Participants and study design
DNA and STAI-responses were collected from 72 healthy volunteering participants, 37 females and 35 males (self-assessed health, non-clinical). Participants were in the age range of 19–40 years (mean age females = 24.6 years, SD = 4.6; mean age males = 26.8 years, SD = 6.0). The participants were recruited from the student population at Linköping University through an exploratory functional magnetic resonance imaging (fMRI) based study with the overall aim to investigate the neural, endocrine and genetic correlates of affective touch. The self –assessment of the participant’s health was done through questions asked to the participants. Although the results presented in this paper focus on the genetic aspects in connection with the STAI questionnaire, the inclusion and exclusion criteria were designed to fit the overall aim of the fMRI based study. The inclusion criteria were that couples should have been in a romantic relationship for more than one year and the female should be between 19–40 years. Exclusion criteria were current use of contraceptives with estrogen, pregnancy, as well as ongoing or recently completed hormone therapy. Since the fMRI based study also included endocrine measurements it only included participants that had been through puberty but had not entered menopause, therefore the selection of the 19–40 year old participants.
Samples for DNA extraction were collected from both female and male participants separately and all participants answered the STAI questionnaire one-on-one without their partner present.
DNA sampling and extraction
For the female participants, DNA was extracted from venous blood collected in EDTA-tubes using the DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany). For the male participants, DNA was extracted from saliva collected in collection tubes Oragene DNA OG-500 using the Oragene PrepIT L2G (DNA Genotek Inc., Ontario, Canada). In the fMRI based study, through which the participants were recruited (described above), the female and male participants had different roles; neural and endocrine responses were investigated in the female participants while receiving touch from their male partners. Therefore, DNA was obtained from different sources for female and male participants.
Polymorphism analysis
Each polymorphism was analyzed with the most suitable and effective method as determined in our laboratory for that particular polymorphism. Details follow below.
Serotonin transporter SLC6A4, 5-HTTLPR
The DNA-fragment in the promoter region of the SLC6A4 was amplified by polymerase chain reaction (PCR) using the following reaction mix: 40 ng of genomic DNA, 0.5 mM of each primer as previously described (21) (Table 1) and 10 µl GoTaq (Promega, Madison, Wisconsin, USA) in a reaction volume of 20 µl. After an initial denaturation step for 5 min at 95 °C, 35 cycles of denaturation at 95 °C for 30 s, annealing at 59 °C for 40 s and extension of 72 °C for 50 s were performed, followed by a final extension step of 72 °C for 5 min. PCR-products were separated on a 3.5% agarose gel to distinguish between the long allele (l), 440 bp, and short allele (s), 396 bp.
Serotonin receptor gene HTR1A, rs6295
A 163-bp fragment containing the SNP at nucleotide position HTR1A-1019 was amplified using the same setup of PCR-reaction and program as for SLC6A4. The reverse primer (Table 1) was designed to introduce a variable restriction site depending on if there is a C or a G in position HTR1A-1019, as previously described (22). Subsequently, the introduced restriction site was detected by digesting 10 µl of the PCR product with the restriction enzyme BseGI in a total volume of 50 µl according to the manufacturer’s instructions (ThermoFisher, Waltham, Massachusetts, USA) and then separating the product on a 3.5% agarose gel. The undigested fragment (163 bp) carries the C and the digested one (146 bp/17 bp) carries the G in the same position.
Glucocorticoid receptor gene, NR3C1, (BclI) rs41423247
The gene variant of NR3C1 SNP rs41423247 was analyzed with droplet digital PCR (ddPCR) mutation detection assay according to the manufacturer´s instructions (Bio-Rad, Hercules, California, USA). Probes were designed to discriminate between the alleles using two different fluorescent TaqMan probes (Table 1). The probe detecting the C allele was marked with the fluorophore HEX and the probe detecting the G allele was marked with the fluorophore FAM (Bio-Rad, Hercules, California, USA).
FK506-binding protein 51, FKBP5, rs1360780
The gene was amplified in the following PCR-reaction; 40 ng DNA, 0,2 mM dNTP, 0,4 mM of each primer (Table 1), 2 mM MgCl2 and 0,5 U of Taq-polymerase (New England Biolabs, Ipswich, Massachusetts, USA) in a total volume of 25 µl. Primers were designed using Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). The same PCR program as for SLC6A4 was used. The SNP was then detected using Sanger sequencing.
Oxytocin receptor gene OXTR, rs53576
The gene variants of OXTR SNP rs53576 were analyzed with ddPCR mutation detection assay according to the manufacturer´s instructions (Bio-Rad, Hercules, California, USA). Probes were designed to discriminate between the alleles A and G using two different fluorescent TaqMan probes (Table 1). The probe detecting the A allele was marked with the fluorophore HEX and the probe detecting the G allele was marked with the fluorophore FAM (Bio-Rad, Hercules, California, USA).
Table 1
Primers and probes used for the analyses of genetic polymorphisms in PCR and ddPCR.
Gene
|
SNP/Poly-morphism
|
Primer Sequence 5´-3´/
ddPCR assay sequence (SNP in brackets)
|
Product (bp)
|
Polymorphism
|
SLC6A4
|
5-HTTLPR
|
f-ATGTCCCTACTGCAGCCTCC
r-AGTCCGCGCGGGATTC
|
s(396)/l(440)
|
(s)/(l)
|
HTR1A
|
rs6295
|
f-GGCTGGACTGTTAGATGATAACG
r-GGAAGAAGACCGAGTGTGTCAT
|
C(163) G(17 & 146)
|
C/G
|
NR3C1
|
rs41423247
|
CATTTGAACGTAAAATTTTGTTTTGCACCATGTTGACACCAATTCCTCTCTTAAAGAGATT
[C/G]ATCAGCAGACATAACTTGTCTACTTTATGGCAAGAACCCTGTGAGCAAGACCTGTGTCTAA
|
|
C/G
|
FKBP5
|
rs1360780
|
f-CTGCAAGTCCCCAAAATTTGAC
r-ATCTCTTGTGCCAGCAGTAG
|
|
C/T
|
OXTR
|
rs53576
|
GTCCCCCACACCTCGGGCACAGCATTCATGGAAAGGAAAGGTGTACGGGACATGCCCGAGG[A/G]
TCCTCAGTCCCACAGAAACAGGGAGGGGCTGGGAAGCTCATTCTACAGATGGGGAAACAGT
|
|
A/G
|
Expected product size in base pairs depending on the polymorphism. SNP = single nucleotide polymorphism; f = forward primer; r = reverse primer; bp = base pairs |
Anxiety measurement
The participants’ self-assessed anxiety was measured through STAI, a validated and frequently used questionnaire for measuring general anxiety (25). There are two subscales in STAI; one determines state anxiety (S) which is a measure of how the person feels right now, the other measures the trait anxiety (T) which is the proneness for anxiety in the personality (25).
The STAI questionnaire is a self-administered test with 40 questions. State anxiety items include statements like “I am tense” and “I feel secure”. Trait anxiety items include “I worry too much over something that doesn´t really matter” and “I am a steady person”. Each item is scored on a 4-point Likert scale. The range 1 to 4 is from “not at all” to “very much so” for the STAI-S and from “almost never” to “almost always” for the STAI-T, with a total score range of 20 to 80. The median alpha reliability coefficients in healthy individuals for the STAI questionnaire (forms S and T) are 0.92 and 0.90, respectively (26, 27).
Missing data in the STAI-S and STAI-T questionnaires (maximum two missing values) was handled with hot deck imputation (28). This was the case for two female participants, one in STAI-S (one item missing) and one in STAI-T (one item missing).
Statistical analyses
All analyses were carried out using IBM SPSS 24 (SPSS Inc., Chicago, USA). We applied independent t-test to compare mean values of STAI-S and STAI-T between sexes and genotypes in the candidate genes. Chi-square test was used for calculating Hardy-Weinberg equilibrium for genetic polymorphisms.
A probability level of < 0.05 was considered statistically significant for testing gender differences in STAI and also for Hardy-Weinberg equilibrium. To control for multiple comparisons in the association analysis, a Bonferroni correction was performed, taking into account that five different SNPs were tested. Therefore results with a p-value < 0.01 were considered statistically significant for the association analysis.