2.1 Main reagents
GSH peroxidase 4 (GPX4; 67763-1-Ig, 1:3000), anti-solute carrier family 7 member 11 (SLC7A11; also known as xCT; 26864-1-AP, 1:3000), acyl-CoA synthetase long-chain family member 4 (ACSL4; 66617-1-Ig, 1:3000), anti-transferrin 1 (FPN1; 26601-1-AP, 1:3000), ferritin heavy chain 1 (FTH1; 10727-1-AP, 1:3000), GAPDH antibody (60004-1-Ig, 1:5000), HRP Goat anti-Rabbit IgG (15014, 1:5000), HRP Goat anti-Mouse IgG (15015, 1:5000) (Proteintech, China), cell malondialdehyde (MDA) detection kit (A003-1-2; Jiancheng, Nanjing, China), GSH detection kit (A006-2-1; Nanjing, China), Prussian blue iron staining kit (G1422; Beijing Solarbio Science & Technology Co., Ltd., China), hematoxylin and eosin staining reagents (G1120; Beijing Solarbio Science & Technology Co., Ltd., China) and High-sig ECL Western Blotting Substrate (180-501; Tanon Science and Technology Co., Ltd., China).
2.2 Experimental animals
Specific pathogen-free (SPF) male Sprague-Dawley (SD) rats (5-6 weeks old; body weight, 180.6±10.5 g) were purchased from the SPF Experimental Animal Center of Dalian Medical University [qualification number: SCXK (Liao) 2018-0003; Dalian, China]. Rats were adaptively fed for 7 days and randomly divided into four groups: The normal control (NF) group, which was fed with ordinary feed; the high-fat diet (HFD) group, which was fed with high-energy feed to induce simple obesity; the HFD-induced OHF group; and the OHF treated with Dapa (DA; 10 mg/kg/day for 4 weeks) group. For all groups, suitable humidity, temperature and light conditions were maintained during the feeding process.
Experiments were carried out according to the Guideline for the Care and Use of Laboratory Animals published by the National Institutes of Health, USA. All experimental procedures were approved by the Animal Experimental Ethics Committee of Affiliated Zhongshan Hospital of Dalian University (animal experimental research plan no. 202104031; Dalian, China).
2.3 General situation
- Body weight (g): The weight of the rats was accurately determined using electronic smart scale equipment (those whose average body weight exceeded 20.0% of the common feed group were regarded as the standard of the obese group [15]).
- Body length (cm): The distance from the tip of the nose to the anus of the rat was measured with a scale.
- Lee's coefficient = 3 √weight (g) x 10/body length (cm).
2.4 Blood pressure measurement
The systolic and diastolic pressure of the experimental animals were registered through the MedLab (Beijing Rillabao Technology Co., Ltd, China) biological function experiment system. Each rat was continuously measured for 3 days, and the average value was selected for statistics.
2.5 Metabolic parameters
In the 16th week, all rats were fasted but allowed to drink water for 8 h. Rats were anesthetized using ketamine (100 mg/kg) via intracavitary injection, and blood from the tail tip of the rats was taken to measure the fasting blood glucose (FBG) and postprandial blood glucose, and venous blood was collected through the inner canthus of the eye of the rats and the serum insulin (INS) level, insulin sensitivity index [quantitative insulin-sensitivity check index =1/(lgFBG + lgINS)] and insulin resistance index (homeostatic model assessment for insulin resistance = FBG x INS/22.5) were analyzed using the corresponding ELISA kit (RX30247R; Quanzhou Ruixin Biological Technology Co.,LTD, Quanzhou,China).
The blood lipid levels, including the triacylglycerol (TG), total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C) and low-density lipoprotein cholesterol (LDL-C) serum levels, were determined using an automatic intelligent Biochemical analysis instrument (AU5821; Beckman Coulter, Inc., USA). The thiobarbituric acid method was used to examine the MDA concentration at 532 nm, and the colorimetric method was used to measure GSH at 405 nm.
2.6 Echocardiography
After the 12th and 16th weeks, the rats were anesthetized (1% sodium pentobarbital dose (20 mg/kg) by intracavitary injection) and the cardiac function parameters of the rats were measured using a 12.0 MHz ultrasonic probe (General Electric, USA). Rats were anesthetized after the 12th and 16th weeks. Representative systolic and diastolic functional parameters, including left ventricular diastolic dimension (LVIDd), left ventricular internal dimension in systole (LVIDs), left ventricular ejection fraction (LVEF), left ventricular fractional shortening (LVFS), early diastolic filling to atrial filling velocity ratio of mitral flow (E/A) and early diastolic filling velocity/early diastolic velocity of the mitral annulus ratio (E/E'), were recorded and analyzed. All measurement data obtained were measured by two experienced professionals who were not informed of the experimental grouping situation, and the measured data were averaged over three consecutive periods.
2.7 Histology analysis and tissue staining
Following 4 weeks of treatment, all rats were sacrificed by a 1% sodium pentobarbital overdose (100 mg/kg) by intracavitary injection. Histology analysis included H&E staining, Sirius red staining and Prussian blue staining. Briefly, paraffin sections of the heart tissues were deparaffinized, rehydrated and then stained using a HE kit (G1120; Beijing Solarbio Science & Technology Co., Ltd., China), Sirius red kit (G1472; Beijing Solarbio Science & Technology Co., Ltd., China) and Prussian blue kit (G1422; Beijing Solarbio Science & Technology Co., Ltd., China), respectively. Sections were observed using a DP73 microscope (Olympus Corporation, Japan). ImageJ Plus 6.0 software (National Institutes of Health, USA) was used to measure the proportion of collagen fiber tissue to evaluate the degree of left ventricular interstitial fibrosis.
2.8 RNA-sequencing (RNA-seq) technology
Library preparation and RNA-seq were performed by the Experimental Department of Novogene, China. Cardiac tissues of SD rats (HFD and OHF) were processed for RNA-seq transcriptome analysis using a Hiseq 4000 system (Illumina, Inc., USA). Raw sequences were processed by quality control, trimming (Trimmomatic version 0.36) and alignment (STAR/2.5.1b). Downstream analyses were performed with R (version 3.1.1), using edgeR and limma packages with the voom method. Differentially expressed genes were further processed for Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway significant enrichment analysis. Quantitative PCR (qPCR) and western blotting were used to validate the expression of candidate genes in the HFD and OHF groups.
2.9 Transmission electron microscopy (TEM)
A total of three rats were randomly selected in each group, and their myocardial tissues were fixed with 2.5% glutaraldehyde, soaked in 1% azetidine acid, washed with PBS solution, and the effective concentrations (50.0, 75.0, 85.0, 95.0 and 100%) ethanol immersion, acetone dehydration, Epon812 infiltration, tissue embedding, sectioning, and uranium-lead staining. Subsequently, the myocardial tissue structure of rats was observed using a JEM-2002EX transmission electron microscope (JEOL, Ltd., Japan), and images were captured and saved.
2.10 Western blotting
Myocardial tissue was ground to obtain lysate. After centrifugation (4℃,13000×g, 20min), the supernatant was taken to determine the protein concentration using the BCA method. Proteins were separated using 10% SDS-PAGE and transferred to PVDF membranes, which were probed with primary antibodies against GSH peroxidase 4 (GPX4; 67763-1-Ig, 1:3000), anti-solute carrier family 7 member 11 (SLC7A11; also known as xCT; 26864-1-AP, 1:3000), acyl-CoA synthetase long-chain family member 4 (ACSL4; 66617-1-Ig, 1:3000), anti-transferrin 1 (FPN1; 26601-1-AP, 1:3000), ferritin heavy chain 1 (FTH1; 10727-1-AP, 1:3000), GAPDH antibody (60004-1-Ig, 1:5000), HRP Goat anti-Rabbit IgG (15014, 1:5000), HRP Goat anti-Mouse IgG (15015, 1:5000) (Proteintech, China). ECL luminescent solution was added dropwise for protein visualization and grayscale analysis was performed using Image J 6.0 (National Institutes of Health, USA).
2.11 Reverse transcription-qPCR (RT-qPCR)
The RT-qPCR technique was used to detect the target genes (GPX4, SLC7A11, FPN1, FTH1 and ACSL4)(Table 1). The internal reference gene was GAPDH. qPCR included total RNA extraction, cDNA synthesis and qPCR reaction, and the volume of the reaction system was 20 µl.
Table 1 Primer sequences for qPCR
Gene
|
Forward sequence (5'-3')
|
Reverse sequence (5'-3')
|
GPX4
|
AATTCGCAGCCAAGGACATC
|
GGCCAGGATTCGTAAACCAC
|
SLC7A11
|
GGTGGTGTGTTTGCTGTCT
|
AGAGGAGTGTGCTTGTGGA
|
FPN1
|
TCCTGGGCTTCGACTGTATC
|
CAAGTGAAGGCCACAGTTCC
|
FTH1
|
GGCTGAATGCAATGGAGTGT
|
TCTTGCGTAAGTTGGTCACG
|
ACSL4
|
AGACAAACCCGGAAGTCCAT
|
AGGCTGTCCTTCTTCCCAAA
|
GADPH
|
TCCGCCCCTTCCGCTGATG
|
CACGGAAGGCCATGCCAGTGA
|
ACSL4, acyl-CoA synthetase long-chain family member 4; FTH1, ferritin heavy chain 1; FPN1, transferrin 1; GPX4, glutathione peroxidase 4; SLC7A11, solute carrier family 7 member 11.
2.12 Statistical analysis
SPSS 20.0 software (IBM Corp., USA) was used for statistical analysis of the data. The measurement data are presented as the mean ± standard deviation (`x ± s). Comparisons among the means of multiple groups were performed using one-way analysis of variance and pairwise comparisons. P<0.05 was considered to indicate a statistically significant difference.