Inhibitory Effects of the Spore-forming Bacillus spp. on the Expression Levels of eae, luxS, flu, and ctxM Genes in E. coli Isolates

doi:10.21203/rs.3.rs-33946/v3

Download PDF

Research article

Inhibitory Effects of the Spore-forming Bacillus spp. on the Expression Levels of eae, luxS, flu, and ctxM Genes in E. coli Isolates

https://doi.org/10.21203/rs.3.rs-33946/v3

This work is licensed under a CC BY 4.0 License

Version 3

posted

You are reading this latest preprint version

Background

Escherichia coli antibiotic resistance is one of the major health problems in many countries. Nowadays, researchers are focusing on novel approaches for the treatment of E. coli infections, including the use of spore-forming probiotics for their high stability in the harsh gastrointestinal (GIT) environment.

Methods

Initially, 300 stool samples were collected from patients with gastrointestinal infections admitted to Imam Khomeini Hospital in Tehran. Then, diagnostic tests were performed to detect E. coli isolates on the samples. A DNA test was applied to examine the presence of ctxM, luxS, eae and flu in the samples. Afterward, the effect of native and commercial probiotics of Bacillus subtilis and Bacillus coagulant was investigated on the expression of the studied genes.

Results

Genes of flu, eae, luxS, and ctxM which are involved in bacterial attachment, biofilm formation, signaling, and antimicrobial resistance were existing in four out of 40 E. coli isolated among patients suffering from diarrhea. The expression levels of flu, luxS, eae, and ctxM genes decreased significantly (p-value < 0.05) after co-culture of E. coli with B. subtilis ATCC 6633 and broiler-derived B. subtilis. Both broiler-derived B. subtilis and broiler-derived B. coagulans have a significant effect on all the studied genes.

Conclusions

The broiler-derived isolates had a greater capacity to decrease the expression of these genes than the standard strains, proposing their adoption for dietary supplementations.

General Microbiology

Applied & Industrial Microbiology

probiotics

spore-forming Bacillus spp.

Gene Expression

Escherichia coli normally colonize the gastrointestinal tract of human infants and form the normal intestinal microflora over time. These commensal E. coli strains can lead to infections following compromising the host immune system. In fact, several E. coli clones have evolved by acquiring specific virulence traits, allowing them to cause a wide array of infections, including the enteric disease, urinary tract infections (UTIs), and sepsis [1,2].

Similar to other mucosal pathogens, E. coli strains follow a multi-step pathogenetic process, starting with the colonization of a mucosal site and continue with host defense evasions, multiplication, and host injury. Although pathogenic E. coli strains often remain extracellular, EIEC is an intracellular pathogen with the ability to invade and replicate inside macrophages and epithelial cells. In terms of other E. coli strains, internalization by epithelial cells is possible at a low level, but no evidence exists regarding their intracellular replication [3].

The pathogens studied in this research include a pathogenicity island called locus of enterocyte effacement (LEE), which contains all the essential genes that cause attachment-effacing (A/E) lesions on intestinal epithelial surfaces by activating a type III secretory system [4]. A/E lesions are characterized by loss of microvilli and accumulation of cytoskeletal compounds to form pedestal structures on the host cell that act as an anchor for bacteria [5]. The eae gene on the LEE encodes an adhesin that is a surface protein called intimin, which is responsible for attaching bacteria to the gut and causing specific damage called effacing/attaching and cup-shaped structures in the intestinal epithelial cells [6].As an antigen encoded by the flu gene, Arg43 is a surface autotransporter protein with the ability to enhance cell-to-cell adhesion and is involved in the formation of the three-dimensional structure of biofilms. Numerous studies have shown the correlation between increased levels of flu gene expression and the formation of E. coli biofilm on abiotic levels [7,8]. CTX-M, SHV, VEB, TEM, and GES enzymes are the main ESBLs of class A, among which the CTX-M family had the highest number of variants described in recent years [9]. The term “CTX-M pandemic” has been used to describe this explosive dissemination of CTX-Ms worldwide [10]. luxS gene plays a role in the development of E. coli biofilm independently of autoinducer-2 and helps the adaptation to various situations. LuxS has been suggested to be an interspecies signal with a crucial role in the physiologic functions of bacteria by contributing to quorum sensing (QS) [11].

The production of Extended–Spectrum Beta-Lactamase enzymes (ESBL) is one of the most frequent resistance mechanisms adopted by E. coli strains [12]. Antimicrobial resistance has therefore necessitated the development of other therapeutic methods to combat E. coli infections. In this regard, one of the safest ways is the exploitation of probiotic bacteria. For many years, Lactobacilli and Bifidobacteria have been used to treat gastrointestinal tract (GIT) diseases [13]. However, these bacteria are sensitive to physiological conditions, such as pH of the stomach and bile salts. In addition, various conditions of production, storage, and transportation may affect their bioavailability [14]. To overcome these hurdles using spore-forming Bacillus spp. as probiotics have recently come to notice. These bacteria have an innate ability to produce a wide number of enzymes and vitamins and are highly tolerant of the harsh environment of GIT. Moreover, Bacillus spp. are ideal candidates for probiotics owing to their stability during food processing and storage [15]. Considering the merits of Bacillus spp. as probiotics, this study aimed to investigate the effects of B. coagulans and B. subtilis against the expression levels of eae, flu, ctxM, and luxS genes to achieve a deeper insight into the mechanisms by which spore-forming Bacillus spp. can affect E. coli infections.

Sample collection

The present study conducted on 300 patients with E. coli-related gastrointestinal diseases who were admitted to Imam Khomeini Hospital in Tehran. The stool samples of the patients were transferred to the laboratory under sterile conditions and subjected to microbiological analysis. Considering the value of P = 0.91 in this study, the sample size is calculated with 95% accuracy. In order to perform microbiological testing in hospital laboratories, clinical specimens were first cultured on two environments: blood agar base and McKenzie agar base. After incubation at 37° C for 24 hours, a total of 5 lactose-positive and 2 lactose-negative colonies were selected from McKenzie base and cultured separately in TSI medium and incubated at 37 ° C for 24 hours [16].

Detection of E. coli bacteria

The detection of E. coli bacteria was performed using biochemical tests of glucose degradation in various medium including TSI medium, urease medium, SIM medium to evaluate H2S production, presence of tryptophanase enzyme in bacteria, and reduction of tryptophan to indole amino acid, Simon Citrate Agar medium, Lysine Decarboxylase base, and Methyl Red-Voges Proskauer medium. In the Methyl Red-Voges Proskauer base, both MR and VP tests can be performed for either strain. In order to store E. coli strains for the study tests, the bacteria were first cultured in vials containing tryptic soy broth (TSB) medium. After incubation at 37 °C, in the case of bacteria grow, verified E. coli strains were stored in Tripticase soy Broth with glycerol in a freezer at -20 ° C for later testing [5].

Primer design and polymerase chain reaction (PCR) assay

To confirm the presence or absence of eae, flu, luxS, and ctx-M genes, specific primers were designed using the Primer-BLAST software (Table 1). Total genomic DNA of E. coli isolates was extracted using a DNA Extraction kit (Roche, Mannheim, Germany) according to the protocol recommended by the manufacturer. To investigate the presence of eae, flu, luxS, and ctx-M genes, the PCR assay was performed in a volume of 25 μl in a DNA thermal cycler (Bio-Rad, USA) according to the following reaction conditions: initial denaturation at 94 °C for 5 min, 33 × denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 30 s, and final extension at 72 °C for 5 min. No template control (NTC) was used as a negative control. Finally, amplicons were observed following gel electrophoresis, and sent for sequencing after purification.

Table 1. Characteristics of the primers used in this study
Reference	Product size	Sequence (5’ à 3’)	Target gene
This study	73 bp	F; ACTAACTTCCAGTTCCGCCG R; AGTCGCTTTAACCTCAGCCC	eae
[17]	113 bp	F; ACCGCCGATAATTCGCAGAT R; TGCTTATCGCTCTCGCTCTG	ctxM
[18]	124 bp	F; ACGGTAAATGGCGGACTGTT R; CACGGATGGTCAGGGTATCG	flu
[19]	113 bp	F; GTGCCAGTTCTTCGTTGCTG R; GAACGTCTACCAGTGTGGCA	luxS
[20]	190 bp	F;CATTGACGTTACCCGCAGAAGAAGC R; CTCTACGAGACTCAAGCTTGC	16srRNA E. coli
This study	165	F;AAAAGACATTGCCACCCCCA R;GGACCGATTTCAACAACGCC	16srRNA B. coagulans
This study	108	F;TGTTGATCACGCGGAAGTGA R;AATGCCACGACCTTTTTCGC	16srRNA B. subtilis
F: Forward; R: Reverse

Isolation of spore-forming probiotics from gastrointestinal tracts of broilers

A total of 10 broilers aged 6-12 months were chosen that did not take antibiotics or probiotics during their lifetime. After the slaughter of birds in sterile conditions, intestinal contents were collected and diluted 1:1 (wt:vol) in buffered peptone-water (Oxoid) and resuspended by vigorous vortexing until obtaining an evenly distributed suspension. Then, aerobic spore-forming isolates were selected by heat (80 °C) and ethanol treatments. Ethanol treatment was performed by diluting the primary suspension (1:1) in ethanol (final concentration of 50% vol/vol) and incubation at room temperature for 1 h. Aliquots (0.1 ml) were cultured on nutrient agar plates and incubated at 37°C for 24-48 h. Colonies were picked randomly and purified by re-streaking on Luria-Bertani agar plates. The laboratory strain B. subtilis ATCC 6633 was used as a control throughout the experiments. Isolates were identified using the API 50 CHB strips according to the manufacturer's protocols (bioMérieux), and catalase and hemolysis tests were carried out to confirm the identified isolates. Finally, the identified B. subtilis and B. coagulans were selected for further analysis. Moreover, to confirm the production of spores, B. subtilis and B. coagulans isolates were grown on Difco sporulation medium (DSM) for 24-48 h. Then, cultures were purified as described by Henriques et al. ^[21] and stored in Difco heart-infusion broth (HIB) with 30% glycerol at -80°C for future use.

Molecular detection of spore-forming probiotics

Total genomic DNA of the isolated spore-forming probiotics was extracted using the pepGOLD Bacterial DNA kit (Roche, Mannheim, Germany) according to the manufacturer’s protocol. For molecular identification of the isolated spore-forming probiotic bacteria, 16srRNA gene was investigated using the specific primers designed by the Primer-BLAST software (Table 1). PCR assay was performed in a DNA thermal cycler (Bio-Rad, USA) in a volume of 25 μl according to the following reaction conditions: initial denaturation step at 94 °C for 5 min, 30 × denaturation at 94 °C for 30 s, annealing at 61 °C for 30 s, extension at 72 °C for 30 s, and final extension at 72 °C for 7 min. No template control (NTC) was used as a negative control. After observing PCR products following gel electrophoresis, amplicons were finally sent for sequencing after purification.

Probiotic characterization of isolated bacterial strains

Resistance of vegetative B. subtilis and B. coagulans to bile salts and simulated gastric conditions was determined using overnight LB cultures of B. subtilis and B. coagulans isolates. To this end, he tolerance of Bacillus spores to bile salts and simulated gastric conditions was tested as previously explained by Duc et al.^[22] with some modifications. Briefly, about 108-109 spores per ml were suspended in an isotonic buffer containing 0.76% H2PO4, 0.6% [NH4]2SO4, 0.1% trisodium citrate, and 1.24% K2HPO4, also known as Bott and Wilson salts (pH 6.7) as well as 0.2% bile salts consisting of 50% sodium deoxycholate and 50% sodium cholate or in 0.85% NaCl (pH 2), containing 1 m pepsin (Sigma) and incubated at 37°C with shaking. Aliquots were collected immediately and following 30 min-1 h for assessing acid tolerance and 1-3 h for assessing bile tolerance. After direct plating of adequate dilutions in isotonic buffer onto LB plates CFU was determined following incubation at 37°C for 24 h. Control samples were suspended only in the isotonic buffer or 0.85% NaCl.

Bacterial co-culture assay

Co-culture of the two Bacillus spp. strains with E.coli isolates harboring all the studied genes (luxS, flu, ctxM, and eae) were performed to determine changes in expression levels of the studied virulence genes in E. coli strains. Briefly, overnight cultures of B. subtilis and B. coagulans were centrifuged, the supernatant was collected, and after filtering, the two strains were inoculated individually in the tubes containing 5 ml of nutrient broth. Then, overnight cultures of E. coli isolates were also inoculated in each tube and once these cultures were set up, the tubes were incubated at 37 ºC under microaerophilic conditions. Each strain was also cultured alone as a control. To determine the effects of B. subtilis and B. coagulans on the expression levels of the studied virulence genes in E. coli, samples were withdrawn at the logarithmic growth phase (OD = 0.08-0.1). Experiments were carried out three times independently.

Real time-PCR analysis

Real time-PCR (RT-PCR) experiment was carried out to investigate the expression of the studied virulence genes in E. coli after the co-culture assay. Briefly, after the logarithmic growth phase, 1 ml of tube content was collected for RNA extraction using commercially available kits (QIAGEN RNeasy Mini kit). Samples were treated with Turbo DNase (Ambion, Grand Island, NY, USA) to eliminate remaining genomic DNA whose absence was confirmed using PCR and running samples on a 1% agarose gel. The quality of total RNA was assessed using the NanoDrop 1000 (Thermo Fisher Scientific, Waltham, MA, USA). Complementary DNA (cDNA) was synthetized using random hexamers (Applied Biosystems, CA, USA) and SuperScript II Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA) according to the recommended protocols.

Finally, quantitative RT-PCR was performed in a Rotor-Gene thermal cycler (Corbett 6000, Australia) using the SYBR Green method (AccuPower Green Star PCR Master Mix, Bioneer, Korea). Thermal cycling consisted of an initial cycle of 95 °C for 10 min and 40 cycles of 95, 58 , and 72 °C for 12 s, 25 s, and 30 s, respectively. 16s rRNA was used as the internal reference gene. After confirming the absence of primer dimers, RT-PCR results were analyzed by the 2^{–(ΔΔC(t))}method [23]. A P-value less than 0.05 was considered statistically significant.

Statistical analysis

In order to evaluate the significant probiotic effects of properties of B. subtilis and B. coagulans on the expression of flu, eae, luxS, and ctxM genes in E. coli isolates, one sample t-test was performed using SPSS v. 24 at a significe level of p-value < 0.05.

Isolation of E. coli from fecal samples and the presence of the studied genes

Of 300 fecal samples obtained from patients with diarrhea, 40 were positive for E. coli. The bacterial strains were identified and confirmed by cultivation of samples on MacConkey agar and EMB agar, in addition to performing complementary biochemical tests, including MR/VP, consumption of citrate, production of urease and lysine decarboxylase, and production of ornithine. The presence of flu, luxS, eae, and ctxM genes in clinical E. coli isolates was confirmed through designing specific primers and PCR assay (Fig. 1). According to the results of amplification assay, the prevalence rates of luxS, flu, ctxM, and eae genes were 35% (n=14), 62.5% (n=25), 37.5% (n=15), and 17.5% (n=7), respectively. Among these, four E. coli isolates carried all the flu, luxS, ctxM and eae genes.

Isolation of spore-forming Bacillus spp. from the intestinal content of broilers

Isolates showing positive catalase test were differentiated from the anaerobic spore-forming Clostridium spp. Moreover, isolates showing no hemolysis on 5% sheep blood agar were considered as Bacillus spp. Isolates showing biochemical catalase production, gelatin hydrolysis, motility, MR-/VP+, no urease production, citrate consumption, and fermentation of arabinose, cellobiose, fructose, glucose, glycerol, glycogen, inositol, maltose, mannitol, mannose, starch, sucrose, xylose, and trehalose were confirmed biochemically as Bacillus spp. B. subtilis ATCC 6633 and B. coagulans MTCC 5856 were used as controls. According to the results of biochemical and microbiological tests and PCR, one B. subtilis and one B. coagulans were isolated from the intestinal content of broilers (Fig. 2).

Acid and bile tolerance of Bacillus cells

The survival rates of B. subtilis and B. coagulans cells were evaluated after exposure to both simulated gastric conditions and bile salts. According to results of the CFU measurements, both B. coagulans [CFU of 8.8 × 10⁸ (pH 2) compared to CFU of 5.5 × 10⁸(pH 7)] and B. subtilis [CFU of 7.4×10⁶(pH 2) compared to CFU of 6.3×10⁶ (pH 7)] were resistant to 1 mg/mL of pepsin, 1 mg/mL of trypsin, 0.2% bile salts, and pH 2.

Expression levels of flu, luxS, eae, and ctxM genes in E. coli after co-culture with B. coagulans and B. subtilis isolates

After co-culture of E. coli with B. coagulans MTCC 5856 and broiler-derived B. coagulans, flu expression showed 1.4 and 2 fold decrease, respectively, while co-culture of E. coli with B. subtilis ATCC 6633 and broiler derived B. subtilis led to 2.7 and 2.1 fold decrease in flu gene expression, respectively. In case of luxS gene, co-culture of E. coli with B. coagulans MTCC 5856 and broiler-derived B. coagulans as well as with B. subtilis ATCC 663 and broiler-derived B. subtilis resulted in 3.3, 3.6, 1.1, and 1.4 fold decreased expression. Similar to luxS and flu genes, decreased expression of eae gene was observed following co-culture of E. coli with either B. coagulans or B. subtilis. In fact, after separate co-culture of E.coli with either of the B. coagulans MTCC 585, broiler-derived B. coagulans, with B. subtilis ATCC 6633 and broiler-derived B. subtilis, luxS expression showed 1.8, 1.5, 3.3, and 3.8 fold decrease. ctxM expression in E. coli after inoculation with B. coagulans MTCC 585 and broiler-derived B. coagulans reduced 2.7 and 1.7 fold, while its expression showed 2.8 and 2.2 fold decrease following co-culture with B. subtilis ATCC 6633 and broiler-derived B. subtilis, respectively (Fig. 3).

The expression of flu, luxS, eae, and ctxM genes decreased significantly (p-value < 0.05) after co-culture of E. coli with B. subtilis ATCC 6633 and broiler-derived B. subtilis. However, the broiler-derived B. subtilis showed a greater effect on the expression levels of eae and luxS. B. coagulans MTCC 5856 and broiler-derived B. coagulans also led to significant decreases in expression levels of all the studied genes (p-value < 0.05), while the standard strain had a greater impact on the expression of ctxM and eae than the broiler-derived strains. A comparison on the results of the expression levels of the studied genes indicated that B. subtilis had a more substantial effect on the reduced expression levels of eae, flu, and ctxM than B. coagulans (Table 2).

E. coli strains are considered as harmless commensal bacteria; however, several strains have gained the ability to cause infections in human hosts. These pathogenic variants have obtained a variety of virulence factors that confer environmental adaptations and pathogenicity [24]. Moreover, these pathogenic variants have adopted several mechanisms to resist antibiotic therapy with the production of beta-lactamase enzymes being the most common strategy [25]. Therefore, finding novel therapeutic approaches to fight E. coli infections seems to be necessary. In this regard, using the probiotic properties of various bacteria has become an interesting subject in recent years [26]. Recently, researchers have focused on developing drugs based on more resistant bacterial species due to the antagonistic environment of the human gastrointestinal tract [27]. Spore-forming Bacillus spp. are one of these bacteria with high levels of tolerance to harsh conditions that are currently being used in dry probiotic products due to their ability to survive in conditions of high or low temperatures, aridity, and high oxygen levels [28].

Based on the studies carried out by Fijan ^[29] because of the probiotic properties of Bacillus spp such as improvement of immunity systems and the prevention of GIT disorders, it's used for the treatment of diarrhea and irritable bowel syndromes [30]. It's while limited studies have focused on the effects these probiotic bacteria may have on the virulence factors of gastrointestinal pathogenic bacteria including E. coli. In accordance with the prevalence rates of flu (62.5%), eae (17.5%), luxS (35%), and ctxM (37.5%) genes in four E. coli isolates, it could be noted that they are very critical in bacterial pathogenicity. After determining the tolerance of B. subtilis and B. coagulans to the simulant GIT environment, PCR assay was utilized for the molecular confirmation of B. subtilis and B. coagulans isolates. According to the results, the studied B. subtilis and B. coagulans were tolerant to low pH (2), 0.2% bile salts, and gastric enzymes, including pepsin and trypsin, suggesting their suitability for probiotic use. As a result of examining the effects of B. coagulans and B. subtilis on the expression levels using the RT-PCR method, it was observed that, the expression levels of all the studied genes decreased significantly after co-culture of E. coli isolates harboring these genes with each of B. subtilis ATCC 6633 and B. coagulans MTCC 5856, as well as broiler-derived B. subtilis and B. coagulans strains. These results reveal the important roles of B. subtilis and B. coagulans isolates in reducing the expression of genes involved in the virulence and antimicrobial resistance in E. coli isolates. Moreover, since broiler-derived isolates showed similar to or even better effects than the standard strains, gut microbiota of broilers can be exploited as suitable sources of these probiotic bacteria in case of unavailability of commercial strains [11].

Furthermore, the results indicated that B. subtilis had a greater influence on the expression levels of eae, ctxM and flu while B. coagulans showed a greater influence on the expression levels of luxS. These results suggest that B. subtilis mostly affects the expression of genes involved in attachment, biofilm formation, and antibiotic resistance, whereas B. coagulans has a greater potential to reduce the expression of genes involved in bacterial quorum sensing, proposing the different capabilities of these probiotic bacteria and different pathways they may adopt to combat bacterial pathogens.

Several studies have shown the probiotic properties of spore-forming Bacillus spp. on E. coli infections. Guo et al.^[31] collected a total of 124 intestinal samples from broilers and isolated six spore-forming Bacillus spp. with the ability to inhibit E. coli K88 and E. coli K99. Of this isolated Bacillus spp., B. subtilis MA139 showed great tolerance to pH2 and 0.3% bile salts, with the highest activity against E. coli strains by co-culture method. In another study by Kim et al.^[32] dietary supplementation of B. subtilis DSM 25841 reduced the E. coli F18 infection significantly. Overall, they showed a positive influence of this probiotic microorganism on the promotion of health after infecting pigs with pathogenic E. coli . Also, Lin et al. revealed the effect of B. coagulans on the intestinal microbiota of broilers. In their study, probiotic supplementation with 0.02% and 0.04% B. coagulans led to a significant increase in Lactobacillus counts and a significant reduction in E. coli counts of duodenum and cecum [33]. The effects of spore-forming Bacillus spp. on the expression of virulence genes and beta-lactamase genes in E. coli were not found in the literature. However, Medellin-Pena et al. showed decreased expression of autoinducer-2 and several genes associated with virulence in E. coli O157: H7 (EHEC) following exposure to L. acidophilus. They suggested the role of L. acidophilus as an inhibitor of quorum sensing in EHEC O157 strains [34].

In conclusion, the current study indicate the capacity of broiler-derived B. coagulans and B. subtilis to significantly reduce the expression of genes involved in bacterial attachment, biofilm formation, quorum sensing, and antibiotic resistance in E. coli isolates. Standard strains of these spore-forming Bacillus spp. also showed the same effects. However, B. coagulans strains had a greater potential to reduce the expression of genes involved in quorum sensing while B. subtilis showed a comparatively greater ability to reduce the expression of genes involved in attachment, biofilm formation, and antibiotic resistance, suggesting the different mechanisms adopted by probiotics to combat E. coli infections. Moreover, the broiler-derived isolates showed a greater capacity to reduce the expression of these genes than the standard strains, proposing their large-scale usage in dietary supplementations. However, further studies are required to clarify the effects of these spore-forming bacteria on E. coli infections in vivo and their possible influences on lactose tolerance, nutritional absorption, and reduced cholesterol levels.

- Ethics approval and consent to participate

I understand that in any report on the results of this research my identity will remain anonymous.

- Consent to publish

All authors are giving permission to publisher to publish this research.

- Availability of data and materials

The anonymized patient-level data used for this project cannot be shared for reasons of information governance.

- Competing interests

I declare that I have no significant competing financial, professional, or personal interests that might have influenced the performance or presentation of the work described in this manuscript.

- Funding

We will provide funding for publication processing charges.

- Authors' Contributions

MBS designed the study, JGK. ZE carried out the experiments, and ZE and MG wrote the manuscript under supervision of MS. All authors read and approved the manuscript.

- Acknowledgements

The authors thank all who helped us at the Department of Microbiology, Fars Science and Research Branch, Islamic Azad University, Fars, Iran, and Department of Microbiology, Shiraz Branch, Islamic Azad University, Shiraz, Iran.

Croxen MA, Law RJ, Scholz R, Keeney KM, Wlodarska M, Finlay BB. Recent advances in understanding enteric pathogenic Escherichia coli. Clinical microbiology reviews. 2013;26(4):822-80.
Köhler C-D, Dobrindt U. What defines extraintestinal pathogenic Escherichia coli? International Journal of Medical Microbiology. 2011;301(8):642-7.
Toth, I., Herault, F., Beutin, L. & Oswald, E. Production of cytolethal distending toxins by pathogenic Escherichia coli strains isolated from human and animal sources: establishment of the existence of a new cdt variant (type IV). J. Clin. Microbiol. 2003; 41, 4285–4291.
Jarvis KG. and Kaper JB. Secretion of extracellular proteins by enterohemorrhagic escherichia coli via a putative type III secretion system. Infection and Immunity. 1996; 64(11): 4826-4829.
Frankel G. et al. Enteropathogenic and enterohaemorrhagic Escherichia coli: more subversive elements. Mol Microbiol. 1998; 30(5): 911-921.
O'Brien AO. et al. Escherichia coli O157: H7 strains associated with haemorrhagic colitis in the United States produce a Shigella dysenteriae 1 (SHIGA) like cytotoxin. Lancet 1. 1983; (8326 Pt 1): 702.
Beloin C. et al. Escherichia coli biofilms. Curr Top Microbiol Immunol. 2008; 322: 249-289.
Sherlock O. et al. Glycosylation of the self-recognizing Escherichia coli Ag43 autotransporter protein. J Bacteriol. 2006; 188(5): 1798-1807.
Han X, Bai H, Liu L, Dong H, Liu R, Song J, et al. The luxS gene functions in the pathogenesis of avian pathogenic Escherichia coli. Microbial pathogenesis. 2013;55:21-7.
Donnenberg MS, Tzipori S, McKee ML, O'Brien AD, Alroy J, Kaper JB. The role of the eae gene of enterohemorrhagic Escherichia coli in intimate attachment in vitro and in a porcine model. The Journal of clinical investigation. 1993;92(3):1418-24.
Davies J, Davies D. Origins and evolution of antibiotic resistance. Microbiol Mol Biol Rev. 2010;74(3):417-33.
Ali T, Ali I, Khan NA, Han B, Gao J. The growing genetic and functional diversity of extended spectrum beta-lactamases. BioMed research international. 2018;2018.
Verna EC, Lucak S. Use of probiotics in gastrointestinal disorders: what to recommend? Therapeutic advances in gastroenterology. 2010;3(5):307-19.
Thompson JS. et al. Rapid biochemical test to identify verocytotoxin-positive strains of Escherichiacoli serotype O157. Journal of Clinical Microbiology. 1990; 28(10): 2165-216.
Tabar MM, Mirkalantari S, Amoli RI. Detection of ctx-M gene in ESBL-producing E. coli strains isolated from urinary tract infection in Semnan, Iran. Electronic physician. 2016;8(7):2686.
Roche AJ, McFadden JP, Owen P. Antigen 43, the major phase-variable protein of the Escherichia coli outer membrane, can exist as a family of proteins encoded by multiple alleles. Microbiology. 2001;147(1):161-9.
Lu S-Y, Zhao Z, Avillan JJ, Liu J, Call DR. Autoinducer-2 quorum sensing contributes to regulation of microcin PDI in Escherichia coli. Frontiers in microbiology. 2017;8:2570.
Bartosch S, Fite A, Macfarlane GT, McMurdo ME. Characterization of bacterial communities in feces from healthy elderly volunteers and hospitalized elderly patients by using real-time PCR and effects of antibiotic treatment on the fecal microbiota. Appl Environ Microbiol. 2004;70(6):3575-81.
Henriques AO, Beall BW, Roland K, Moran C. Characterization of cotJ, a sigma E-controlled operon affecting the polypeptide composition of the coat of Bacillus subtilis spores. Journal of Bacteriology. 1995;177(12):3394-406.
Duc LH, Hong HA, Barbosa TM, Henriques AO, Cutting SM. Characterization of Bacillus probiotics available for human use. Applied and environmental microbiology. 2004;70(4):2161-71.
Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. methods. 2001;25(4):402-8.
Donnenberg MS, Whittam TS. Pathogenesis and evolution of virulence in enteropathogenic and enterohemorrhagic Escherichia coli. The Journal of clinical investigation. 2001;107(5):539-48.
Djuikoue IC, Woerther P-L, Toukam M, Burdet C, Ruppé E, Gonsu KH, et al. Intestinal carriage of Extended Spectrum Beta-Lactamase producing E. coli in women with urinary tract infections, Cameroon. The Journal of Infection in Developing Countries. 2016;10(10):1135-9.
Gómez NC, Ramiro JM, Quecan BX, de Melo Franco BD. Use of potential probiotic lactic acid bacteria (LAB) biofilms for the control of Listeria monocytogenes, Salmonella Typhimurium, and Escherichia coli O157: H7 biofilms formation. Frontiers in microbiology. 2016;7:863.
Elshaghabee FM, Rokana N, Gulhane RD, Sharma C, Panwar H. Bacillus as potential probiotics: status, concerns, and future perspectives. Frontiers in microbiology. 2017;8:1490.
Konuray G, Erginkaya Z. Potential use of Bacillus coagulans in the food industry. Foods. 2018;7(6):92.
Fijan S. Microorganisms with claimed probiotic properties: an overview of recent literature. International journal of environmental research and public health. 2014;11(5):4745-67.
Geyer C. N, Fowler R. C, Johnson J. R, et al. Evaluation of CTX-M steady-state mRNA, mRNA half-life and protein production in various STs of Escherichia coli. J Antimicrob Chemother. 2016; 71(3): 607–616.
Guo X, Li D, Lu W, Piao X, Chen X. Screening of Bacillus strains as potential probiotics and subsequent confirmation of the in vivo effectiveness of Bacillus subtilis MA139 in pigs. Antonie Van Leeuwenhoek. 2006;90(2):139-46.
Kim K, He Y, Xiong X, Ehrlich A, Li X, Raybould H, et al. Dietary supplementation of Bacillus subtilis influenced intestinal health of weaned pigs experimentally infected with a pathogenic E. coli. Journal of Animal Science and Biotechnology. 2019;10(1):52.
Lin S, Hung A, Lu J. Effects of supplement with different level of Bacillus coagulans as probiotics on growth performance and intestinal microflora populations of broiler chickens. Journal of Animal and Veterinary Advances. 2011;10(1):111-4.
Medellin-Peña MJ, Wang H, Johnson R, Anand S, Griffiths MW. Probiotics affect virulence-related gene expression in Escherichia coli O157: H7. Appl Environ Microbiol. 2007;73(13):4259-67.

Download PDF

Version 3

posted

You are reading this latest preprint version

Inhibitory Effects of the Spore-forming Bacillus spp. on the Expression Levels of eae, luxS, flu, and ctxM Genes in E. coli Isolates

Status:

Version 3

Abstract

Figures

Background

Methods

Results

Discussion

Declarations

References

Status:

Version 3