The expression of deiodinase 2 and deiodinase 3 are reduced by insulin and D-glucose respectively, in human placental explant cultures

doi:10.21203/rs.3.rs-3437419/v1

Download PDF

Research Article

The expression of deiodinase 2 and deiodinase 3 are reduced by insulin and D-glucose respectively, in human placental explant cultures

https://doi.org/10.21203/rs.3.rs-3437419/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Introduction: Gestational diabetes mellitus is associated with altered expression of deiodinases (DIO), a group of seleno-enzymes that metabolize thyroid hormones in several tissues, including human placenta. It has been reported that these alterations could lead to reduced fetal thyroid hormone levels and impaired central nervous system development. However, it is not clear if D-glucose or insulin, which levels are increased in metabolic pathologies such as Gestational diabetes mellitus, are responsible for this phenomenon.

Methods: We recruited 10 women with normal pregnancies from Hospital Guillermo Grant Benavente, Concepcion, Chile. After delivery, explants were extracted from placenta to perform cultures exposed to different concentrations of D-glucose and insulin, in order to evaluate deiodinase mRNA expression by RT-qPCR, enzymatic activity and protein localization by immunohistochemistry.

Results: We observed that insulin could decrease both DIO2 mRNA (~38%) and activity (~40%), and D-glucose diminished DIO3 mRNA (~48%) as well as its activity (~36%). At control conditions DIO2 expression was observed mainly in fetal vasculature, while DIO3 expression focused on macrophage-like cells. D-glucose did not change deiodinase localization in placenta, whereas insulin promoted DIO2 and DIO3 expression in syncytiotrophoblast.

Conclusion: We suggest that a diabetogenic state in pregnancy with high levels of D-glucose and insulin, may lead to deiodinase alterations in placenta and consequently fetal thyroid dysfunction.

Deiodinase

Gestational diabetes mellitus

Thyroid hormones

Placenta

Glucose

Insulin

Thyroid hormones (TH) play an important role in embryogenesis and central nervous system development [1–3]; during gestation, TH are involved in neuronal progenitor proliferation, migration, maturation and survival of neurons [4]. Throughout the first and part of the second trimester of gestation, the developing fetal thyroid is unable to produce enough TH quantities required for such process [5]. This is the reason why the fetus needs TH supply from maternal circulation, which are transported mainly through cytoplasm and the plasmatic membrane of syncytiotrophoblast in placenta [6]. TH transport in placenta is regulated by carrier proteins, TH membrane transports and a group of seleno-enzymes called deiodinases [7]. Three different types of deiodinases are known: deiodinase 1 (DIO1), deiodinase 2 (DIO2) and deiodinase 3 (DIO3) [8]. Only DIO2 and DIO3 have a significant expression in human placenta [9].

It is known that several factors could impair deiodinase function in placenta; there is evidence that shows a positive correlation between perioperative plasmatic glucose levels and placental DIO3 expression in women with cesarean delivery [10]. Importantly, a decreased DIO3 activity has been described in ovine placenta during delivery when exogenous cortisol is administered [11]. Besides, Cheng et al. reported that taurine, a sulfured amino acid product of methionine and cysteine metabolism, restores the decreased DIO3 protein and mRNA expression generated by decabromodiphenyl ether (BDE), an environmental contaminant, in JEG cellular culture [12].

In a particular pathologic context such as insulin resistance and diabetes, alterations in deiodinase function have also been reported; for instance, the association between reduction of DIO2 enzymatic activity and appearance of insulin resistance condition in Caucasian population [13]. In the same line, a negative correlation between free thyroxine (FT4) levels and diabetes metabolic markers in pregnant women, such as increased percentage of glycosylated hemoglobin, fasting insulin and HOMA-IR has been described [14]. Also, it has been reported decreased triiodothyronine (T3) and thyroxine (T4) levels measured in cord blood samples of women with glucose intolerance pregnancies, which would suggest alterations in deiodinase activity [15]. Recently, our group observed reduced T3, T4 and FT4 and elevated thyroid stimulating hormone (TSH) levels in cord blood samples from gestational diabetes mellitus (GDM) pregnancies, and also decreased DIO2 and increased DIO3 protein expression, both localized mainly in syncytiotrophoblast and endothelium, in GDM placentas [16].

Although this evidence shows an impaired deiodinase function in insulin resistance and diabetes, it is not clear if there is an association with these pathological conditions. For the first time in our knowledge, using human placental explant model we evaluated if D-glucose and insulin can regulate deiodinase expression, localization, and activity.

Patients and Biological samples

10 normal pregnant women who complied all inclusion criteria (uncomplicated delivery and age﹥18 y/o) were recruited between the years 2018 and 2019 from Hospital Guillermo Grant Benavente of Concepción, Chile. The term placentas were obtained post-delivery and transported (< 30 minutes) to the laboratory at 25°C. The exclusion criteria included underage women, diagnosis of diabetes mellitus and/or thyroid pathologies and other pregnancy pathologies (i.e. preeclampsia, fetal growth restriction, ectopic pregnancy) (supporting information: Table S1).

Ethic aspects

This work has been carried out in accordance with the declaration of Helsinki. Committee approval from the Comité Ético Científico de Servicio de Salud Concepción (CEC:23-2017-20) and informed consent of each pregnant woman from the three Primary Health Centers of Concepción were obtained.

Human placental explant culture and viability assay

The decidua was cut to extract 6-8 mm explants from at least 5 different cotyledons. Explants were washed 10 times with cold PBS and transferred to 12-well plates with 1 mL of M199 (Hyclone), supplemented with 10% FBS, 100 units/mL of penicillin and 100 mg/mL of streptomycin. First, we performed a viability assay measuring LDH released by an automated immunoassay (Siemens Healthcare Diagnostics) in culture supernatant, at 0-24 hours, 37°C, 95% O₂ and 5% CO₂. Placental explant cultures were conducted with D-Glucose (5.6 and 25 mM, 12 hours) or insulin (0 and 0.1 nM, 12 hours) at the same culture conditions.

RNA extraction and RT-qPCR.

From placental explants stored in 1mL of trizol (Invitrogen) at -80°C post-culture, RNA extraction was performed following the manufacturer’s instructions. The obtained RNA was quantified in microplate spectrophotometry (Sinergy 2, BioTech). For reverse transcriptase reaction, 0.2-1 µg of total RNA was utilized with ImProm-II Reverse Transcription System kit (Promega), following the manufacturer’s instructions. Amplification of cDNA was performed by qPCR in Applied Biosystem 7500 fast thermal cycler (ThermoFisher Scientific) for 28S (forward: ACATTGTTCCAACATGCCAG; reverse: TTGAAAATCCGGGGGAGAG), DIO2 (forward: TCGATGCCTACAAACAGGTGA; reverse: TTGCCACTGTTGTCACCTCC) and DIO3 (forward: TCGAGCGTCTCTATGTCATC; reverse: TCATCATAGCGTTCCAACCA). We utilized 4 µL Fast Evagreen qPCR Master Mix 1X (Biotium), 0.5 µL of reverse and forward primers at 10 µM, 2 µl of cDNA and nuclease free water to complete 20 µl of total volume. The amplification protocol goes as follows: Initial denaturation 94°C for 10 minutes; 40 cycles of: 94°C for 30 seconds (denaturation), 54°C (28S and DIO3) and 57°C (DIO2) for 30 seconds (annealing), and 72°C for 45 seconds (extension); final extension 72°C for 10 minutes. Relative expression of deiodinase genes was determined by the 2-ΔΔctmethod.

Immunohistochemistry (IHQ)

After culture, placental explants were stored in 1 mL 4% paraformaldehyde at 4°C until processing. Dehydration and tissue preparation were performed in Citadel 1000 automatized system (ThermoFisher Scientific) for 13 hours, then embedded in paraffin and sectioned at 4 µm. The paraffin sections were rehydrated, and the endogenous peroxidase activity was inhibited by 3% H₂O₂ in methanol for 30 minutes, then washed with PBS for 5 minutes. For Antigen retrieval the sections were exposed to 1x EDTA (Diagnostic Biosystem) pH 8.0 at 95°C for 20 minutes. After immunostaining, tissue integrity was assessed (Fig S1). The samples were incubated overnight at 4°C with the primary rabbit IgG antibody anti-DIO2 (Invitrogen) and anti-DIO3 (Invitrogen), diluted 1:100. Negative control slides in absence of primary antibody but in presence of pig IgG were included (Fig S2). Samples plus ImmPRESS HRP universal antibody polymer detection kit (Vector laboratories) were incubated for 30 minutes at room temperature. Finally, ImmPACT DAB peroxidase substrate kit (Vecton laboratories) was used to detect immunoreactivity. The nuclei were counterstained with Harris hematoxylin.

Deiodinase activity

After culture, 300 µg of explant protein in presence of 1,4-Dithiothreitol (DTT, 20mM) were exposed to T4 (MP Biomedicals, LLC, Solon, OH, USA) (0-500 nM, 37°C, 15 min). The reaction was stopped with absolute ethanol (4°C). The sample was centrifuged at 10500g (4°C, 8 min), and the supernatant was used to measure T3(Competitive ELISA, Invitrogen) and rT3 (reverse T3) (Competitive ELISA, Invitrogen) [16,17].

Determination of kinetic parameters

Saturable T4 conversion at initial rates was adjusted to the Michaelis-Menten asymptotic hyperbola. T4-conversion kinetic parameters maximal velocity (Vmax) and apparent Michaelis-Menten constant (Km) of transport were calculated as follows:

Vo corresponds to initial velocity and [T4] the T4 concentration. Each assay was run in duplicate, and activity was expressed in ng/mL/µg of protein/min (5’-deiodinase activity) and pg/L/µg of protein/min (5-deiodinase activity). To compare the 25 mM of D-glucose and/or Insulin 0.1 nM effect on deiodinase activity, we calculated the enzyme catalytic efficiency using the Vmax/Km ratio.

Statistical analysis

Values were mean ± SD. Comparisons between two or more groups were performed by Mann-Whitney U test and Kruskal-Wallis test, respectively. If the Kruskal-Wallis test demonstrated a significant interaction between variables, post hoc analyses were performed by Dunn’s multiple-comparison test. *p < 0.05 was considered as statistically significant. The statistical software GraphPad Prism 7.0a.65 (GraphPad Software Inc., San Diego, CA, USA) was used for data analysis.

Viability assay and D-glucose and insulin effect on deiodinase mRNA expression by RT-qPCR

LDH release was not significative until 24 hours of culture; the ET50 value, a measure to determine the time needed to reach half of the maximum effect on LDH release, was 12.3 ± 0.3 hours (Fig. 1)

D-glucose did not change DIO2 mRNA expression (Fig. 2A), but reduced DIO3 mRNA (~48%) at 25 mM (Fig. 2B); insulin otherwise reduced DIO2 mRNA at 0.1 nM (~38%) (Fig. 2C). In the case of DIO3, mRNA expression showed no significant changes at 0.1 nM (Fig. 2D).

D-glucose and insulin effect on deiodinase protein expression by IHQ

DIO2 showed regular expression at red blood cells (RBC) membrane, but also in fetal vessels and endothelium in control condition (Fig. 3A, 3E); there were no changes in expression or localization at 25 mM of D-glucose (Fig. 3C). DIO3 presented abundant expression in macrophage- like cells, possibly Hofbauer cells (HBC) in control condition (Fig.3B, 3F); at 25 mM of D-glucose condition remained the same DIO3 expression pattern (Fig.3D). Therefore, DIO2 focusses its expression on fetal vascular tissue, and it is not altered by D-glucose; DIO3 expression is localized predominantly at possible HBC and its expression is neither modified by D-glucose. However, at 0.1 nM of insulin, DIO2 expression persisted in RBC membrane and endothelium, although we observed a positive reaction in apical membrane of syncytiotrophoblast (Fig. 3G). In the case of DIO3 at 0.1 nM of insulin a positive reaction appeared in the basal zone and mesenchymal area of syncytiotrophoblast (Fig. 3H).

Deiodinase activity is altered in placental explant cultures exposed to D-glucose and insulin

DIO activity is presented as kinetic enzymatic assays (Fig. 4) and parameters (Table 1). We observed that T3 and rT3 formation from T4 were saturable in placentas from Control, 25 mM of D-Glucose and insulin (Fig 4 A and C). Eadie-Hofstee plots were linear in both groups of placentas (Fig 4 B and D). 5’-deiodinase activity showed a reduction in Vmax (~40%) and Vmax/Km ratio (~50%), without changes in apparent Km in explants cultured with insulin compared to Control and D-Glucose (Fig. 4A and B, Table 1). However, 5-deiodinase activity showed a reduction in Vmax (~36%) and Vmax/Km ratio (~30%), without changes in apparent Km in explants cultures with 25 mM of D-Glucose compared with Control and insulin (Fig. 4 C and D, Table 1).

Table 1

Kinetics parameters of 5’- and 5- deiodinase activity
Kinetics parameters	Control	D-Glucose 25 mM	Insulin 0.1 nM
5’-deiodinase activity (T4 → T3)
V_max (pg/L/µg of protein/min)	0.201 ± 0.2	0.211 ± 0.5	0.120 ± 0.1*
K_m (nM)	25.1 ± 2.8	23.3 ± 2.2	27.4 ± 2.5
V_max/K_m (pg/L/µg of protein/min/nM)	0.008 ± 0.001	0.009 ± 0.001	0.004 ± 0.001*
5-deiodinase activity (T4 → rT3)
V_max (ng/mL/µg of protein/min)	1.302 ± 0.1	0.821 ± 0.01*	1.594 ± 0.2
K_m (nM)	4.1 ± 0.05	3.8 ± 0.04	4.5 ± 0.5
V_max/K_m (ng/mL/µg of protein/min/nM)	0.31 ± 0.03	0.22 ± 0.02*	0.36 ± 0.004
V_max: maximal velocity; K_m: Michaelis-Menten constant; V_max/K_m: enzyme catalytic efficiency. *P < 0.05 with respect to other groups. N = 5 per group.

Using the human placental explant model, we assessed if D-glucose and insulin can regulate DIO2 and DIO3 expression and activity. Interestingly, insulin and D-glucose reduced DIO2 and DIO3 expression and activity, respectively.

First, it was necessary to determine explant survival in culture; to achieve this, we measured LDH release for 24 hours. Goncalves et al. reported long-survival placental explant cultures, reaching elevated levels of LDH from day 2 of culture where the highest value was observed, and then begin to decline until day 5, to experience a new increase at day 7 [18]. Other evidence showed no significant LDH release until day 11 [19]. Otherwise, in a short-term placental explant model, LDH levels remained constant for 3.5 hours; in this case it was not necessary to extend the tissue survival much longer [20]. Placental tissue damage is associated with syncytiotrophoblast degeneration during earlier days of culture. In these conditions cytotrophoblast differentiates to syncytial phenotype after 4–5 days of incubation, where necrosis and apoptosis are involved [19]. The reason why some placental explant cultures show damage signs earlier than others may be due to oxygen tension; it has been reported that placental explant survival increases in hypoxic conditions [21]. In the present study the placental explants were incubated in normoxia and showed a significant LDH release at 24 hours, which implies that the explants remain viable at least until 12 hours of culture. Moreover, our group reported DIO3 mRNA alterations in HUVEC and HTR8-Svneo in 6 hours cultures (unpublished data); for all these reasons we decided to maintain the normoxia condition and establish 12 hours for placental explant cultures.

There is no clear evidence about the effect of D-glucose or insulin on deiodinase expression and activity in placenta. Our group reported a reduced DIO2 and an increased DIO3 mRNA, protein expression and activity in term placentas from GDM pregnancies [16]. In the present study DIO2 mRNA did not exhibit significant changes when exposed to D-glucose, while DIO3 mRNA decreased at 25 mM of D-glucose. The absence of DIO2 mRNA changes does not correspond to what was reported by Gutierrez-Vega et al.; this would suggest that D-glucose is not inducing DIO2 mRNA alterations seen in GDM placentas alone [16]. Related to DIO3 expression, the results showed in this study are in contradiction with what we observed in HTR8-Svneo (unpublished data) and placentas from GDM pregnancies; this is probably due to HTR8-Svneo is a first trimester trophoblast cell line which represents a localized response of just one cellular type, therefore it may differ from the total placenta response. On the other hand, despite the fact that an hyper-glycemic state is an important factor for GDM establishment, this disease has a multifactorial pathogenesis and elevated glucose is just one of those factors. It is possible that increased DIO3 mRNA seen in GDM placentas would not be due to high D-glucose levels precisely [16]. Related to insulin effect on deiodinase expression, we observed a reduced DIO2 mRNA expression at 0.1 nM; this concentration is similar to the upper limit insulin physiological value. In the case of DIO3 mRNA, there were no significant changes at 0.1 nM, but a trend towards increase is noted. DIO2 alterations generated by insulin in this model have also been reported in GDM term placentas [16]. DIO2 is a TH activating-enzyme that may have a role supplying TH (triiodothyronine, mainly) to the fetus during gestation; a decreased expression of DIO2 could explain the reduced levels of TH measured in cord blood samples of GDM pregnancies [16].

To evaluate protein expression and localization of deiodinases, we performed IHQ. DIO2 focusses its expression on erythrocytes membrane and fetal endothelium at both concentrations of D-glucose tested. The expression of DIO2 in fetal origin placental components may be related to extrathyroidal desiodation, which helps to manage T4 rising levels and the fetal hypothalamus-pituitary-thyroid axis during maturation [5]. On the other hand, DIO3 focused its expression on placental components that refer to HBCs at both D-glucose concentrations tested. These cells are fetal origin placental villi resident macrophages which are present during all gestation [22]. Macrophages can adopt different phenotypes, mainly stimulated by the micro-environment in which they are involved, a process known as polarization. It has been reported that HBCs isolated from term placentas display a M2 phenotype mainly, specially M2a, M2b and M2c subtypes, based on surface markers and cytokine secretion profile [23, 24]. Thus, due to the predominance of this anti-inflammatory macrophage phenotype in placenta, HBCs are possibly associated with chorionic villi development and immune tolerance to the fetus. Furthermore, it has been observed that in an insulin resistance condition with low-grade inflammation such as GDM, the HBCs profile does not suffer significant alterations and the M2 or anti-inflammatory phenotype is maintained [24]. In our knowledge, this is the first time that DIO3 expression is reported in possible HBCs; moreover, the role that these cells play in TH transport in placenta is unknown. We suppose that given the fetal origin and the phenotype that favors placental morphogenesis and homeostasis, they may act in coordination with syncytiotrophoblast to regulate the TH supply to the fetus. Related to insulin effect on deiodinase expression and localization in placental tissue, in control conditions DIO2 is expressed in RBC membrane and endothelium, but when insulin concentration increased, we observed immunoreactivity in syncytiotrophoblast, in line with what was reported by other authors [25]. DIO3 focuses its expression in possible HBCs at control condition, but at 0.1 nM of insulin, immunoreactivity also appeared in syncytiotrophoblast, in accordance with other studies [25, 26]. In agreement with our results, Gutierrez-Vega et al. reported that both DIO2 and DIO3 are mainly localized in syncytiotrophoblast in term placentas from GDM pregnancies[16].

Deiodinase activity is classified in two types: (1) 5’-deiodinase, favoring T3 formation from T4 mediated by DIO1 and DIO2, and (2) 5-deiodinase, favoring rT3 formation from T4, or T2 from T3, mediated by DIO1 and DIO3[16]. In fact, DIO2 is the main T3 source in humans[27]. Interestingly, in mice lacking DIO2 (D2KO), it has been observed an increase in insulin resistance[28], and also in human, associated with Thr92Ala polymorphism of DIO2 [29, 30]. Moreover, obesity and hyperglycemia are associated with an increase in general deiodinase activity calculated by T3/FT4 ratio[31]. Furthermore, it has been reported that DIO3 activity is 400-fold higher than DIO2 activity in human placenta [9]. In fact, DIO3 activity reduces T4 transport in human perfused placenta[32]. Therefore, a reduction in DIO3 activity, as it was seen in this work with D-glucose, could increase the T4 transport across the placenta. The Km values that we obtained from 5-deiodinase activity are similar to those from previous experiments that have measured DIO3 activity in placental tissue [16, 33]. However, our Km values for 5’-deiodinase activity showed less affinity for T4 than those that have been previously described for DIO2 activity in placental tissue[9, 17], but similar to previous studies done for our group[16].

Using third trimester human placental explant cultures, we demonstrated that insulin decreased DIO2 mRNA and enzymatic activity, whereas D-glucose reduced DIO3 mRNA and enzymatic activity, as it is shown in our proposed model in Fig. 5. Moreover, we noted that insulin favored both DIO2 and DIO3 protein expression in syncytiotrophoblast. Considering the epidemiological and physio-pathological link between insulin resistance and impaired thyroid function [34], plus the evidence showed in the present study, we suggest that a diabetogenic state, with high insulin and D-glucose levels, regulates deiodinase expression/activity and thus may promote fetal TH dysfunction. As a limitation of this study we identify that working with first trimester explants would have been more representative of TH transport through developing placenta than third trimester explants. As projections, we look forward to determine the insulin pathway involved in this phenomenon, and to characterize the role of DIO3 expressing HBCs in both normal and GDM placentas.

Author Contributions

NH-C, DR and EG-G prepared the figures and wrote the manuscript. NH-C, DM, JB and JA-R applied statistical analysis. NH-C, DR, AS, CA, KR and MG recruited pregnant women and did biochemistry and molecular biology analysis.

Funding

This work was supported by the National Grant for Scientific and Technological Development, FONDECYT 11170710; ANID-FOVI210057 for EG-G. ANID (MSc scholarship 22181038) for NH-C.

Acknowledgments

We want to thank all the pregnant women and health personnel from Obstetrics and Gynecology Service of Hospital Guillermo Grant Benavente who collaborated in the success of this work. EG-G, CA and MG are members of Group of Research and Innovation in Vascular Health.

Conflict of Interest: The authors declare that they have no conflict of interest.

Bernal, J. (2007). Thyroid hormone receptors in brain development. Nature Clinical Practice Endocrinology and Metabolism, 3, 249–259. https://doi.org/10.1038/ncpendmet0424
Jansen, T. A., Korevaar, T. I. M., Mulder, T. A., White, T., Muetzel, R. L., Peeters, R. P., & Tiemeier, H. (2019). Maternal thyroid function during pregnancy and child brain morphology: a time window-specific analysis of a prospective cohort. The Lancet Diabetes and Endocrinology, 7, 629–637. https://doi.org/10.1016/S2213-8587(19)30153-6
Rotem, R. S., Chodick, G., Shalev, V., Davidovitch, M., Koren, G., Hauser, R., Coull, B. A., Seely, E. W., Nguyen, V. T., & Weisskopf, M. G. (2020). Maternal Thyroid Disorders and Risk of Autism Spectrum Disorder in Progeny. Epidemiology, 31, 409–417. https://doi.org/10.1097/EDE.0000000000001174
Stepien, B. K., & Huttner, W. B. (2019). Transport, metabolism, and function of thyroid hormones in the developing mammalian brain. Frontiers in Endocrinology, 10, 1–16. https://doi.org/10.3389/fendo.2019.00209
Eng, L., & Lam, L. (2020). Thyroid function during the fetal and neonatal periods. NeoReviews, 21, e30–e36. https://doi.org/10.1542/neo.21-1-e30
Eerdekens, A., Verhaeghe, J., Darras, V., Naulaers, G., Van den berghe, G., Langouche, L., & Vanhole, C. (2020). The placenta in fetal thyroid hormone delivery: from normal physiology to adaptive mechanisms in complicated pregnancies. Journal of Maternal-Fetal and Neonatal Medicine, 33, 3857–3866. https://doi.org/10.1080/14767058.2019.1586875
Landers, K., & Richard, K. (2017). Traversing barriers - How thyroid hormones pass placental , blood-brain and blood-cerebrospinal fluid barriers. Molecular and Cellular Endocrinology, 1–7. https://doi.org/10.1016/j.mce.2017.01.041
Gereben, B., Zavacki, A. M., Ribich, S., Kim, B. W., Huang, S. A., Simonides, W. S., Zeöld, A., & Bianco, A. C. (2008). Cellular and molecular basis of deiodinase-regulated thyroid hormone signaling. Endocrine Reviews, 29, 898–938. https://doi.org/10.1210/er.2008-0019
Koopdonk-kool, J. J. M. (1996). Type II and Type III Deiodinase Activity in Human Placenta as a Function of Gestational Age. Endocrine Society, 81, 2154–2158.
Akturk, M., Oruc, A. S., Danisman, N., Erkek, S., Buyukkagnici, U., Unlu, E., & Tazebay, U. H. (2013). Na+/I- symporter and type 3 iodothyronine deiodinase gene expression in amniotic membrane and placenta and its relationship to maternal thyroid hormones. Biological Trace Element Research, 154, 338–344. https://doi.org/10.1007/s12011-013-9748-y
Forhead, A. J., Curtis, K., Kaptein, E., Visser, T. J., & Fowden, A. L. (2006). Developmental control of iodothyronine deiodinases by cortisol in the ovine fetus and placenta near term. Endocrinology, 147, 5988–5994. https://doi.org/10.1210/en.2006-0712
Cheng, Y., Qin, C., Hao, X., Wang, R., Niu, X., Li, Z., Shang, X., Shao, J., Wang, Y., & Xiaohui, L. (2019). Alteration of Placental Deiodinase 3 Expression by BDE 209 and Possible Protection by Taurine in Human Placenta-Derived JEG Cells Under Hypoxia. In Advances in Experimental Medicine and Biology,1155, 775-784. https://doi.org/10.1007/978-981-13-8023-5_3
Mentuccia, D., Proietti-Pannunzi, L., Tanner, K., Bacci, V., Pollin, T. I., Poehlman, E. T., Shuldiner, A. R., & Celi, F. S. (2002). Association Between a Novel Variant of the Human Type 2 Deiodinase Gene Thr92Ala and Insulin Resistance. Diabetes, 51, 880–883. http://diabetes.diabetesjournals.org/content/51/3/880.abstract
Bassols, J., Prats-Puig, A., Soriano-Rodríguez, P., García-González, M. M., Reid, J., Martínez-Pascual, M., Mateos-Comerón, F., De Zegher, F., Ibáñez, L., & López-Bermejo, A. (2011). Lower free thyroxin associates with a less favorable metabolic phenotype in healthy pregnant women. Journal of Clinical Endocrinology and Metabolism, 96, 3717–3723. https://doi.org/10.1210/jc.2011-1784
Shanmugam, S., Dhiman, P., Rajendiran, S., Nimesh, A., & Maurya, D. K. (2019). Gestational impaired glucose tolerance (GIGT)-induced suppression of fetal thyroid secretion: effect on fetal outcome. Journal of Maternal-Fetal and Neonatal Medicine, 32, 1992–1996. https://doi.org/10.1080/14767058.2017.1422716
Gutierrez-Vega, S., Armella, A., Mennickent, D., Loyola, M., Covarrubias, A., Ortega-Contreras, B., Escudero, C., Gonzalez, M., Alcala, M., Ramos, M., Viana, M., Castro, E., Leiva, A., & Guzman-Gutierrez, E. (2020). High levels of maternal total tri-iodothyronine, and low levels of fetal free L-thyroxine and total tri-iodothyronine, are associated with altered deiodinase expression and activity in placenta with gestational diabetes mellitus. PLoS ONE, 15, 1–15. https://doi.org/10.1371/journal.pone.0242743
Dora, J. M., Wajner, S. M., Costa, J. D., Pinto Ribeiro, R. V., Leiria, L. B., Lopes, M. G., Vitali Da Silva, A., Crispim, D., & Maia, A. L. (2014). Type 2 deiodinase Thr92Ala polymorphism is associated with disrupted placental activity but not with dysglycemia or adverse gestational outcomes: A genetic association study. Fertility and Sterility, 101, 833–840. https://doi.org/10.1016/j.fertnstert.2013.11.018
Goncalves, J. M., Casart, Y. C., & Camejo, M. I. (2015). Nitric oxide and oxidative stress in placental explant cultures. Systems Biology in Reproductive Medicine, 62, 11–16. https://doi.org/10.3109/19396368.2015.1075163
Siman, C. M., Sibley, C. P., Jones, C. J. P., Turner, M. A., & Greenwood, S. L. (2001). The functional regeneration of syncytiotrophoblast in cultured explants of term placenta. American Journal of Physiology - Regulatory Integrative and Comparative Physiology, 280, 1116–1122. https://doi.org/10.1152/ajpregu.2001.280.4.r1116
Sooranna, S. R., Oteng-Ntim, E., Meah, R., Ryder, T. A., & Bajoria, R. (1999). Characterization of human placental explants: Morphological, biochemical and physiological studies using first and third trimester placenta. Human Reproduction, 14, 536–541. https://doi.org/10.1093/humrep/14.2.536
Miller, R. K., Genbacev, O., Turner, M. A., Aplin, J. D., Caniggia, I., & Huppertz, B. (2005). Human Placental Explants in Culture : Approaches and Assessments. Placenta. 26, 439–448. https://doi.org/10.1016/j.placenta.2004.10.002
Kim, J. S., Romero, R., Kim, M. R., Kim, Y. M., Friel, L., Espinoza, J., & Kim, C. J. (2008). Involvement of Hofbauer cells and maternal T cells in villitis of unknown aetiology. Histopathology, 52, 457–464. https://doi.org/10.1111/j.1365-2559.2008.02964.x
Johnson, E. L., & Chakraborty, R. (2012). Placental Hofbauer cells limit HIV-1 replication and potentially offset mother to child transmission (MTCT) by induction of immunoregulatory cytokines. Retrovirology, 9, 1–11. https://doi.org/10.1186/1742-4690-9-101
Schliefsteiner, C., Peinhaupt, M., Kopp, S., Lögl, J., Lang-Olip, I., Hiden, U., Heinemann, A., Desoye, G., & Wadsack, C. (2017). Human placental Hofbauer cells maintain an anti-inflammatory M2 phenotype despite the presence of gestational diabetes mellitus. Frontiers in Immunology, 8, 1–17. https://doi.org/10.3389/fimmu.2017.00888
Chan, S., Kachilele, S., Hobbs, E., Bulmer, J. N., Boelaert, K., McCabe, C. J., Driver, P. M., Bradwell, A. R., Kester, M., Visser, T. J., Franklyn, J. A., & Kilby, M. D. (2003). Placental iodothyronine deiodinase expression in normal and growth-restricted human pregnancies. Journal of Clinical Endocrinology and Metabolism, 88, 4488–4495. https://doi.org/10.1210/jc.2003-030228
Huang, S. A., Dorfman, D. M., Genest, D. R., Salvatore, D., & Larsen, P. R. (2003). Type 3 iodothyronine deiodinase is highly expressed in the human uteroplacental unit and in fetal epithelium. Journal of Clinical Endocrinology and Metabolism, 88, 1384–1388. https://doi.org/10.1210/jc.2002-021291
Maia, A. L., Kim, B. W., Huang, S. A., & Harney, J. W. (2005). Type 2 iodothyronine deiodinase is the major source of plasma T3 in euthyroid humans. The Journal of Clinical Investigation, 115, 2524–2533. https://doi.org/10.1172/JCI25083
Castillo, M., Hall, J. A., Correa-Medina, M., Ueta, C., Kang, H. W., Cohen, D. E., & Bianco, A. C. (2011). Disruption of thyroid hormone activation in type 2 deiodinase knockout mice causes obesity with glucose intolerance and liver steatosis only at thermoneutrality. Diabetes, 60, 1082–1089. https://doi.org/10.2337/db10-0758
Wang, X., Chen, K., Zhang, C., Wang, H., Li, J., Wang, C., Teng, W., Shan, Z., & Lai, Y. (2021). The Type 2 Deiodinase Thr92Ala Polymorphism Is Associated with Higher Body Mass Index and Fasting Glucose Levels: A Systematic Review and Meta-Analysis. BioMed Research International, 2021, 1–8. https://doi.org/10.1155/2021/9914009
Ortega-Contreras, B., Armella, A., Appel, J., Mennickent, D., Araya, J., González, M., Castro, E., Obregón, A. M., Lamperti, L., Gutiérrez, J., & Guzmán-Gutiérrez, E. (2022). Pathophysiological Role of Genetic Factors Associated With Gestational Diabetes Mellitus. Frontiers in Physiology, 13, 1–14. https://doi.org/10.3389/fphys.2022.769924
Haddow, J. E., Lambert-Messerlian, G., Eklund, E., Neveux, L. M., & Palomaki, G. E. (2017). Peripheral deiodinase activity: A potential explanation for the association between maternal weight and gestational hyperglycemia. Obstetric Medicine, 11, 73–78. https://doi.org/10.1177/1753495X17733223
Mortimer, R. H., Gallican, J. P., Cannell, G. R., Addison, R. S., & Roberts, M. S. (1996). Maternal to fetal thyroxine transmission in the human term placenta is limited by inner ring deiodination. Journal of Clinical Endocrinology and Metabolism, 81, 2247–2249. https://doi.org/10.1210/jc.81.6.2247
Kuiper, G. G. J. M., Klootwijk, W., & Visser, T. J. (2003). Substitution of cysteine for selenocysteine in the catalytic center of type III iodothyronine deiodinase reduces catalytic efficiency and alters substrate preference. Endocrinology, 144, 2505–2513. https://doi.org/10.1210/en.2003-0084
Pinto, S., Croce, L., Carlier, L., Cosson, E., & Rotondi, M. (2023). Thyroid dysfunction during gestation and gestational diabetes mellitus: a complex relationship. Journal of Endocrinological Investigation, 46, 1737–1759. https://doi.org/10.1007/s40618-023-02079-3

SupportingmaterialFinal.docx

Download PDF

Editorial decision: Major Revisions Needed
19 Oct, 2023
Reviewers agreed at journal
13 Oct, 2023
Reviewers invited by journal
13 Oct, 2023
Editor assigned by journal
12 Oct, 2023
First submitted to journal
12 Oct, 2023

You are reading this latest preprint version

The expression of deiodinase 2 and deiodinase 3 are reduced by insulin and D-glucose respectively, in human placental explant cultures

Status:

Version 1

Abstract

Figures

1 Introduction

2 Material and methods

3 Results

4 Discussion

Declarations

Author Contributions

Funding

Acknowledgments

References

Supplementary Files

Status:

Version 1