Tissue collection
The CRC tissues and adjacent normal colon tissues were obtained from Inner Mongolia Medical University Affiliated Hospital between 2015 and 2018. Totally, 40 pairs of tissues were analyzed in the study. Patients with CRC didn’t experience systemic treatment of chemotherapy or radiotherapy before surgery. All of patients had got the written informed consent. The study followed the ethics committee of Inner Mongolia Medical University Affiliated Hospital guidance. All specimens were stored at − 80℃ until use.
Cell culture
We cultured CRC cell lines SW1116, DLD-1, HCT116, SW480, SW620 and human normal colonic epithelial cells HCoEpiC in minimum essential medium (MEM) (Gibco, 41500034) with 1% Glutamax (Invitrogen, 35050-061), 1% Non-essential Amino Acids, 100X (Invitrogen, 11140-050) and 10% fetal bovine serum (FBS). Humidified atmosphere containing 5% CO2 at 37 °C was performed to incubate the cell lines mentioned above. We purchased the cell lines from the Institute of Biochemistry and Cell Biology at the Chinese Academy of Science (Shanghai, China).
Microarray data sets
Gene Expression Omnibus (GEO) (https://www.ncbi.nlm.nih.gov/geo/), a publicly available genomics database, is queried for all data sets. We downloaded the data set of CRC, which was the circRNA expression profile from GEO. The selected dataset in accordance with the following criteria: (1) They employed CRC tissue samples. (2) They took the adjacent normal tissues as control. (3) They utilized information on technology and platform.
Quantitative real time PCR assay
Total RNAs from tissues or cultured cells were isolated using TRIzol reagent (Invitrogen, Carlsbad, CA), following the manufacturer's instructions. Quantitative real-time PCR (qRT-PCR), the reverse transcription kit (Takara, Dalian, China) was used to reverse transcribed total RNA into cDNA according to the manufacturer’s protocol; while a stem-loop RT-qPCR method was used to generate miRNAs. qRT-PCR was conducted in ABI StepOnePlusTM real-time PCR system (Applied Biosystems, Foster City, USA). U6 and GAPDH were applied as internal controls. The gene-specific primers are listed in Table 1.
Table 1
Gene-specific primers used for qRT-PCR
Gene | Primer | Sequence 5’ to 3’ |
hsa_circRNA_000166 | Forward Reverse | GCTTGGAACAGACTCACGGC ATCTCCTGCCCAGTCTGACCT |
miR-326 | Forward Reverse | GGCGCCCAGAUAAUGCG CGTGCAGGGTCCGAGGTC |
LASP1 | Forward Reverse | TGCGGCAAGATCGTGTATCC GCAGTAGGGCTTCTTCTCGTAG |
U6 | Forward Reverse | TGCGGGTGCTCGCTTCGCAGC CCAGTGCAGGGTCCGAGGT |
GAPDH | Forward Reverse | ACACCCACTCCTCCACCTTT TTACTCCTTGGAGGCCATGT |
Plasmid and transfection
The siRNA- negative control (NC), siRNA-1, siRNA-2, miR-NC, miR-326 mimics, miR-326 I, hsa_circRNA_000166 wildtype (WT) and hsa_circRNA_000166 mutant (Mut) were constructed by GenePharma (Shanghai, China). According to the manufacturer’s instructions, we transfected the plasmids into HCT116 and SW480 cells using Lipofectamine 2000 Transfection Reagent (Invitrogen).
Cell Counting Kit-8 assay
Cell Counting Kit-8 (CCK‐8) assay was used to detect cell growth of HCT116 and SW480 cells. Each group was incubated with a density of 104 cells in 96‐well plates. Cells in each well was incubated lasted for 2 hr at 1, 2 and 3 day with CCK‐8 reagent (Doindo, Japan). We measured the optical density at 450 nm using an automatic microplate reader (Synergy4; BioTek).
Colony Formation Assay
We seeded the transfected cells into 6-well plates and cultured for 14 days and then fixed the cells with methanol and stained them with 0.5% crystal violet (Beyotime Biotechnology) for 30 min. Colonies with more than 10 cells were counted under a light microscope.
Flow cytometric assay
For apoptosis detection, the HCT116 and SW480 cells were transfected with different plasmids for 24 hours (h) before collection. Then, we used an Annexin V-FITC/PI apoptosis detection kit (Invitrogen) to label the HCT116 and SW480 cells with Annexin V and PI. Flow cytometry (FACScan; BD Biosciences) was used to detect and analyze the fluorescence (FL1) and red fluorescence (FL2).
Target predication
We obtained the sequence of hsa_circRNA_000166 from circbase (http://www.circbase.org). StarBase v2.0 (http://starbase.sysu.edu.cn) and circinteractome (https://circinteractome.nia.nih.gov) was utilized to predict the binding sites between hsa_circRNA_000166 and miRNAs.
Dual luciferase reporter assay
We constructed pGL3-promoter drived miR-326 luciferase reporter with containing the binding site for hsa_circRNA_000166. And then, we used Lipofectamine 2000 (Invitrogen) to transfect the luciferase reporter with hsa_circRNA_000166 WT and hsa_circRNA_000166 Mut into the HCT116 and SW480 cells. The firefly luciferase activity was detected at 48 hr after transfection using Dual Luciferase Reporter Assay system (Promega).
Western blot assay
For protein isolation after transfection, cells were lysed in the RIPA buffer (Beyotime, China). The SDS-PAGE gel assay was utilized to separate the proteins and then we transferred the separated proteins onto nitrocellulose membranes (GE Healthcare). Primary antibodies were used to incubate the membranes overnight at 4℃, following by washing the membranes for 5 times using phosphate buffered saline supplemented with Tween 20 (PBST). Subsequently, the corresponding horseradish peroxidase‐conjugated secondary antibodies (Santa Cruz) were used to incubate the membranes for 2hr at room temperature. Finally, the Super Signal West Femto kit (Pierce, Rockford, IL) was utilized to bring the bands on the membranes into visualization in the final. The primary antibodies and secondary antibody were used as following: rabbit anti-LASP1 (1:2000, Abcam, ab117806), rabbit anti-GAPDH (1:5000, Abcam, ab181602) and goat anti-rabbit IgG H&L (HRP) (1:1500, Abcam, ab205718). We used GAPDH as the endogenous control in this assay.
Statistical analysis
For significant difference analysis, GraphPad Prism 5.0 software was used to perform all the data. All results were analyzed using the two-tailed Student t-test and shown as the mean ± SD. *P < 0.05, **P < 0.01, *** P < 0.001.