Experimental model
To generate the Trem2Y38C/Y38C mouse model, CRISPR/Cas9-mediated insertion of the SNP encoding the Trem2 Y38C variant into the mouse Trem2 gene was performed as previously reported [21]. Briefly, embryos were injected with Cas9, short-guide RNA (sgRNA) and replacement oligo. The relevant sequences are as follows: Trem2 targeted region 3’-TACTGCGGAACTTCGTGACCCCC, sgRNA (antisense) 5’- ATGACGCCTTGAAGCACTGGGGG and replacement oligo 3’- TGTGACGCCTTGAAGCACTGGGGA. The first codon in the replacement oligo corresponds to the SNP encoding the Y38C variant, while the third codon corresponds to a silent mutation that ablates the protospacer adjacent motif (PAM) site, necessary for initial binding of CRISPR/Cas9. To identify mice containing the Trem2 Y38C mutation, Sanger sequencing of founder lines was used to identify mice carrying heterozygous or homozygous Trem2 Y38C SNP. Five founder lines were selected to generate subsequent crosses. SNP-based genotyping (Thermo Fisher) of offspring was performed using the following primers: forward primer: 5’-GCCGGCCAGTCCTTGAG, reverse primer: 5’-CACCAGGCCTTGCGTCT, SNP reporter 1: 5’-CAAGGCGTCATAAGTACA, SNP reporter 2: 5’-AGGCGTCACAAGTACA. Trem2 Y38C variant carrying offspring of the founder lines were maintained on a C57BL6/J (B6) background.
Trem2-/- (JAX stock #027197) and B6 wildtype (WT) mice were obtained from the Jackson Laboratories (JAX stock #000664). Both male and female mice at ages postnatal day 20 (P20) and 6 months were utilized in this study.
To analyze CRISPR/Cas9 editing efficiency, potential off target mutations were predicted using prediction tool Synthego (https://www.synthego.com/). The top 4 predicted mutations were considered for analysis. Genomic DNA was extracted using 50mM NaOH from the tail snips of 3 F9 (mice used for the experiments) Trem2Y38C/Y38C and one WT. Genomic regions with the predicted off-target sites were amplified (Additional file1: Table S1) and Sanger’s DNA sequencing was performed (GENWIZ) (Additional file2: Table S2). Sequences were then analyzed for the predicted mutation. No predicted off-target mutations were detected in the Trem2Y38C/Y38C samples.
Mice were housed in the Indiana University School of Medicine (IUSM) animal facilities, which are accredited by the Association and Accreditation of Laboratory Animal Care. Animals were maintained according to USDA standards and the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Experiments were approved by the IUSM Institutional Animal Care and Use Committee.
Brain extraction and tissue processing
Mice were deeply anesthetized with ketamine/xylazine and perfused with sterile ice-cold PBS, and their brains were removed. For immunohistochemistry, one hemisphere was drop-fixed in 4% PFA in PBS for 24–48 h, transferred to ice-cold 30% sucrose and stored at 4 °C in in PBS. After embedding in OCT Compound (VWR), 30 μm thick sections were obtained on a Leica CM 1950 cryostat. Cortex and hippocampus was microdissected from the other half of the brain, snap-frozen and stored at −80°C until use. Frozen brain tissue (cortex or hippocampus) was homogenized in ice-cold T-PER homogenization buffer (ThermoFisher, 78510) supplemented with protein phosphatase (1:100, P5726, Sigma-Aldrich) and protease inhibitor cocktail (1:100, P8340, Sigma-Aldrich). Homogenates were aliquoted and reserved for protein extraction or RNA extraction.
RNA extraction
Homogenized cortical lysates that were prepared in ice-cold T-per homogenization buffer, as described above, were added to an equal volume of QIAzol lysis reagent (QIAGEN RNeasy kits). RNA was isolated using QIAGEN RNeasy kit as per the manufacturer’s protocol and quantified using NanoDrop (Thermo Scientific).
RNA-seq library preparation
Total RNA from cortices of WT, Trem2Y38C/Y38C and Trem2-/- mice were first evaluated for its quantity, and quality, using Agilent Bioanalyzer 2100. One hundred nanograms of total RNA were used. Ribosomal RNA was removed from total RNA using QIAseq FastSelect rRNA Removal HMR Kit (Qiagen, Catalog# 334387 Human/Mouse/Rat). After the depletion of rRNA, cDNA library preparation was carried out including RNA fragmentation, cDNA synthesis, ligation of index adaptors, and amplification, following the KAPA RNA Hyper Prep Kit Technical Data Sheet, KR0961 – v3.15 (Roche Corporate, Catalog #KK8541). Each resulting indexed library was quantified and its quality accessed by Qubit and Agilent Bioanalyzer, and multiple libraries were pooled in equal molarity. The library pool was then sequenced in 100b paired-end read format on NovaSeq 6000 (Illumina, Inc.). More than 30 million reads per sample were generated and 91% of the sequencing reads reached Q30 (99.9% base call accuracy). A Phred quality score (Q score) was used to measure the quality of sequencing.
Mapping QC and data analysis
The sequencing data were first assessed using FastQC (Babraham Bioinformatics, Cambridge, UK) for quality control. All sequenced libraries were mapped to the mouse genome (mm10) (or to the human genome (hg38)) using STAR RNA-seq aligner (v.2.5) [22] with the following parameter: “--outSAMmapqUnique 60”. The reads distribution across the genome was assessed using bamutils (from ngsutils v.0.5.9) [23]. Uniquely mapped sequencing reads were assigned to mm10 refGene genes (or hg38 refGene genes) using featureCounts (from subread v.1.5.1) [24] with the following parameters: “-s 2 –p –Q 10”. Differential expression and visualization were performed using R Bioconductor package DESeq2 by pair-wise comparison of Trem2Y38C/Y38C versus WT and Trem2-/- versus WT. Counts were normalized and examined for outliers in DESeq2. The list was further filtered based on FDR (P-adj) <0.05 and Log fold changes (logFC), |logFC| < 0.58. All the filtered differentially expressed genes were annotated using Ingenuity Pathway Analysis (IPA) software. Enrichment for Tissue type, Molecular Functions, Cellular Components, and Pathways on the filtered differentially expressed genes were performed using Enrichr web-server tool [25,26]. The smallest P-value indicates the highest degree of enrichment. Volcano plots and heatmaps were plotted using volcanoPlot and pheatmap functions in R.
Western blotting
For protein extraction, homogenates of microdissected cortices and hippocampi were sonicated and centrifuged at 50,000 × g. Protein concentrations were measured using a Bicinchoninic Acid (BCA) assay (Thermo Fisher, 23225), according to the manufacturer’s instructions. Proteins were denatured at 95°C for 10 min in 3X denaturing buffer containing LDS sample buffer and 50mM DTT. 15-20 μg of protein for each sample were loaded onto Novex 4–12% Bis-Tris gels (Invitrogen) and run at 150 V for 1 hr in MES running buffer (Thermo Fischer) and transferred onto PVDF membranes (EMD Millipore) in Tris-Glycine transfer buffer containing methanol at 100V for 2 hours on ice. Membranes were blocked in TBST (Tris-buffered saline with 0.1% Tween 20) containing 5% BSA for 1 hr at room temperature and incubated in the indicated primary antibodies in blocking buffer overnight at 4 °C with shaking: PSD-95 (NeuroMab, 75-028, 1:20,000 ), Synaptophysin (Cell Signaling technology, 5461, 1:20,000), Synapsin 2 (Abcam, ab13258, 1:1000), Homer 1 (GeneTex, 103278, 1:5000), CNPase (abcam, ab6319,1:500), MBP (abcam, ab7349, 1:2000), β actin (Sigma, A1978, 1:200,000). Membranes were then washed in TBST and incubated for 1 hr with appropriate secondary antibody diluted in 5% milk in TBST at room temperature. Membranes were imaged using Chemiluminescence HRP substrate (Millipore). Densitometry was performed using Image J.
Immunohistochemistry
30 μm free-floating tissue sections were subjected to antigen retrieval in sodium citrate buffer (10 mM, pH 6) for 10 min at 95°C. After cooling, sections were blocked in blocking buffer (5% Normal Donkey Serum, 0.3% TritonX-100 in PBS) and incubated with the appropriate primary antibody overnight at 4°C: Iba-1 (Millipore, MABN92 or Wako, 019-19741; both at 1:500). After washing, sections were incubated in corresponding Alexa Fluor-conjugated secondary antibodies (1:500). Sections were mounted with ProLong Gold AntiFade with DAPI (Fisher Scientific). For Trem2 immunofluorescent staining, Tyramide Signal Amplification (TSA) Biotin System kit (PerkinElmer, NEL700A001KT) was used. Briefly, following antigen retrieval (as described above), sections were blocked in TNB blocking buffer at room temperature for 1 hour. Sections were then incubated in primary antibody for TREM2 (R&D systems, AF1729, 1:300) overnight at 4°C. After washing in TNT wash buffer, sections were incubated with anti-sheep biotinylated secondary antibody (Vector laboratories, BA-6000, 1:850)mkj for 1 hour at room temperature. Sections were washed and incubated in Streptavidin-HRP (1:1000). Sections were washed and then incubated in Tyramide solution (1:250) for 4 minutes. After washing, the sections were incubated in Streptavidin Alexa Fluor 488 (Invitrogen, S32354, 1:1000) at room temperature for 1 hour. After washing, sections were blocked and stained for Iba-1 as described above.
Morphological analysis of Iba-1 positive cells was performed on a total of 4 sections (2 medial tissue sections and 2 lateral sections), from 6 mice (equal number of males and females) per genotype. The number of Iba-1 positive cells and percent area of Iba-1 staining were quantified on 10X images of the entire cortex and hippocampus of a section. After thresholding, soma number and total cell area were quantified in a blinded manner using ImageJ. 31-33 microglia per genotype were selected randomly from the cortical images which were binarized and skeletonized using ImageJ Skeletonize plugin, as described previously [27]. Using Analyze Skeleton feature, total number of branches and junctions per cell were quantified for images from cortex. Immunofluorescent images to visualize TREM2 were acquired with the Nikon AR1 Confocal microscope. Maximum intensity of Z-stacks were obtained using 60X Nyquist view images of microglia from similar cortical regions for all the genotypes to confirm the expression of TREM2 in Iba-1 positive cells.
Enzyme linked immunosorbent assay (ELISA)
To quantify total TREM2 protein levels, cortices from WT, Trem2Y38C/Y38C and Trem2-/- were homogenized in lysis buffer (25 mM Tris pH 7.4, 150 mM NaCl, 1 mM EDTA, 5% glycerol, 1% NP-40) and protein concentration was determined by Bicinchoninic Acid (BCA) assay (Thermo Fisher, 23225). F8 Maxisorp Nunc-Immuno Module (Thermo Fisher, 468667) wells were coated with 2µg/ml of the TREM2 capture antibody (R&D Systems, MAB1729) in 0.05M carbonate/bicarbonate buffer (pH 9.6), overnight at 4°C, and blocked with 3% BSA, 0.05% Tween in PBS for 1 hour at RT. TREM2 standards were prepared using recombinant mouse TREM2 protein (R&D system, 9228-T2). Standards, and 500µg of cortical lysates were incubated for 2 hours at room temperature. Wells were washed 4 times with 0.05% Tween in PBS and incubated with 0.25ug/ml of the TREM2 biotinylated detection antibody (R&D Systems, BAF1729) for 1 hour at RT. After washing, samples were incubated with HRP-conjugated streptavidin (PerkinElmer, NEL750001EA, 1;10,000). The samples were washed and incubated with the chromogenic substrate TMB (3,3',5,5'-tetramethylbenzidine) (Pierce TMB Substrate kit, ThermoFisher, 34021). Upon optimal color development, reactions were stopped using 1N HCL and wells were read at 450 nM using the Epoch2 microplate reader (BioTek). For sTREM2 quantification, frozen mouse cortices were subjected to cryogenic grinding in a mortar and pestle. Cortices were further homogenized in ice-cold Tris-buffered saline (TBS; 50 mM Tris pH 7.4, 150 mM NaCl; 10 w/v) using a 26-G needle and cleared by ultracentrifugation (186,000 × g,1 h, 4°C). Protein concentration was determined using BCA assay and 140 µg of protein was added to the wells. sTREM2 levels were quantified using the ELISA protocol described above.
Quantitative RT-PCR (qRT-PCR)
cDNA was prepared from 700 ng of RNA using the High Capacity RNA-to-cDNA kit (Applied Biosystems, 4387406) and quantitative PCR (qPCR) was performed using the QuantStudio 6 Flex (Applied Biosystems). Murine Trem2 mRNA quantification was performed using following primers: Forward 5'- CCTCTCCACCAGTTTCTCCT -3' and Reverse 5'- CAGTGCTTCAAGGCGTCATAAG -3'. Taqman assays used: Mbp (Mm01266402_m1), Olig2 (Mm01210556_m1), Mobp (Mm02745649_m1). Relative gene expression was determined using the ΔΔCT method and graphed as fold change relative to murine GAPDH.
Brain slice preparations
Mice (6-month-old) were deeply anesthetized using isoflurane and sacrificed by rapid decapitation. Brains were removed and placed in a 95% O2 and 5% CO2-saturated, ice-cold tissue cutting solution (194 mM sucrose, 30 mM NaCl, 4.5 mM KCl, 1 mM MgCl2, 26 mM NaHCO3, 1.2 mM NaH2PO4, 10 mM glucose). Sagittal slices containing hippocampus were cut to a thickness of 350 µm using a vibratome (Leica VT1200S) and transferred to an artificial cerebral spinal fluid (aCSF) (124 mM NaCl, 4.5 mM KCl, 1 mM MgCl2, 26 mM NaHCO3, 1.2 mM NaH2PO4, 10 mM glucose, 2 mM CaCl2) saturated with 95% O2 and 5% CO2 at 30°C for 1 hr. Slices were then kept at room temperature until recording.
Field potential recordings
Field excitatory postsynaptic potential (fEPSP) recordings were performed on brain slices containing the stratum radiatum of hippocampal CA1 region in a chamber that was continuously perfused with aCSF at a rate of 1-2 mL/min in 5% CO2 at 30-32˚C. Slices were visualized using an Olympus BX51WI microscope (Olympus Corporation of America). Extracellular recordings were conducted using a Multiclamp 700B amplifier (Molecular Devices). Schaffer collaterals in the hippocampus were stimulated with tungsten stereotrodes (MicroProbes for Life Science). To record responses from hippocampal CA1 neurons, filament-containing borosilicate micropipettes (World Precision Instruments) were prepared using a P-1000 micropipette puller (Sutter Instruments) and filled with 1 M NaCl. A Constant current Isolated Stimulator (Digitimer) was used to produce electrical stimulation.
Input-output (I/O) curves were recorded to determine the maximum stimulus-response, which was determined by calculating the slope of the response (mV/ms). Using the stimulation strength that produced 50% of the maximum intensity, a stable baseline was observed for 10 minutes before recording the pair pulse ratio (PPR) and field excitatory postsynaptic potential (fEPSPs). The PPRs were obtained every 20 seconds for a total of 3 minutes. The fEPSPs were acquired across a 70-minute time window: 10 min of pre-stimulation baseline and 60 minutes post-stimulation. Long term potentiation (LTP) was induced using a high-frequency protocol: 4 trains of 10 pulses, every 20 seconds at 100 Hz. The investigators were blinded to genotype.
Statistical analysis
False discovery rates (P-adjusted) and P value were calculated using the Benjamini & Hochberg method [28] and Wald test, respectively, within DESeq2. Statistical analyses were performed using Prism (GraphPad) for rest of the data. Statistical significance was determined using a one-way or two-way ANOVA with Bonferroni or Tukey’s post hoc analysis, with P values less than 0.05 considered as significant. Fisher’s exact test were used for contingency tables. Each ‘N’ represents a single biological replicate and details for each experiment can be found in the figure legends. Data shown are representative of at least two independent experiments and are represented as the mean and error bars show the standard error of the mean (SEM) unless otherwise noted.