Cell culture and chemicals
The EGFR-mutant lung adenocarcinoma cells PC9, HCC827, H1975, and H1650 were kindly provided by Peking University Cancer Hospital. Cells were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum and maintained at 37°C in a humidified 5% CO2 atmosphere.
Gefitinib was purchased from Selleck Chemicals (Selleck, USA) and diluted in dimethyl sulfoxide (DMSO) at a concentration of 10 mmol/L. Estradiol (E2) was purchased from Sigma-Aldrich (Sigma-Aldrich, Germany) and diluted in pure ethanol at a concentration of 10 mmol/L. Both drugs were aliquoted and stored at -80°C.
RNA extraction and quantitative real-time PCR (qRT-PCR)
Total RNA was extracted using the RNAsimple Total RNA kit (Tiangen, China), and first-strand cDNA synthesis was performed using the PrimeScript™ RT Master Mix (Takara, Japan). The relative mRNA levels of ERβ1 and ERβ5 were measured using SYBR green PCR assays (Thermo Fisher Scientific, USA). The sequences of the primers used in qRT-PCR were as follows: ERβ1 forward primer: 5'-GTCAGGCATGCGAGTAACAA-3', reverse primer: GGGAGCCCTCTTTGCTTTTA; ERβ5 forward primer: 5'-TGGTCACAGCGACCCAGGATG-3', reverse primer: 5'-TTAGGGCGCGTACCTCGCATG-3'; GAPDH forward primer: 5’-GACCCCTTCATTGACCTCAAC-3’, reverse primer: 5’-CTTCTCCATGGTGGTGAAGA-3’. Cycle threshold (Ct) values were determined using the system and analysis software. The relative mRNA levels were determined by normalizing to the GAPDH mRNA levels.
Establishment of cell lines stably expressing ERβ1 and ERβ1/5
Lentiviral vectors expressing ERβ1 and ERβ5 were purchased from GenePharma (Shanghai, China). PC9 cells were infected with lentiviruses (MOI = 50) for three days. Subsequently, transduced cells were selected with 2 μg/mL of puromycin for one week. ERβ1-overexpressing single-cell clones were established (hereafter referred to as PC9/ERβ1 cells), and stable ERβ1 overexpression was confirmed by Western blot and qRT-PCR. PC9/ERβ1 cells were then infected with viruses carrying ERβ5 open reading frame (ORF), followed by selection with neomycin (600 mg/mL) for one week.
Immunocytochemistry and immunofluorescence
ERβ expression was assessed by immunofluorescence (IF) and immunocytochemistry (ICC). For IF, cells were fixed with 4% paraformaldehyde at room temperature for 20 minutes, followed by incubation with 0.5% Triton X-100 for 15 minutes. Non-specific binding was blocked with 5% bovine serum at 37°C for 30 minutes, before incubating with anti-ERβ (1:100; GeneTex, USA) and anti-ERβ1 (1:200; Santa Cruz, USA) primary antibodies. After incubation at 4°C overnight, cells were incubated with a secondary antibody conjugated with Alexa Fluor® 488 (1:500, Cell Signaling Technology, USA) for 1 hour at room temperature. Subsequently, cell nuclei were counterstained with 4',6-diamidino-2-phenylindole (DAPI), and samples were imaged using a confocal laser scanning microscope (Zeiss, Germany). For ICC, a two-step polymer-HRP detection method (Dako, Carpinteria, CA) was used.
Immunoblotting analysis
Cells were cultured in serum-free medium for 24 hours and then treated with gefitinib (40 nM) or/and estradiol (20 nM) for another 8 hours. Total protein was extracted from cells using cell lysis buffer (Beyotime, China) supplemented with a protease inhibitor cocktail (Roche, Germany); protein concentration was determined using the BCA protein assay (Beyotime, Beijing, China). The following primary antibodies (1:1000) were used: anti-EGFR, anti-phospho-EGFR (Tyr1068), anti-AKT, anti-phospho-AKT (Ser473), anti-RPS6, anti-phosphor-RPS6 (Ser235/236), anti-P21, anti-CyclinD3, anti-cleaved-PARP (cPARP), and anti-beta-actin (Cell Signaling Technology, USA). Membranes were then incubated with peroxidase-linked anti-mouse or anti-rabbit secondary antibodies (1:5000; Cell Signaling Technology, USA) for 2 hours at room temperature.
Cell viability and colony formation assays
Cells were treated with estradiol (20 nM) during the experiment. Cell viability was assessed using a cell counting kit-8 (CCK8; Dojindo, Japan). Briefly, cells were seeded (3×103 cells/ well) in sextuplicate in 96-well plates containing 100 μL medium and incubated for 24 hours. Subsequently, cells were treated with increasing concentrations of the indicated drugs for an additional 72 hours. After treatment, 10 μL of water-soluble tetrazolium salt (WST-8) was added to each well and incubated for 2 hours. Optical absorbance at 450 nm was measured using a microplate reader. Relative viability was calculated using the following formula: Relative viability (%/control) = [A450 (treated)- A450 (blank)]/[A450 (control) - A450 (blank)].
For colony formation assays, cells were seeded into 6 cm cell culture dishes (500 cells/dish) and treated for two weeks with 40 nM gefitinib or DMSO (1/1000 dilution). After washing twice with phosphate-buffered saline (PBS), cells were stained with crystal violet (Beyotime, China) for 20 min and washed with PBS.
Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL)
Cells were seeded on glass slides in 6-well plates 3×104 cells/well. After a 24 hour treatment with 40nM gefitinib or DMSO, cells were fixed with 4% paraformaldehyde and permeabilized with 0.1% Triton X-100 in 0.1% sodium citrate. Then, 50 μL of a freshly prepared TUNEL solution (Keygene, China) was added onto each slide. Subsequently, cell nuclei were counterstained with DAPI, and samples were imaged using a fluorescence microscope (Zeiss, Germany). The percentage of apoptotic cells normalized to the control group (set to 100%) was calculated after counting cells in five representative fields. The data were expressed as mean ± standard deviation (SD).
Patients
The data from 103 Chinese patients with advanced lung adenocarcinoma were retrospectively reviewed. The inclusion criteria used for patient enrollment were as follows: (1) Pathological diagnosis of adenocarcinoma; (2) sufficient tissue for both EGFR and KRAS mutation detection and ERβ1 immunohistochemistry; (3) presence of EGFR mutations associated with sensitivity to EGFR TKIs, including 19 exon deletion and 21 exon point mutation, and absence of EGFR T790M or KRAS mutations; (4) patients treated with EGFR TKIs, including erlotinib, gefitinib, and icotinib; (5) available clinicopathological characteristics, including sex, age, disease stage, and smoking history. Treatment responses were classified according to the response evaluation criteria in solid tumors (RECIST), version 1.1. Progression-free survival (PFS) time was defined as the time between the first day of EGFR TKI treatment until radiologic progression or death. The study was approved by the Ethics Review Committee of the Shandong Cancer Hospital.
EGFR and KRAS mutation detection and immunohistochemistry for ERβ1
Amplification refractory mutation system (ARMS) was employed to detect different genetic variants, including EGFR (exon 19 deletions, L858R, and T790M) and KRAS mutations.
ERβ1 expression in lung adenocarcinoma tissue samples was assessed by immunohistochemistry (IHC). Informed consent to use biopsy tissues was obtained from all patients. Briefly, formalin-fixed, paraffin-embedded tissue sections (3-μm) were deparaffinized and stained according to standard procedures. Sections were probed with anti-ERβ1 mouse antibody (1:200; Abcam, USA); a biotinylated anti-mouse IgG secondary antibody was used. Brown staining in cytoplasm or/and nucleus was considered positive. No staining was observed in negative controls, including lung tissues probed with a non-immune primary antibody. Based on the localization of “positive” immunoreactivity in the cytoplasm, nucleus, or both, patients were grouped as cERβ1-, n/cERβ1-, or nERβ1-positive. IHC staining was evaluated independently by two investigators (Lijuan Zhang and Meng Tian) and a pathologist (Jianbo Zhang).
Statistical analysis
Differences in the relative mRNA levels, cell viability, and apoptosis between different cell lines were analyzed using two-tailed Student’s t-tests. Patient survival was estimated using the Kaplan-Meier method, and comparisons between groups were conducted using log-rank tests. All statistical tests were two-tailed, and P-values < 0.05 were considered statistically significant. All statistical analyses were performed using GraphPad Prism 8.0. (Prism Software Inc., San Diego, USA).