Animal treatment and grouping
Sprague Dawley male rats (175-225 g) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). After one week of adaptive feeding, the rats were randomly divided into normal control (NC) group (normal saline + normal diet group, n = 6) and DN group (high glucose (HG) and high fat diet group, n = 60). Rats in the DN group were intraperitoneally injected with streptozotocin (STZ, 0.1 mol/L citric acid buffer, 30 mg/kg). After 72 hours, the blood glucose concentration was measured by a glucometer (Roche Diagnostics, Indianapolis, IN, USA). When the blood glucose level was equal to or higher than 16.7 mmol/L for three consecutive times, the diabetes model was established successfully (if the blood glucose level of rats was lower than 16.7 mmol/L, STZ was injected repeatedly, and the amount of each injection was 20 mg/kg). The successful DN model was randomly assigned into 10 groups, 6 rats in each group: activator protein 1 (Ap1)-NC group, Ap1-overexpression (OE) group, TET1-NC group, TET1-OE group, Nrf2-NC group, si-Nrf2 group, Ap1-OE + TET1-NC group, Ap1-OE + TET1-OE group, TET1-OE + Nrf2-nc group, TET1-OE + si-Nrf2 group. Except for the NC group with normal diet, rats in the other groups were all fed with high fat diet, with free diet during the whole experimental period, and all rats were measured for weight and blood glucose at a fixed time every week. The following analysis was conducted 10 weeks later.
Biochemical analysis
At the end of the 10th week, the rats in each group were placed in the metabolic cages, and urine within 24 hours was collected from 6:00 am to 6:00 am of the next day. The concentration of microprotein in 24-hour urine was detected by using UAE assay kits (Nanjing Jing Bioengineering Institute, China) and colorimetry. One mL of tail vein blood was taken for measurement of serum creatinine (Src) and blood urea nitrogen (BUN) by Hitachi 7180 automatic biochemical analyzer (Hitachi, Japan).
Periodic acid-schiff (PAS) staining
After fasting for 12 hours, rats were anesthetized by intraperitoneal injection of 1% pentobarbital sodium (90 mg/kg). The left kidney of rats was dissected, and the renal vein was washed with precooled normal saline. After the left kidney became white, it was taken out and fixed for 2 hours with 4% paraformaldehyde. The renal tissue was embedded in paraffin and sliced at 4 μm. PAS kit (BaSO diagnostics Inc., China) was applied to evaluate the renal pathological changes. The proliferation of mesangial cells and glomerular basement membrane were observed under the microscope (BX51, Olympus, Tokyo, Japan). Then the rats were euthanized by intraperitoneal injection of 1% pentobarbital sodium (150 mg/kg).
Cell culture and treatment
Human mesangial cells (HMCs) were purchased from Cell Bank of Chinese Academy of Sciences (catalog numbder TCHu 104, Shanghai, China), and cultured in Dulbecco's modified Eagle's medium (DMEM) (Thermo Fisher, USA) containing 10% fetal bovine serum (Australian Biosearch, Australia) and 1% antibiotic (Thermo Fisher) at 37°C with 5% CO2, followed by Hg treatment. HMCs were cultured in 25 mM D-glucose (Amresco, Solon, OH, USA) for 48 hours and used for subsequent analysis.
Enzyme-linked immunosorbent assay (ELISA)
After 48 hours of transfection, the cells were seeded into 24-well microplates with 1 × 106 cells/well at 37°C with 5% CO2 for 24 hours. After centrifugation at 1800 g for 1 minute, the supernatant was collected. Rat IL-6 ELISA Kit (ab100772, Abcam) and rat TNF-α ELISA Kit (ab100785, Abcam) were used to detect the expression of TNF-α and IL-6 in the supernatant. The antibody concentration was adjusted to 10 ug/mL and added to the microplates overnight at 4°C. Then cells were supplemented with 0.2 mL diluted plasma for 1 hour at 37°C, followed by 3 times of PBS washes. Afterwards, cells were treated with 0.2 mL enzyme-labeled antibody solution at 37°C for 1 hour, 0.2 mL substrate at 37°C for 30 minutes, and finally added with 0.05 mL H2SO4 to terminate the treatment. Optical density (OD) value was determined by a microplate reader (Thermo Fisher).
Western blot (WB)
Total protein of tissues and cells was extracted by RIPA lysis buffer, and the protein concentration was examined by a BCA protein quantitative kit (Beyotime Institute of Biotechnology). After denaturation by boiling, the protein samples (40 μg per lane) were separated with 10% SDS-PAGE and transferred to polyvinylidene difuoride membranes (DuPont Nen, USA). After being sealed with 5% skimmed milk for 1 hour, the membranes were incubated for 16 hours at 4°C with anti-fibronectin (ab45688, 1:400, Abcam, UK), anti-collagen IV (bs1072, 1:400, BioWorld Technology Inc., USA), anti-TET1 (Abcam, 1:1000), anti-Ap1 (Abcam, 1:5000), and anti-Nrf2 (Abcam, 1:2000) antibodies, and then probed with goat anti-rabbit IgG antibody (ab205718, 1:5000) for 4 hours. Protein bands were soaked in enhanced chemiluminescence (pierce biotechnology, Bonn, Germany) and analyzed using ChemiDoc™ XRS imaging system (Bio-rad, Hercules, CA, USA).
Microarray analysis
The kidney tissues of NC rats and DN rats were homogenized in TRIzol, and then extracted with chloroform. After chloroform extraction and centrifugation, a small amount of aqueous phase (1.2 mL) was adjusted to 35% ethanol and added to RNeasy column. The RNA was eluted according to the RNaeasy kit (Qiagen, CA), and the integrity of RNA was checked by electrophoresis, and the concentration was determined by an ultraviolet spectrophotometer. cDNA was synthesized by the Superscript™ III reverse transcription (Invitrogen) and hybridized with Affymetrix Rat Genome 430 2.0 array (Affymetrix, CA). A 200 μL mixture containing 15 μg cRNA was loaded onto the chip. The chip was hybridized at 45°C for 16 hours and then put into Affymetrix GeneChip scanner for scanning analysis. The differential expression genes were screened and a heatmap was plotted according to |FoldChange| > 2 and P < 0.01.
Quantitative real-time polymerase chain reaction (RT-qPCR)
Total RNA of tissue and HMCs was prepared by TRIzol reagent (Invitrogen). The Superscript™ III reverse transcription (Invitrogen) was used for reverse transcription. The Universal SYBR Green Master kit (Roche, Tokyo, Japan) was utilized for RT-qCPR. The expression was calculated by the 2−ΔΔCT method. The forward primer of TET1 was TGAGAACTGTCCTTACGTGACC, and the reverse primer was AGAGCACCAAGCGGCTC. The forward primer of Ap1 was 5’-AGGGTACTACAAGAGAC-3’, and the reverse primer was 5’-TCAGGCGAGCGATAACC-3’. The forward primer of Nrf2 was 5’-GCACCGCATTTACACCAATG-3’, and the reverse primer was 5’-TGCTTGCTGATCCACATCTG-3’. The forward primer of β-actin (loading control) was 5’-GATAAAGACCTACAGGG-3’ and the reverse primer was 5’-CATCCGTCTCTATGCCAAC-3’.
Cell counting kit-8 (CCK-8) assay
Each well in the 96-well microplate was added with 100 μL media containing 10% FBS. Cells in logarithmic growth period were seeded into the microplate at 1 × 103 cells/well at 37°C with 5% CO2 for 24 hours. CCK-8 kit (AbMole) was used to determine the cell activity. Each well was supplemented with 10 μL CCK8 solution at 37°C for 1 hour. The absorbance at 450 nm was measured by a microplate reader.
Flow cytometry
After 48 hours of transfection, cells were detached using 0.25% trypsin (excluding EDTA) (Shanghai Yubo, China) and collected into the flow tubes. After three times of cold PBS washes, the cells were treated with annexin V-FITC/PI retaining kit (BD Biosciences, USA). After that, 1 × 106 cells were resuspended in every 100 μL staining solution, and the cells were vibrated evenly. After incubation for 15 minutes, they were placed on FACScan flow cytometer (BD Biosciences) to detect apoptosis.
Chromatin immunoprecipitation (ChIP) assay
HMCs were cultured to 70-80% confluency, and fixed for 10 minutes by 4% paraformaldehyde to make the DNA and protein fixed and cross-linked. After cross-linking, they were randomly fragmented into pieces of appropriate sizes using a sonicator, and centrifuged at 13000 rpm at 4°C for 5 minutes to collect supernatant. The supernatant was divided into two parts and incubated overnight at 4°C with rabbit anti-IgG (ab109489, 1:100, Abcam, Cambridge, UK) and target protein specific antibodies Ap1 (1:1000, ab21981, Abcam), TET1 (1:2000, ab220867, Abcam). The endogenous DNA protein complex was precipitated by protein agarose/Sepharose, and the nonspecific complex was washed. The DNA was de-crosslinked overnight at 65°C and purified by phenol/chloroform. The enrichment of Ap1 in TET1 promoter and the enrichment of TET1 in Nrf2 promoter were examined.
Statistical analysis
SPSS 22.0 statistical software (IBM Corp. Armonk, NY, USA) was used to process the data. All experiments were repeated 3 times independently. All the data were presented as mean ± standard deviation. The comparisons between two groups were done by the unpaired t test and the comparisons among multiple groups were conducted by the one-way or two-way analysis of variance (ANOVA), followed by Tukey’s multiple comparison test. A probability value of P < 0.05 indicated the difference was statistically significant.