Noncoding RNAs(ncRNAs) are consisted of microRNAs (miRNAs), long ncRNAs (lncRNAs), circular RNAs (circRNAs), and tsRNAs, which are small RNAs that are not capable of encoding proteins(9, 21, 22). Recently, with the application of high-throughput sequencing technology and biological information analyses in ncRNAs, researchers have revealed many new research theories, mainly including the theory that ncRNAs such as tsRNA (including tRFs and tiRNAs) are of great importance in the initiation and development of tumors and can be used as molecular markers for tumor diagnosis or molecular targets for treatment.
CircRNAs and lncRNAs can be considered molecular markers of tumor diagnosis or therapeutic targets. It has been determined by RNA-seq that 448 circRNAs are differentially expressed in colorectal cancer (CRC) and adjacent normal tissues (23). The research carried out the enrichment analyses of the target genes of the abnormal expressed circRNAs and the results demonstrated that these circRNAs are related to the carcinogenesis of CRC (23). miRanda and miRpath software combined with KEGG pathway analysis indicated that the target miRNAs of the first 10 abnormal expressed circRNAs were relevant to the KEGG pathway and miRNAs in CRC, suggesting that the interactions between circRNA and miRNA are of great importance for the progression of CRC (23); circDDX17 was the most significantly differentially expressed circRNA. The experiments proved that circDDX17 expression in CRC tissues was significantly downregulated and relevant to clinicopathological parameters detected by qRT-PCR (23). The research illustrated that circDDX17 inhibition can contribute to the invasion, proliferation, and migration of CRC cells and reduce apoptosis (23). It has been suggested that circDDX17 suppresses CRC and is likely to become a new diagnostic biomarker and molecular target of CRC (23). In addition, one study revealed the connection between lncRNAs and anoxic and non-anoxic tissues of CRC and detected lncRNAs and mRNAs that were differentially expressed via RNA-seq (24). Some new lncRNAs, such as CTB-22K21.2, LIc01119, RP11-126K1.2, RP3-438O4.4, RP11-798M19.6 and RP112B63, have not been previously reported to regulate hypoxia (24). KEGG and GO enrichment analysis clarified that the differential expression of mRNAs was mainly relevant to the regulation of basic metabolic processes and gene transcription processes and was involved in several classical pathways associated with cancer (24). This may be a potential diagnostic biomarker, which may help to explain the mechanism of CRC carcinogenesis (24).
Similarly, tsRNAs can act as molecular markers of disease diagnosis or molecular targets of treatments. It has been demonstrated by RNA-seq and qRT-PCR that the expression of three tsRNAs (rno-tRF5-Glu-29a ,rno-tRFi-Ser-25a, and rno-tRF5-Ala-16a) decreased after intracerebral hemorrhage (25) . The results of enrichment analyses about abnormal expressed tsRNAs illustrated that it might be participant in different pathways related to intracerebral hemorrhage (25). The experimental consequence proved that tsRNAs may become a new molecular target for intracerebral hemorrhage (25). It’s reported that the CD5+ diffuse large B-cell lymphoma (DLBCL) tissues were found to have three differentially expressed tRFs (AS-tDR-013492, AS-tDR-011395, and AS-tDR-008946), as detected by RNA-seq and qRT-PCR(26). GO and KEGG analysis of the target genes of AS-tDR-013492 and AS-tDR-008946 proved that the target genes NEDD4L and UBA52 and several correlated pathways (PI3K/AKT and MAPK/ERK) may participate in the formation of CD5 + R/RDLBCL (26). The preliminary research on tRFs may supply a critical means for exploring the pathogenesis and progress of CD5 + R/R (relapsed & regenerative) DLBCL (26). Some scholars identified 8 differentially expressed tRFs by RNA-seq and qRT-PCR in good model of brain aging and related diseases (27). Subsequently, the results of GO and KEGG analyses of pathways correlated with tRFs-miRNAs indicated that differentially expressed tRFs were mainly enriched in brain function-related pathways, including synapse formation and synaptic vesicle cycle pathways (27). Then, the authors predicted that tRFs acting in a miRNA-like manner are more likely to affect Parkinson's disease and Alzheimer's disease (27). These tRFs can become a new molecular marker of diagnosis and molecular target of treatment of brain aging-related diseases (27). Recently, some research certified that 69 tRFs were upregulated and 70 tRFs were downregulated, as detected by RNA-seq in undifferentiated and differentiated glomerular podocytes (28). GO analysis suggested that dysregulated tRFs take part in the biological processes of angiogenesis, DNA amplification, RNA polymerase II promoter transcription, cell adhesion, etc (28). KEGG analysis certified that these dysregulated tRFs were related to PI3K-Akt pathways, Rap1 pathways, MAPK pathways, Ras pathways, and Wnt pathways (28). The author supposed that abnormal expressed tRFs may have influenced on the differentiation of podocytes and the progression of chronic kidney disease (28). In addition, the research found 38 differentially expressed tRFs in moyamoya disease (a rare chronic cerebrovascular disease) and healthy controls detected by RNA-seq(16). After predicting target genes of differentially expressed tRFs, GO and KEGG enrichment analysis of target genes demonstrated that tRFs were enriched in multiple pathways, which were mainly involved in angiogenesis and metabolism and were the physiological and pathological basis of moyamoya disease (MMD) (16). This study provides new clues for the pathogenesis of MMD and illustrated that tRFs are likely to become a molecular target for future remedy of MMD (16). However, there is little information about differentially expressed tRFs in CCA. Therefore, in our study, we explored the differentially expressed tRFs in CCA by RNA-seq and further analyzed the potential function and biological role of tRFs by GO and KEGG enrichment analysis.
In our study, we identified a total of 535 differentially expressed tsRNAs detected by RNA-seq in CCA tissues and adjacent normal tissues. Compared with normal tissues, there were 241 upregulated tsRNAs and 294 downregulated tsRNAs in CCA tissues (P value< 0.05, |log2 (fold change)| >=1). Analogous to results of differentially expressed tRFs above, we speculated that differentially expressed tRFs may have an impact on the progression of CCA in our study. Subsequently, we carried out GO and KEGG enrichment analysis, and the results revealed that three tRFs (tRF-34-JJ6RRNLIK898HR, tRF-38-0668K87SERM492V, tRF-39-0668K87SERM492E2) were downregulated, and their target genes were enriched in GO and KEGG pathways (P<0.05, adjusted P<0.05).There are many similarities in the three differentially expressed tRFs screened. For instance, although the UniqueIDs are different in MINTbase, they share the same sequence (CAGGCGGCCCGGGTTCGACTCCCGGTGTGGGAAC), and similar regions of chromosomes 13 and 15 can be cut to generate these sequence fragments. These are interesting phenomena that we found in this research, but the specific mechanism remains to be further studied in the future. The target genes of dysregulated tRFs were mainly enriched in the Notch signaling pathway, Hippo signaling pathway, and cAMP signaling pathway and in growth hormone synthesis, secretion and action (Figure 4). It has been reported that when the cAMP signaling pathway was activated, it may suppress the migration of breast cancer cells (29). The Hippo signaling pathway are relevant to the procession of hepatocellular carcinoma(30), breast carcinoma (31), and gastric carcinoma (32), influencing the proliferation, differentiation, and migration of tumor cells. The Notch signaling pathway is significant to the development of diversified cancers and can regulate the growth, survival, apoptosis, invasion and migration of all kinds of tumor cells, such as pancreatic carcinoma and liver cancer cells (33-36). In addition, research has identified the relationship between tRFs and the Notch signaling pathway and shown that tRF/miR-1280 can bind with the 3'-UTR of JAG2 mRNA to decrease the synthesis of JAG2 (a ligand of Notch signaling pathway), thereby inactivating the Notch signaling pathway and reducing the proliferation and metastasis of CRC (37). tRF/miR-1280 can also depress the Notch signaling pathway, thus reducing the expression level of the CD133+ stem cell phenotype in CRC cells, decreasing tumor motility and migration ability and hindering the formation of a tumor metastasis-favorable microenvironment(37). Furthermore, the Notch signaling pathway is great of significance in the carcinogenesis of CCA. Some research claimed that the level of cyclin E protein is positive regulated by the Notch signaling pathway in CCA (38). Some scholars have indicated that when the Notch signaling pathway is activated, it can prompt hepatic progenitor cells and differentiate hepatocytes to turn into biliary lineage cells, thus promoting the carcinogenesis of CCA(39). The Notch signaling pathway may be a main driving factor of human CCA occurrence and a perspective molecular target of therapy(39). According to the study above, we assumed that the dysregulated tRFs in CCA may result in the progression of CCA by regulating the cancer-related enriched pathways. However, its effect on the biological behavior of tumor cells and its specific mechanism need to be further explored.
In summary, we used high-throughput RNA-seq to determine differentially expressed tsRNAs in CCA and adjacent normal tissue. Subsequent GO and KEGG analyses of dysregulated tsRNAs in the two groups indicated that the target genes of tsRNAs were enriched in multiple cancer-related pathways. Our study suggests that tsRNAs may make a difference in the origin of CCA, which may contribute us to discover the etiological mechanism about CCA, and that tsRNAs may become a new molecular marker of diagnosis and a molecular target of therapy in CCA.