Cell lines
The NPC cell line, CNE1, was obtained from the Shanghai Institutes for Biological Sciences (Chinese Academy of Sciences, Shanghai, China). CNE1 cells were irradiated with X-ray doses of 2 Gy every other day for 40 days, resulting in 20 total irradiation treatments. Surviving cells were considered radioresistant (CNE1/IR) and were cultured in RPMI-1640 (Gibco; Invitrogen, Carlsbad, California, USA) supplemented with 10% FBS (HyClone, Thermo, USA) and 1% penicillin-streptomycin in a humidified incubator at 37°C and 5% CO2.Slit2, Robo1, Robo2 shRNA and scrambled control shRNA carrying lentivirus were purchased from Gene Pharma. CNE1-IR/NC, CNE1-IR/Slit2, CNE1-IR/Robo1 or CNE1-IR/Robo2 were produced by infecting CNE1-IR cells with Lentiviral vectors LV3-NC, LV3-shSlit2, LV3-Robo1and LV3-Robo2, separately.
Colony formation assay
The colony formation assay was employed to confirm a lethal dose of NPC cells with IR. CNE1 cells were plated onto 6-well plates after IR. Cells were exposed to radiation in a Gamma Cell Radiator (RS-2000 XE Biological Irradiator, RAD. SOURCE) using X-rays as a radioactive source. A radiation dose of 1.47 Gy/min was applied to all groups., and after administration of the different doses 0Gy, 4Gy, 8Gy, 12Gy, 16Gy, 20Gy. The medium was changed after irradiation for 24 hours. After two weeks, cell colonies were fixed with methanol, stained with 0.1% crystal violet, and scored by counting the number of colonies with an inverted microscope, using the standard definition that a colony consists of 50 or more cells.
Enzyme-linked immunosorbent assay (ELISA)
The levels of Slit2 were detected by ELISA (Bio-swamp) in supernatural of lethal CNE1 cells. The samples were incubated in ELISA plates for 90 min at 37℃. Then the biotinylated antibodies were added and incubated for 30 min at 37℃. After washing with washing buffer, HRP-conjugate reagent were added to each well for 30 min at 37℃. The chromogen 3,3΄,5,5΄-tetramethyl benzidine was added to each well to perform enzyme reaction for 15 min at 37℃ before washing repeat 5 times. Last, the reactions were stopped by the stop solution. The absorbances were measured at 450 nm using a microplate reader (Bio-Rad, model no. 680) at 450 nm, and the results were calculated using a calibration curve prepared from standards.
Cell migration assay.
Cell migration was detected using a Transwell assay. 1×104 stable cells in 100 µl serum-free medium were added to the top chamber of the transwell (0.4 µm pore size, Corning,USA). The bottom well contained growth medium with the supernatant of lethally irradiated NPC cell lines. Cells were incubated at 37°C for 24 h. After 24 h, the cells that up-regulated or knockdown related gene were seeded in the upper chamber. Regular medium containing various agents (rSlit2 and Wortmannin) was added in the lower chamber as the chemoattractant. After incubation at 37˚C for 12 h, the cells were fixed with ethanol and stained with 0.1% crystal violet for 30 min. After washing the cells with PBS, the cells on the upper surface of the filter were mechanically removed with a cotton swab. The invading cells on the lower surface were equantified by counting the number of cells that migrated in 10 random microscopic fields per filter at a magnification of ×200 (TE2000,Nikon). These experiments were repeated three times, and three wells were used for each treatment.
Cell invasion assay.
The invasive ability of cells was confirmed in 24-well transwell chambers (Corning, Corning, NY).The Matrigel was diluted with serum-free medium at the indicated concentrations and then 40 µl of diluted Matrigel was added to the upper chamber, and incubated at 37˚C for 4 h to solidify the gel. Cells were implanted and detected as described migration assay. These experiments were repeated three times, and three wells were used for each treatment.
Western blotting.
At the end of each treatment, the cells were washed twice with ice-cold PBS and then sonicated on ice in a lysis buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.5% sodium deoxycholate, 1% Nonidet P-40, 0.1% SDS,1 mM PMSF, sodium orthovanadate, sodium fluoride and aprotinin). Cell lysates were centrifuged at 12,000 rpm for 10 min at 4˚C, and the supernatants were collected for western blotting. Protein concentration was measured using a protein assay. After boiling for 5 min in the loading buffer with 10% 2-mercaptoethanol, the samples containing 30 µg protein were separated by SDS-PAGE and transferred onto nitrocellulose membranes. The membranes were blocked with 5% non-fat milk-TBST buffer for 1 h at room temperature and incubated with the corresponding primary antibodies overnight at 4˚C with gentle agitation. The primary Rabbit antibodies for Slit2, Robo1, Robo2, phosphorylation-AKT, AKT, and β-catenin were purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA) and were applied at a 1:500 dilution. A 1:1,000 dilution of β-actin (Cell Signaling Technology, Danvers, MA, USA) were also used as a loading control.The membranes were washed in TBST and incubated for 2 h with secondary antibodies at room temperature. The signals were detected using ECL reagent and analyzed using Image Lab 4.0 analysis software from Bio-Rad.
Quantitative real-time PCR
Total RNA from the cultured cells was isolated using the TRIzol reagent according to the manufacturer's instructions. Reverse transcription was carried out with PrimeScript™ RT reagent kit according to the standard protocol (Takara, Dalian, China). The primer sequences used were: slit2 Forward:5'-CGTTTGGAAAATG TGCAGCATAA-3'Reverse:5'-TTCGATTGCTTCTCAACATCAAAGT-3'; Robo1 Forward:5′-GCGTGCAGTACTAAGGGAACA-3′Reverse:5′-GGCTTCTTACATGAACATAATGAA-3′;Robo2Forward:5′-GGGTTACTACATCTGCCAGGCTT-3′Reverse:5′-AGGTGGAGGTCTATCTGTCAAAACAT-3′, qPCR analysis was performed on a Roche LightCycler Nano instrument using FastStart Essential DNA Green Master Mix, andβ-actin Forward: 5' CCTGGGCATGGAGTCCTGTG 3',Reverse: 5' TCTTCATTGTGCTG GGTGCC 3' was used as the endogenous control. The qPCR conditions were: pre-incubation at 95˚C for 10 min (1 cycle) followed by denaturation of 40 cycles at 95˚C for 20 sec, annealing at 60˚C for 20 sec and extension at 72˚C for 20 sec. Treatments and conditions were performed in triplicate to calculate the statistical signifcance.
Co-immunoprecipitation Assay
Robo1 overexpressing CNE1-IR cells were serum starved for 6 h and treated with rSlit2 for 10,20 and 30 min. Cells were lysed and incubated in lysis buffer (150 mM NaCl, 10 mM Tris pH 7.5, 2 mM Mg2Cl2 and 1% Triton X-100) for 30 min at 4°C. Cell lysates were precleaned with normal mouse/rabbit IgG and A/G beads (Santa Crus) for 2 h at 4°C. Immunoprecipitation was performed using antibodies against Robo1, p85 and mouse/rabbit IgG overnight at 4°C. The antigen-antibody complex was immobilized with A/G beads for 2 h at 4°C. After washed with wash buffer (150 mM NaCl, 10 mM Tris pH 7.5, 2 mM Mg2Cl2 and 0.1% Triton X-100), proteins were eluted by addition of loading dye and boiling at 95°C for 2 min. The proteins were subjected to SDS-PAGE analysis followed by immunoblotting with various antibodies.
Immunofluorescence
Control and shRobo1 of CNE1/IR cells were seeded on coverslips and treated with rSlit2. The cells were washed with PBS, fixed in 4% paraformaldehyde for 10 min, washed with PBS and permeabilized in 0.2% Triton X-100 for 15 min. After washed with PBS, cells were blocked with PBS containing 10% FBS for 2 h before incubation with the primary antibody as indicated anti-β-catenin overnight at 4°C. The cells were incubated for 1 h with a fluorochrome-conjugated secondary antibody (Alexa Fluor 488 anti-mouse). Coverslips with stained cells were then washed with PBS, stained with 4’,6-Diamidino-2-phenylindole (DAPI), and mounted onto glass slides with Vectashield mounting medium (Vector Laboratories, Burlingame, CA). For the primary tumor tissue sections, 100°C EDTA buffer was used for heat induced antigen retrieval. Slides were blocked in PBS containing 10% FBS and then incubated with primary antibodies against β-catenin(Sigma) overnight at 4°C. The slides were incubated for 1 h with fluorochrome-conjugated secondary antibody (Alexa Fluor 488 anti-mouse or Alexa Fluor 594 anti-rabbit). Slides were then stained with DAPI, and mounted onto glass slides with mounting medium.
In vivo tumor metastasis experiment
Male nude mice aged 4 weeks were obtained from the Laboratory Animal Center of the Fourth Military Medical University (Xi’an, china) and were maintained under specific pathogen-free conditions. For in vivo tumor metastasis assay, mice(n=5each group) were implanted with 1×106/100μL CNE1-IR/NC cells or 1×106/100μL CNE1-IR/shslit2 cells on day 0 by lateral tail vein injection. Five weeks after inject, Metastatic was quantified using a noninvasive bioluminescence In Vivo Imaging System (IVIS) (Xenogen) as described previously[11]. All mice were killed for necropsy and observed the lung metastasis via H&E assay.
Statistical analysis
All data were presented as means ± standard deviation (SD). Differences between statistical comparisons were determined by Student’s t-test and One-way ANOVA analysis via GraphPad Prism version 6.0. Asterisk (*)indicated statistical significance with p-value ≤0.05. Asterisk (**) indicated statistical significance with p-value ≤0.01.