5.1 Bacterial strains, plasmids, and growth conditions
The wild-type strain A. veronii TH0426 used in this study was initially isolated from a farmed Pelteobagrus fulvidraco in Zhejiang Province, China. The original strains and plasmids were stored by the Preventive Veterinary Research Laboratory of Jilin Agricultural University. The bacterial strains and plasmids used in this study are listed in Table 1. All the A. veronii strains were grown in Luria-Bertani (LB) medium and Rimler-Shotts (RS) selective medium at 30 °C. The host bacterium DH5α strains and engineered E. coli strain WM3064 used in this study were grown in LB broth or plated on LB agar plates. Three vectors, namely, pEASY-Blunt Zero (pEASY), the broad-host-range expression plasmid pBBR1-MCS, and the suicide plasmid pRE112, were utilized for gene expression. When required, appropriate antibiotics were added at the following final concentrations: ampicillin (Amp, 100 µg/ml) and chloramphenicol (Cm, 45 µg/ml).
Table 1
Bacterial strains and plasmids used in this study.
Strains or Plasmids
|
Description
|
Source or Reference
|
Strains
A. veronii TH0426
|
Wild-type strain, Ampr
|
This study
|
∆Fis
|
Isogenic Fis mutant of strain TH0426
|
This study
|
C-Fis
|
Mutant ∆Fis complemented with intact Fis gene
|
This study
|
E. coli Trans1-T1
|
F-ϕ80(lacZ)∆M15∆lacX74hsdR(rk−,mk+) ∆recA1398endA1tonA
|
TransGene Biotech
|
E. coli WM3064
|
thrB1004 pro thi rpsL hsdS lacZ∆M15RP4-1360(araBAD)567∆dapA1341: :[erm pir(wt)]
|
Stored in our lab
|
E. coli DH5α-λpir
|
λpir lysogen of DH5α
|
Stored in our lab
|
Plasmids
|
|
|
pEASY-Blunt Zero
|
TA cloning vector, Ampr
|
TransGene Biotech
|
pEASY-UD Fis
|
Carrying the flanking region of the ORF for Fis TA cloning, Ampr
|
This study
|
pRE112
|
pGP704 suicide plasmid, pir depengent, oriT, oriV, sacB, Cmr
|
Stored in our lab
|
pRE112-UD Fis
|
pRE112 carrying the flanking region of the Fis ORF, Cmr
|
This study
|
pBBR1-MCS
|
Broad-host range vector, Cmr
|
Stored in our lab
|
pBBR-Fis
|
pBBR carrying of 1681bp containing the promoter and Fis ORF, Cmr
|
This study
|
5.2 Experimental Fish
We purchased healthy zebrafish weighing 0.5 ± 0.03 g and crucian carp weighing 300 ± 0.5 g from a fish farm (Changchun, Jilin, China). The crucian carp and zebrafish were fed the basal diet twice a day in the amount of 2% of their body weight for 2 weeks. Crucian carp were acclimatized in flow-through aquariums at 26 ± 1.0 ℃ and zebrafish were maintained in Racirculating Aquaculture Systems at 28 ± 1.0 ℃, with natural photoperiod. During the whole experiment periods, the physicochemical parameters of the water were measured daily (5.6 ± 0.45 mg/L of dissolved oxygen, 0.12 ± 0.01 mg/L of ammonia, 0.015 ± 0.003 mg/L of nitrate and 7.8 ± 0.5 of pH). After the study, all remaining experimental animals were euthanized by bringing the concentration of cove oil in the water to 80 mg/L. This study was conducted following the Jilin Agriculture University Institutional Animal Care and Use Committee (JLAU08201409), and the experimental procedures were performed in compliance with the National Institutes of Health guide for the care and use of Laboratory animals (NIH Publications No. 8023).
5.3 Construction of the A. veronii deletion and complementation strains
To construct the Fis gene deletion strain, partial deletion of the Fis gene was conducted by homologous recombination. Briefly, the genome of the TH0426 strain was used as a template to amplify the flanking region of the Fis gene with the primers P1-1/P1-2 and P1-3/P1-4, and the upstream (named S1) and downstream (named S2) regions of the target gene Fis were amplified by Polymerase Chain Reaction (PCR). Using S1 and S2 as templates, the primer pair P1-1/P1-4 was utilized to amplify the fragment lacking the Fis gene mutation, named M Fis. The two purified flanking regions were then ligated by fusion PCR and inserted into a linear vector, pRE112, digested at the same restriction site, and the construct obtained was named pRE112-M Fis. The correctly sequenced recombinant suicide plasmid pRE112-M Fis was transformed into competent E. coli WM3064 cells and then conjugated into the wild‐type strain A. veronii. A plate containing Amp and Cm was used to screen the strains for the first conjugative transfer, and then, the second homologous recombination was induced on the plate containing Amp + 10% sucrose.
The Fis gene fragment carrying the promoter region (2,252 bp) was amplified and ligated into the broad-host-range expression plasmid pBBR1‐MCS of gram‐negative bacteria to construct the expression plasmid Fis. Finally, Reverse Time-Polymerase Chain Reaction (RT-PCR) was used to identify the mutant ∆Fis and the complementation strain C‐Fis. All primers utilized in this study were listed in Table 2.
Table 2
Primers used in study
Target genes
|
Primers
|
Sequence (5′~3′)
|
Fis upstream homology arm sequence
|
P1-1 (Xba I)
|
GCTCTAGACGATGCGCCGCTCGATC
|
|
P1-2
|
GACACTTGTGCGCGAGGGCGAATGCGA
|
Fis downstream homology arm sequence
|
P1-3
|
CGCCCTCGCGCACAAGTGTCAGAAACTGGAGGT
|
|
P1-4 (Kpn I)
|
GGGGTACCCCTTGTCAGGGCACTGGGCC
|
Fis ORF and its external sequence
|
P2-1
|
TTGTCGCTGGGCCCGCTTCA
|
|
P2-2
|
CTGGCCGATCAGCAGGATGA
|
Fis ORF internal sequence
|
P3-1
|
TCGCAACGGGATGAACAACA
|
|
P3-2
|
CGCAGGCGAGCTTCAATCA
|
Promoter sequence
|
P4-1 (BamH I)
|
CCGGATCCCTGTTTATGGGCGGC
|
|
P4-2
|
CTTGCTCCATGGGCGTGCTCT
|
Fis ORF sequence
|
P4-3
|
CGCCCATGGAGCAAG
|
|
P4-4 (Hind III)
|
CGAAGCTTTCAGTTCACCTCCAGTTTC
|
16S rRNA sequence (for real-time PCR)
|
P5-1
|
GCCACGTCTCAAGGACACAG
|
|
P5-2
|
TGGGGAGCAAACAGGATTAGA
|
Fis ORF sequence (for real-time PCR)
|
P6-1
|
CTCTACCACCGTCTC
|
|
P6-2
|
CAGTCCCTTGTCATC
|
pRE112 vector sequence
|
P7-1
|
GCGATGAGTGGCAGGGC
|
|
P7-2
|
TTACCGACTGCGGCCTGAGT
|
pBBR1-MCS vector sequence
|
P8-1
|
TAAGTTGGGTAACGCCAGG
|
|
P8-2
|
GAGTTAGCTCACTCATTAGGC
|
5.4 Comparison of colony morphology and determination of the growth curve
ΔFis, C-Fis, and A. veronii TH0426 were inoculated into LB at 1% of the culture volume and cultured at 30 °C for 12 h. The concentrations of the three strains were adjusted to the same value by colony counting. The final concentration was adjusted to 1 × 106 CFU/mL, and the morphology was observed by Gram staining. Then, the same amount of bacterial liquid was dropped onto a solid LB plate, and the colony morphology was observed after incubation for 35 h at 30 °C. The experiment was replicated three times.
ΔFis, C-Fis, and A. veronii TH0426 at the adjusted concentrations were inoculated into liquid LB medium at 1% of the culture volume and cultured at 30 °C and 170 rpm for 13 h. The OD600 was measured at intervals of 1 h and recorded. This experiment was replicated three times.
5.5 Determination of haemolytic activity
To evaluate whether the haemolysin activity of Fis was affected, we performed a haemolytic activity experiment. Briefly, according to a previously described method, the cell densities of ∆Fis, C-Fis, and TH0426 were adjusted to be equal. Equal volumes of the bacterial suspensions were inoculated onto a sheep blood agar plate, and the cells were cultured at 30 °C for 12 h. The experiment was repeated three times.
5.6 Motility detection
Previous research results from this research laboratory have shown that TH0426 has swimming ability. We evaluated the swimming motility of the bacteria by measuring the colony diameter of bacteria growing on a plate containing 0.5% agar and 5% glucose. The swimming ability of ∆Fis, C-Fis, and TH0426 was tested.
5.7 Biofilm assay
The biofilm detection procedure was based on the method of Müsken M et al. [39]with appropriate modifications. The concentrations of ∆Fis, C-Fis, and TH0426 were adjusted to 1 × 106 CFU/mL, and 180 μL of LB broth and 20 μL of bacterial solution were added to a 96-well plate; sterile Phosphate Buffered Saline (PBS) was added to the control wells. Ten repeat wells were set up for each strain. The 96-well plate was sealed with parafilm and incubated at 28 °C for 24 h. After the incubation was complete, the liquid in each well was aspirated, and the well was washed twice with sterile PBS. Then, 200 μL of 99% methanol was added, and the cells were fixed for 20 min. The methanol was then aspirated, and 200 μL of 0.1% crystal violet staining solution was added to each well. The solution was then aspirated, and the wells were washed three times with sterile PBS. Then, 200 μL of 33% acetic acid was added to each well, and the plate was incubated for 5 min. Finally, the biofilm formation ability of each strain was determined by OD575 analysis, which was repeated three times[40].
5.8 Cytotoxicity analysis
A cytotoxic kit was used to detect the toxicity of the deletion strain ∆Fis and the wild-type strain TH0426 to EPC cells according to the manufacturer’s instructions.
5.9 Bacterial adhesion to and invasion of EPC cells
The adhesion and invasion abilities of ∆Fis, C-Fis, and TH0426 to EPC cells were tested[41]. EPC cells were cultured in Medium 199 (M199) medium containing 10% foetal bovine serum and 1% dual antibodies (penicillin and streptomycin) at 25 °C in a 5% CO2 incubator. In brief, EPC cells were subcultured and counted, and the cell density was adjusted. And the cells were then seeded on a 24-well cell culture plate. The medium was aspirated and discarded after culturing to a monolayer, and the cells were washed twice with M199 (without antibiotics and serum). Then, M199 was used to dilute the bacterial solution at a ratio of 10:1 (bacteria: cells), and the cells were incubated for 1 h at 25 °C. Finally, the cells were washed three times with M199, and 1 mL of 1% Triton X-100 was added to each well and mixed well. After gradient dilution, the colonies were counted, and the adsorption rate was calculated[42].
5.10 Challenge
To assess the pathogenicity of the three strains, LD50 values were determined for all strains[43]. First, the deletion strain ∆Fis, the complementation strain C-Fis and the wild-type strain TH0426 were inoculated in LB culture medium and cultured for 12 h. The bacterial colonies were counted, the concentration was calculated, and the bacterial solution was diluted 10-fold with sterile PBS. A total of 180 zebrafish were randomly divided into 3 groups with 6 gradients in each group. The bacterial solution from the previous step was used to inject the zebrafish intraperitoneally according to the corresponding gradient. The control group was injected with sterile PBS[44, 45]. After observation for one week, the number of deaths from the challenge was counted, and the LD50 of each strain towards zebrafish was calculated by the Kou method.
5.11 Expression of virulence genes
To analyse the cause of the change in virulence of the ∆Fis deletion strain, in this experiment, we screened 4 virulence genes for real-time quantitative PCR and detected the expression of these genes in ∆Fis and C-Fis[46].
5.12 Bacterial load test
Thirty healthy crucian carp were randomly divided into three groups, and the concentration of the bacterial solution was adjusted to 1 × 108 CFU/mL according to the above method. Crucian carp were intraperitoneally injected and inoculated, and the control group was injected with PBS. Three live fish were dissected in each group after 24 h and 72 h, and the blood, liver, kidney and spleen of each fish were ground. Then, the grinding droplet plate was placed on an RS solid plate, and incubated at 28 °C for 12 h, followed by colony counting. The whole process was conducted under sterile conditions.
5.13 Statistical analysis
Statistical analysis was performed with SPSS 16.0 software and GraphPad Prism version 8.0. For all tests, statistical significance was defined as P < 0.05. The results are expressed as the mean ± SD of at least three independent tests.