Preparation of viral templates
The pQβ7 plasmid is an infectious plasmid encoding a full-length cDNA copy of the Qβ genome (29). The pQβ7 plasmid holds an ampicillin resistance gene. The plasmid was purified using a Midiprep kit (Nucleobond Xtra Midiprep, Macherey-Nagel) followed by phenol/chloroform extraction and ethanol precipitation. The purified pQβ7 plasmids were used as a template in two different ways: directly as a template in CFI systems or as a template for in vitro RNA transcription of Qβ (+)-RNA, which subsequently served as the template in CFI systems.
In the latter case, the pQβ7 plasmid was linearized using SmaI (Thermo Scientific) to ensure well-defined 3’-ends of the resulting transcripts, while the 5’-ends are dictated by the upstream T7 promoter. The linearized DNA was purified by phenol/chloroform extraction and ethanol precipitation. Qβ (+)-RNA was produced by the “TranscriptAid T7 High Yield Transcription Kit” (Thermo Scientific) using the linearized pQβ7 as a template. The RNA products were purified by phenol/chloroform extraction followed by ethanol precipitation and the yield and homogeneity of the RNA was determined by 1% agarose gel electrophoresis.
Isolation of Qβ phage particles
E. coli HB101 cells were transformed with pQβ7 and grown in 100 mL LB medium for 48 hours at 37°C with shaking. The culture was centrifuged at 12,000 ×g for 30 minutes at 4°C, and the resulting supernatant containing the Qβ phage particles was filtered through a 0.45 µm sterile filter followed by filtration through a 0.2 µm sterile filter. The Qβ phage particles were precipitated for 48 hours in a solution with a final concentration of 9% PEG 6000 and 0.45 M NaCl, and subsequently centrifuged at 15,000 ×g for 30 minutes at 4°C. The pellet was dissolved in 3 mL 40 mM Tris/HCl pH 7.6, 20 mM MgCl2 and 200 mM NaCl followed by dialysis overnight against the same buffer. The phage particle solution was added glycerol to 33% prior to storage at -20°C.
Purification of Hfq
BL21(DE3) was transformed with pTYB11-6 (New England Biolabs) encoding Hfq with a N-terminal tag consisting of a chitin-binding domain embedded in an intein tag for ease of purification (30). A 2L culture was inoculated with 1.25% overnight culture of the transformed cells and grown in auto-induction media (10 g/L peptone, 5 g/L yeast extract, 10 g/L NaCl, 25 mM Na2HPO4, 25 mM KH2PO4, 10 mM NH4Cl, 2 mM MgSO4, 0.5% glycerol, 0.05% D-(+)-glucose, 0.2% L-(+)-lactose, 100 µg/mL ampicillin) at 37°C overnight. The cells were harvested and resuspended in column buffer (20 mM Tris/HCl pH 8, 500 mM NaCl, 1 mM EDTA and 1 mM PMSF pr. gram cells) and subsequently lysed with lysozyme (0.5 mg/g cells) and deoxycholate (0.1 mL/g cells). The lysed cells were DNase treated (0.5 mg/mL, Roche) and centrifuged (4,500 rpm, 40 minutes). The supernatant was applied to a chitin column (New England Biolabs) equilibrated with column buffer followed by washing overnight with the same buffer at 4°C. On the following day, the column was flushed with flush buffer (20 mM Tris/HCl pH 8, 500 mM NaCl, 1 mM EDTA and 50 mM DTT), the flow was stopped, and the column was incubated for 24 hours at 4°C and for 24 hours at room temperature. Hfq liberated by intein splicing was eluted with column buffer and dialysed overnight at 4°C against dialysis buffer (20 mM Tris-HCl, 200 mM NaCl). The protein concentration was determined by the Bradford microarray procedure (Bio-Rad).
Cell-free infection systems
The ability of the Qβ virus to replicate in a bacterial cell-free system was tested in three different cell-free protein expression systems, which were either of commercial origin or homemade. The Qβ genome was used as a template either as a plasmid-borne cDNA copy or as an in vitro transcribed (+)-RNA, which were directly added to the systems.
The “PURExpress® In Vitro Protein Synthesis” (PURE) kit (New England Biolabs) contains all the purified E. coli components required for cell-free translation. Additionally, it contains T7 RNA polymerase to enable transcription from a DNA template driven by a T7 promoter. 25 µL reactions were set up following the instructions from the manufacturer with intact pQβ7 plasmid (0.8 µg) or Qβ (+)-RNA (6 µg) as templates. Since Hfq was not expected to be part of the system, this host protein was either added (4.4 µg) in 10 − 1,000 times molar excess over added genomes or left out to study its importance. The reactions were incubated at 37°C for 4 hours at 160 rpm.
The “S30 T7 High-Yield Protein Expression System” (S30 T7) (Promega) is a kit containing an E. coli extract, which has been subject to a S30 centrifugation step. The extract contains T7 RNA polymerase. CFI reactions of 25 µL were set up using this kit with pQβ7 plasmid (0.8–3.2 µg), Qβ (+)-RNA (3–12 µg) or control DNA (provided by the manufacturer) as templates. The protocol from the manufacturer was followed and the reactions were incubated at 25°C for 8–16 hours or at 37°C for 3 hours at 160 rpm. The ability of intact Qβ phage particles to replicate in a CFI system was tested using the S30 T7 kit. Reactions containing ~ 50 or ~ 200 Qβ phage particles instead of the DNA or RNA template were prepared. A separate reaction with 1.6 µg pQβ7 was included as a positive control. The reactions were incubated at 25°C for 16 hours at 160 rpm.
A cell-free protein synthesis (CFPS) system was made by growing and processing BL12(DE3) E. coli into a functional S30 T7 extract following the protocol established by Krinsky et al. (31). The extract contains T7 RNA polymerase, since the strain contains the λDE3 lysogen that carries the gene for T7 RNA polymerase. The buffers and solutions were prepared as described by Krinsky et al. (31). The aromatic amino acids were dissolved by adding a small amount of NaOH, and undissolved amino acids were removed by filtration (45 µm). E. coli BL21(DE3) cells were grown as described by Krinsky et al. (31). The cells were harvested, and the pellet was resuspended in 30 mL lysate buffer (10 mM Tris-acetate pH 7.4, 14 mM magnesium acetate, 60 mM potassium acetate, 1 mM DTT, 7.2 mM 2-mercaptoethanol). The cells were broken by passaging through a High-Pressure Homogeniser at 15,000 psi twice. 50 µL reactions added 40 U “Ribolock RNase inhibitor” (Thermo Scientific) were set up with Qβ (+)-RNA (24 µg) or pQβ7 (0.6 µg) as templates. Control reactions with a pET vector encoding a 10 kDa protein (0.5 µg) or without a template were included. The reactions were incubated either at 25°C for 5–16 hours or 37°C for 16 hours at 160 rpm.
Analysis of phage production
The production of infectious Qβ phages in the CFI systems was evaluated with a double-layered plaque assay (32). Pure Qβ phages were included as a positive control, and top agar, uninoculated overnight culture, LB medium and H2O were included as negative controls to assess potential sources of contamination. The indicator E. coli strain K603 (Coli Genetic Stock Center, Yale University; F+, thr-1, araC14, leuB6(Am), lacY1, glnX44(AS), galK2(Oc), galT22, λ−, ΔtrpE63, xylA5, mtl-1, thiE1, F1-10(Tn10)) was grown on a LB agar plate with tetracycline overnight at 37°C. 250 µL of the overnight culture was added to 25 mL LB media (37°C) with tetracycline and incubated at 37°C, 160 rpm until OD600 ≈ 0.6. The cells were harvested by centrifugation (5,000 rpm, 5°C, 15 minutes), and the pellet was resuspended in 5 mL LB media added tetracycline. LB agar plates were made with added supplements (2 mM CaCl2, 0.1% glucose, 10 µg/mL thiamine). Autoclaved top agar (10 g/L peptone, 5 g/L yeast extract, 10 g/L NaCl, 5 g/L agar, 5% glycerol) was mixed with supplements and tetracycline and aliquoted into sterile 4 mL tubes placed at 60°C on a heating block. The top agar was cooled briefly before addition of 100 µL of the freshly grown K603 E. coli cells followed by pouring on the LB agar plates. The CFI reactions were analysed undiluted and in dilutions in the range from 10− 2 to 10− 10, while only the undiluted control reaction without template was analysed, as were all the other negative controls. A positive control with purified Qβ phages were included. 10 µL of each dilution was transferred to 190 µL LB media and spread on the solidified top agar. The plates were incubated at 37°C overnight.
On the following day, plaque-forming units (PFU) were counted on the plates, where density allowed a sound determination of the number of PFU, and the dilution was taken into account resulting in the total PFU (PFUtotal) in the sample. The average number of the PFUtotal was calculated, when countable numbers of plaques appeared on several plates representing different dilutions of the same reaction.
The concentration of PFU/µL was calculated:
![](data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAI0AAAA3CAYAAAAxD8m2AAAGAklEQVR4Ae2YgVHrMAyGuwIzsAI7MAIzsAIbsAEbMAETsAALsAE79N3Xe3/vRyip3SQ0DfJdSWxLsiN/kRR2+2rlgU4P7DrlS7w8sC9oCoJuDxQ03S4rhYKmGOj2QEHT7bJSKGiKgW4PFDTdLiuFgqYY6PZAQdPtslIoaIqBbg8UNN0uK4WCZgID7+/v+91u9+13e3u7f3t7+2Y1yqj/+Ph4kLu/vz/awCbt9fX1OPby8vLN3qU7Bc3EE3h6etrf3d0drQDCzc3Nsc8NEAHK19fXcRxQnp+fD33GmVdfQth9eHhQdzXXgmbiUXCogKOm6PPx8aGhPZHCwWICQBRVkAWaz8/Pow436MSo9U3gQp2CZqLjiSp+sEorbhawxlIMOqQ1b4o+ESSXudR9QTPB84oQSjvAA0QeeTDPmOoYrnGelKb6RtvBVgRJc5e+FjQTToDo4TBwyLEuiWABh6culkePaOMNsCJIPn/J+4JmgvdJO6cK1aye8SVJP0P1TATJ9ea6F/g9axU0E7xP2jnl7Fgox+VUOPt4BhLRiS+ultYjiz3s9tROBU3LKSQy1BxECH0BJSKHT+yshnFZpS8V0xweX01e9wCm10UClSupjTUU8VpksS8b7KW3dipo/AQ77jko/YbUsn/aZbLUQYIiq4vQAQqBRV+FMtBRiKMngKMs49hHlsa+Vbwz11s7FTQHN67/D4fuDTBitBAUY7KKZLJFRHM7Gh+7NkGjN0pXNhW/EjQXr6IYec1JV7mbcYXXuFkKNdmIc1k/WyeTu6YxogEpheiAP2hEMUUe/MM8bUwWf6MHKNKVnR5wmqBhAQ5WIY0F6ItsNhtl9GAChD4Pxia98QCEVtn2Oe497Ma5oX62zpDsNYzjZ15UfCGf42/G9MLJf5msvpAECDqCj5fV7bb4owkaFhDJMuoLM5bJAAzkq/GQkWig4Zc1HMMD9TZ04jq9Nkp+2ANN0ECjH6zSigOBjOjNlpMOV2/AOHTAmU324emKe+8PreNr1v00DzRBQ4TgracR/jjoGHkUKolA/Bwy9AAjRg1CKrIRJOR1+Aq7h8X/pziHk314P1tHuvHq9Y/2Ha+eXqP+X+2fhAZI3JHAwZvthykZjTHPmLcYEZgbSz8clkcQ2WIvsi3o1EcmW0e6c17dJ1u6b/HRSWh4iwFlrCETI0+Uz+qMmGpcB3lPf8zR972oGHS9GHl8ru7n8cBJaKgrsjfel481j8/pnrcxQpCBhPxQBCL6+NcX997PIg/paijFMH4qSgzp6rn+4nUUGh3CmOMkE2uY6EwihGTQAcSh6AQIWXEMnNJRlOJKpKMGipGHMdaNsMa9Vb/PA6PQcHh6E4cc3yLDlhQ9sMdBAg3wxKaDzubQAxqu2OOHPQBDnjnt169xjUv1ebahRl2Gj7PnHtLJxtHHDj+v9TLZc8dGoTnX6BQ9RZBoA4d7Korza++P1YY8F6laL8SUw0aXl4qX5lRZca7PVgcND5w5jWhyjdDw5isVc5CxARPAKMKQgulPaZQTU22Mrf/zKcakF54DDNUscSkccY3QqN4iXWTQ8Lyq9XhmpdzsxWGeiOtzsY9My4dJ9G9Pf1XQ9Gz82mSHoAEk/9AAAsaQzxpRyyHLAFHNl+nPMVbQzOHFBhut0GBqDBrSjn9Zxj5RCH2lu4atdYsUNN0uO09hDmgAASCIRjRFJfUZIx0Opfjzdv5Tq6D56ZNFRlqhUaTI0pP+baENEnFiwUv6il9NXgNJd8q1oJnivQ7dIWioSbzABwRqkqz5xwBRh4iCvqeimK5YF5k5W0EzpzdHbHHgpBaihTd9LZFWFEm8MHZZ/T9HIFAQqxAmRSldAR4ysoftOVtBM6c3E1ukBg47/jxlcLiKOF7kRnNEIIECILItW8zFdehrPto7t1/QnOu5X9YTIL+8bLpcQZO6ZX2DpBiixhpaQbOGU2jYA2nL/6nXoLKYSEGzmGu3a7ig2e7ZLvZkBc1irt2u4YJmu2e72JMVNIu5druGC5rtnu1iT1bQLOba7RouaLZ7tos9WUGzmGu3a/gf7IiMTFZA2x0AAAAASUVORK5CYII=)
Analysis of viral protein production
Where indicated, radioactive [14C]-serine (SA 2.75 mCi/mmol) was included in the CFPS reactions following the protocol of Krinsky et al. (31) to allow detection of the produced proteins. The reactions were incubated at 25°C for 16 hours at 160 rpm. The CFPS samples (10 µL) were run on a 4%-20% gradient Mini-PROTEAN TGX Precast Protein Gel (Bio-Rad), which was subsequently fixed in fixer solution (50% ethanol, 10% acetic acid, 3% glycerol) for 30 minutes and dried at 80°C in a gel dryer overnight. The dried gel was placed in a “Molecular Dynamics Storage Phosphor Screen” and exposed for 4 days. The cassette was scanned in a “Typhoon Trio” imager (GE Healthcare). An area of the gel containing a high concentration of free [14C]-serine caught in the front was omitted to achieve higher sensitivity and the gel was exposed for an additional 6 days and scanned again.
Analysis of viral RNA replication by RT-PCR
The viral RNA replication in the CFPS system was analysed by reverse transcription polymerase chain reaction (RT-PCR). Total RNA was purified from CFPS reactions added either pQβ7, Qβ (+)-RNA or pET vector as a template and from purified, intact Qβ phages using the “Nucleospin RNA” kit (Macherey Nagel). Additional DNase treatment of the RNA was performed using the “RNase-free DNase I” kit (Thermo Scientific). The purified RNA was analysed on a 1% agarose gel, and the RNA concentration was determined on a “Nanodrop” instrument measuring the absorbance at 260 nm. First-strand synthesis was carried out using the “RevertAid First Strand cDNA Synthesis” kit (Thermo Scientific) using the Qβ_genome_3’UTR primer (Sigma) (Table 1). “Herculase II Fusion DNA Polymerase” (Agilent Technologies) was used in the subsequent PCR reactions. RNA extracted from intact Qβ phages was included as a positive control for the presence of Qβ (+)-RNA, while negative controls without added template, without primer or without reverse transcriptase were included as well. The primers used in the subsequent PCR were Beta-upstream (Sigma) and Qbeta_rev (Sigma) (Table 1). The forward primer binds upstream of the β-subunit gene, while the reverse primer binds within the β-subunit gene (Fig. 1). The resulting PCR product has a size of 1036 bp. PCR cycling began with template denaturation at 95°C for 1 min, then 30 cycles of 95°C for 20 sec, 57°C for 20 sec and 72°C for 1 minute and one cycle at 72°C for 5 minutes. The quantity and size of the resulting PCR products were analysed on a 1.5% agarose gel, where 4 µL samples were loaded.
Table 1
Primer
|
Tm (°C)
|
5’ 3’
|
Application
|
Beta-upstream
|
66
|
CGCGATCCATCCAGTGGTGG
|
PCR
|
Qbeta_rev
|
62
|
CCTTAGGTGATCTGAGGTCC
|
PCR
|
Qβ_genome_3’UTR
|
59
|
GGGCAAAGCAGATCCCCCTC
|
cDNA synthesis
|
The melting temperature (Tm) is indicated for the primers used for RT-PCR. The primer sequences are shown in the 5’-3’ direction, and their specific applications are provided. All primers were from Sigma.