Public Data Acquisition
We gathered two distinct sets of Hepatocellular Carcinoma (HCC) proteomic datasets, accompanied by relevant clinical information, from published literature. These datasets are referred to as the "Jiang et al’s Cohort" [8] and the "Gao et al’s Cohort" [22]. The Jiang et al’s Cohort comprises 101 tumor samples, 98 paracancerous samples, and the Gao et al’s Cohort comprises 159 pairs of tumor and paracancerous samples. In the Jiang et al’s Cohort, any missing values were addressed by imputing the minimum observed value. Furthermore, to facilitate subsequent analytical procedures, log2 transformation was applied to the data.
Survival Analysis
The survival curves were calculated with the R function survfit from the R package survival with the formula Surv (time, vitalstatus) ~ categorie and plotted with the R function ggsurvplot from the R package survminer.
The “surv_cutpoint” function was employed to classify our sample dataset. Subsequently, the power of the "coxph" function was harnessed to construct a Cox Regression model and compute Hazard Ratios (HR).
Biological function and pathway enrichment analysis
Pathway enrichment analysis was performed using Metascape Gene Annotation & Analysis Resource [23] that uses several ontology sources: KEGG Pathway, GO Biological Processes, Reactome Gene Sets, Canonical Pathways and CORUM. Proteins were clustered according to their pathways and processes. Relationships between genes were identified using the network map generated from the Metascape tool and visualized with Cytoscape.
Gene set enrichment analysis (GSEA) is a method of analyzing and interpreting microarray and such data using biological knowledge. The data firstly generated an ordered list of logFC based on differential analysis, and then a predefined gene set receives an enrichment score (ES), which was a measure of statistical evidence rejecting the null hypothesis that its members were randomly distributed in the ordered list. The R package clusterProfiler was mainly used for GSEA analysis.
Cell lines and cell culture
All hepatocellular carcinoma cell lines (Huh7, PLC/PRF/5 (PLC), MHCC-97H) were purchased from the Shanghai Cell Bank, Chinese Academy of Sciences (Shanghai, China), and were subjected to cell identification and mycoplasma detection. All hepatocellular carcinoma cell lines were cultured in DMEM (Gibco, USA) medium supplemented with 10% FBS and 1% penicillin-streptomycin (Gibco, USA). Human monocyte line THP-1 was purchased from Shanghai Zhongqiao Xinzhou Biotechnology Co., Ltd. and cell identification and mycoplasma detection were performed (Shanghai, China). The cell lines were cultured in RPMI-1640 (Gibco, USA) medium supplemented with 10% FBS and 1% penicillin of streptomycin (Gibco, USA). All cells were maintained in a humidified incubator at 37°C with 5% CO2 cells within 50 passages were used for experiments.
Macrophage polarization assay
THP-1 cells were treated with 162 nM phorbol 12-myristate 13-acetate (PMA, P8139, Sigma) for 24 h to differentiate into M0 macrophages. On the basis of M0, cells were polarized to the M1 phenotype after treatment with 100 ng/mL Lipopolysaccharide (LPS, L2880, Sigma) and 20 ng/mL Interferon-γ (IFN-γ, 300-02, Peprotech) for 24 hours. Based on this M0 state, cells were polarized to the M2 phenotype after treatment with 20 ng/mL interleukin-4 (IL-4, 200-04, Peprotech) for 48 hours.
MNDA Knockdown stable cell line generation
We used retroviral vectors containing short hairpin (sh) RNA for MNDA CCCAAACAGAATTATCGAAAT (denoted as shRNA1), GCACAATATCAAGTGTGAGAA (denoted as shRNA2), to transfect THP-1 cells. The transfected cells were selected in 4 µg/ml puromycin.
Immunostaining
Liver cancer tissues were first harvested and fixed overnight in 4% paraformaldehyde (PFA). Thereafter, the tissues were embedded in paraffin and sliced at 5 µm. The sections were blocked with 10% goat serum for 30 min at 37°C and then incubated overnight at 4°C with the following primary antibodies: MNDA (HPA034532, 1:1000; sigma), CD163 (ab182422, 1:100; Abcam), CD3 (ab5690, 1:100; Abcam). Samples were then incubated with the corresponding Alexa Fluor-conjugated secondary antibodies (1:100, Thermo Fisher Scientific) and finally examined using a confocal microscope (LSM 880, Carl Zeiss AG).
Isolation and characterization of exosomes
When macrophage confluence reached 80–90%, the cell culture medium was removed. Cells were washed twice with pre-warmed PBS and then macrophages were cultured in conditioned medium supplemented with 10% exosome-free fetal bovine serum (FBS, C3801-0050, VivaCell) for 48 hours. Approximately 50 mL of cell culture medium was collected for each cell line, the collected medium was centrifuged at 300 × g for 10 minutes, followed by centrifugation at 2,000 × g for 30 minutes to remove cell debris. Next, the supernatant was filtered using a 0.22-µm filter (Millipore). A 12,000 × g centrifugation was performed for 40 min, the precipitate was discarded, and the supernatant was retained. The exosomes in the supernatant were precipitated by ultracentrifugation at 100,000 × g for 90 min. After washing the exosome precipitate in PBS, the exosomes were precipitated again and resuspended in 500 µL of PBS. The protein content of the exosomes was determined by using the BCA Protein Assay Kit (Thermo Fisher Scientific). The exosomes were stored at -80°C for further use. Expression of exosome-specific marker proteins, such as CD63 and CD81, was detected by Western blotting. Exosomes were identified using transmission electron microscopy. First, 10 µL of exosomes were added dropwise to the copper grid, left for 1 min, and then the liquid was blotted from the side with filter paper. Next, 10 µL of uranyl acetate was added dropwise, left for 1 min, and then imaged at 100 kv for electron microscopic detection. The particle size and concentration of exosomes were measured using nanoparticle tracking analysis (NTA). First, frozen samples were taken, thawed in a 25°C water bath, and placed on ice. Then, exosome samples were diluted with 1 × PBS and used directly for NTA assay.
For exosome uptake experiments, exosomes were labeled with the PKH67 fluorescent Cell adaptor kit (Sigma-Aldrich) according to the manufacturer's instructions. That is, 50 microliter exosomes were mixed with 500 µL Diluent C; 2 µL of PKH67 and 500µL Diluent C were mixed and incubated for 4 min. Then 1mL of 1% BSA was added and incubated for 1min, mainly for termination of staining. Labeled exosomes were washed with PBS, collected by ultracentrifugation, and re-suspended in PBS. Exosomes were incubated with HCC cells and analyzed using confocal microscopy at the indicated time points.
Western blot analysis
Total proteins from cells or exosomes were extracted using RIPA lysis buffer containing protease inhibitor (A32955, Thermo). Protein lysates were then quantified using the BCA kit (#23227, Thermo Fisher Scientific). Proteins were separated by electrophoresis using 10% sodium dodecyl sulfate polyacrylamide (SDS-PAGE) and transferred to PVDF membranes (Millipore). The membranes were blocked with 5% skim milk for 1 h at room temperature and then incubated overnight at 4°C with the following primary antibodies: CD63 (ab217345, 1:1000; Abcam), CD81 (#66866-1-Ig, 1:1000; Proteintech), Calnexin (ab22595, 1:1000; Abcam), GAPDH (ab8245, 1:5000; Abcam). The membranes were then incubated with horseradish peroxidase-conjugated secondary antibodies of the corresponding species for 1 h at room temperature and subjected to electrochemiluminescence development by chemiluminescence instrumentation. Antibodies and reagents are detailed in Supplementary Table 1.
RNA extraction and quantitative reverse transcription PCR (qRT-PCR)
Total RNA was extracted using the TRIzol Reagent (#15596018, Life Technologies), according to the manufacturer's instructions, then reverse transcribed into cDNA using reverse transcriptase master mix (R312-00, Vazyme). The cDNA was subjected to qRT-PCR, performed on CFX96 qPCR system (Bio-Rad) using the SYBR Green Real-time PCR Master Mix (Q712-02, Vazyme) according to the manufacturer's instructions. The primers used in this study were synthesized by TsingkeBiotechnologyCo.Ltd. In this experiment, the relative transcript levels of the target genes were calculated by the 2- △△CT method using GAPDH as the internal reference: △△Ct = △Ct experimental group - △Ct control group, where △Ct = Ct target gene - Ct internal reference. The primer sequences are detailed in Supplementary Table 2.
Flow cytometry
When the macrophage fusion reached 80–90% after induction, the cells were washed twice with 1×PBS. The cells were then digested with 5 mM EDTA and collected into centrifuge tubes for centrifugation (4°C, 500 × g, 5 min), washed twice with PBS containing 1% FBS, and counted. The cells were then incubated in the dark for 30 min at 4°C with the corresponding antibody. Cells were washed 3 times with PBS. The stained cells were analyzed by flow cytometry (Fortessa, BD Biosciences, USA). Antibodies used for flow cytometry: CD163 (#326505, Biolegend), CD206 (#321109, Biolegend). Data were analyzed by FlowJo software 8.7.1 (Treestar Inc., USA).
Cell migration assay
The migration and invasion ability of HCC cells was determined by using 24-well Transwell chambers with upper and lower culture chambers separated by polycarbonate membranes with 8 µm pores (BD Biosciences, Franklin Lakes, NJ, USA). 1×105 cells were resuspended in 400 µL of serum-free DMEM medium and inoculated into the upper chamber. The lower chamber was filled with 600 µL of M2 supernatant or exosomes containing 10% FBS, and PBS was used as a control. After incubation for 24 h in a humidified incubator containing 5% CO2 maintained at 37°C, the remaining cells in the upper chamber were removed, and cells migrating to the surface of the lower chamber were fixed with 4% paraformaldehyde and stained with 0.5% crystal violet. At least five random microscopic views (magnification ×100) were taken and the cells were counted. Three independent experiments were performed.
Wound healing assay
The cells were seeded in a six-well plate. Once the cells became sub-confluent, a 200 µL pipette tip was used to create a scratch wound, after 48 hours of co-culture with the conditioned medium and HCC cells, the width of the scratch was observed and images were obtained under microscope. The results are expressed as a percentage of wound closure.
Cell proliferation assay
Cell viability was tested with Cell Counting Kit-8 (CCK8) kit (Beyotime) according to the manufacturer's instructions. HCC cells were trypsinized, counted and then plated at a density of 8,000 cells per well in 96-well plates. After that, they were co-cultured with M2 CM. The cells were incubated at 37°C. The attached cells were treated with the CCK8 dilution for 1 hour, and then the absorbance of each well of the plates was measured at 450 nm.
RNA Sequencing and Raw Data Preprocessing
Total RNA from the cells was extracted using Trizol. RNA library construction and sequencing were performed by Berry Genomics Co. Ltd. Then the cDNA library was sequenced on an Illumina Hiseq 2500.
Quantile normalization, log2 conversion, missing values supplement and differential analysis for the matrix data of RNA-Seq dataset were performed using the “limma” package in R/Bioconductor software (version 4.2.1).
Proteomic analysis
Peptides (300 ng) obtained from M2 exosomes were used for LC-MS analysis. The LC-MS analysis was performed using an EASY nLC1200 FAIMS Orbitrap Exploris 480 mass spectrometer (Thermo Fisher Scientific, USA). The MS system uses Data Independent Acquisition (DIA) for scanning. The raw LC-MS/MS data files were analyzed using Spectronaut (version 17.2.230208.55965) with the spectra searched against the UniProt human database. Search parameters were set as follows: enzyme digestion: Trypsin/P digestion; variable modifications including: oxidation of methionine (M), protein N-terminal acetylation; immobilised modifications including: urea methylation (C); maximum of two missing trypsin cleavage sites allowed; Filtering for the protein and peptide identification was set at a 1% false discovery rate (FDR).
Animal studies
The animal care and experimental protocols were approved by the Institutional Animal Care and Use Committee (IACUC) of National Center for Protein Sciences (Beijing), Ethical review number: IACUC-20221209-78MT. NOD-SCID mice were purchased from Charles River, Inc (Beijing, Vital River Laboratory Animal Technology). All mice were 5–6 weeks old males. To examine the metastatic ability of the HCC cells, 6-week-old male NOD SCID mice were intravenously injected via the tail vein with 2 × 106 MHCC-97H cells that had been treated with M2 CM. The number of metastatic lungs, the number of clones in the lungs, and small metastatic foci were compared across the four groups.
Statistical Analysis
R version 4.2.1 was used for displaying and computation of publicly available data, RNA-seq and proteomics graphs using the R-packages ggplot2. Other analysis of data was performed using GraphPad Prism 8.0 software. The Student’s t-test was used for two-group comparisons, and one-way or two-way ANOVA was used for comparisons among more than two groups. All experiments were performed at least three times, and the data are presented as the mean ± SD. A P-value of less than 0.05 indicates statistical significance.