Plant materials
Cassava cuttings of the three CMD2 resistant cultivars (Agric-rouge, Atinwewe, and Agblehoundo) were collected from University of Abomey-Calavi in Central Laboratory of Biotechnology and Plant breeding Gemoplasm in Benin and transported to Coffee Research Institute (CRI) in Ruiru-Kenya where the tissue culture studies were carried out. The cuttings were certified by ‘Plant Protection Organization of Benin’ on N° 0054994/19/SPVCP/PCP/AE-B (S2 File) before sent to the Coffee Research Institute (CRI) in Kenya. The 20-cm-long cuttings were planted as four to five stems in 10-L boat filled with sterile soil/manure mixture (1:1 v/v) (S3 File). The boat were irrigated to field capacity once per day until sprouting, and twice per week thereafter; cuttings were grown in a greenhouse maintained at 28 °C, with relative humidity > 60%, and natural lighting with an approximate light/dark cycle of 12/12 h at Coffee Research Institute (CRI) in Kenya.
Explants Sterilization
Nodal explants from four weeks old stem cuttings were harvested and transported from the greenhouse to the laboratory in a beaker containing tap water. Once in the laboratory, they were cleaned with cotton wool contained liquid soap to remove any surface debris and rinsed with tap water. They were then sterilized under the lamina flow hood using 10, 15, 20, and 25% v/v commercial bleach Jik (3.85% NaOCl) for 10, 15, 20 and 25 minutes. After exposure to the sterilant, the explants were rinsed two times in sterile distilled water and thereafter quickly (30 secs) immersed in 70% (v/v) ethanol and finally rinsing four times in sterile distilled water. The nodal explants were trimmed and cultured individually in test tubes (15 cm by 3 cm) containing hormone free MS media. They were then incubated in a growth room maintained at a temperature regime of 25 ± 2 ˚C provided by with cool white fluorescent light intensity of 33 µmol. m− 2.s− 1 and 16 h photoperiod. Data on the percent clean explants were collected after 4, 8, and 12 days. This was calculated as total number of contaminated explants / total number of explants x 100.
Microshoot Induction And Culture Conditions
Nodal explants were cultured on MS medium [19] basal salts supplemented with 3% (w/v) sucrose, 100 mg/l myo-inositol, BAP, kinetin evaluated at 5 µM, 10 µM, and 20 µM and TDZ at 0.1 µM, 0.5 µM, 1 µM, and 1.5 µM in separate experiments. The control was devoid of hormones. Rooting of the microshoots was evaluated using half-strength MS media supplemented with 2% (w/v) sucrose,100 mg/l myo-inositol, NAA and IBA evaluated at 1, 5,10 and 20 µM in separate experiments. The control was devoid of hormone. The pH of the media was adjusted to 5.8 using 0.1 M HCl or 0.1 M NaOH, and the media was gelled with 0.3% phytagel. The media was dispensed in 20 mL aliquots into culture vessels and then autoclaved at 1.06 kg·cm-2 and 121 °C for 15 min.
Plantlets Establishment In Greenhouse
The regenerated plantlets with well-developed roots were carefully removed from the culture tubes washed with tap water to remove agar (Fig. 5). They were then dipped in 2% fungicide (green copper) for one hour. They were then placed in plastic pots filled with substrate composed of soil: sand: manure in the ratio of 3:2:1 (Fig. 6). The containers were covered to maintain high relative humidity. The humidity was reduced gradually by opening the top of the pots after two weeks (Fig. 7) (S4 File).
Assessment of the presence CMD2 gene in plantlets.
The molecular analysis work was done in the Molecular Biology and Biotechnology laboratories of CRI and Pan African University of Basic Sciences, Technology and Innovation (PAUSTI), Kenya.
DNA Extraction And Quantification
Young leaves were picked from cassava plants in greenhouse, both mother plants and acclimatized plantlets, and DNA was extracted from the plantlets and the mother plants according to the method described by Diniz et al. [51]. DNA quality and quantity were determined with Genova Spectrophotometer (Model 7415 Nano, Vacutec, South Africa) and quality was also assessed on 1% (w/v) agarose gel. The extracted DNA samples were stored at -20 oC for SSR and SCAR analysis.
Polymerase Chain Reaction (PCR) for scoring CMD2 resistant gene.
During the current study, PCR-based SSR and SCAR markers as described by Houngue et al. [8] were used to assess the presence of CMD2 gene in the regenerated plantlets. The mother plants were used as the control. The characteristics of the primers used are shown in Table 1. The SSR and SCAR analysis were performed as described by Omingo et al. [52]. DNA samples were diluted to10 ng/µl for SSR and SCAR analysis. A total of 100 ng of each DNA sample was used in PCR reactions. A reaction mix was prepared to include: 2.5 µl of buffer (10 x), 2.5 µl of MgCl2 (25 mM), 3.5 µl of dNTPs (500 µM), 1 µl of SSR (10 µM) reverse primer and 1 µl of forward primer, 0.2 µl of Taq polymerase 5u / µl. The 25 µl PCR volume was incubated in a thermocycler (Model FFG02HSD, made in UK) set for the following amplification conditions: One cycle at 95 °C for 5 min, 35 cycles of denaturation at 94 °C for 1 min, annealing at 55 °C for one and half minutes, extension at 72 °C for 10 min and was held 4 ºC. The amplified products were electrophoresed in 2.3% agarose gel and then visualized in a UV trans-illuminator (Model M-26, Upland, CA 91786 U.S.A) after staining in ethidium bromide solution.
Table 6
Specific SSR and SCAR primers used for detection of CMD2 resistant gene in cassava mother plants and regenerated plantlets
Primer code | Marker system | Forward primer sequence | Reverse primer sequence | Expected sequence length (bp) | Annealing Temperature (˚C) |
NS169 | SSR | GTGCGAAATGGAAATCAATG | GCCTTCTCAGCATATGGAGC | 319 | 55 |
RME1 | SCAR | AGAAGAGGGTAGGAGTTATGT | ATGTTAATGTAATGAAAGAGC | 700 | 55 |
Scoring And Analysis Of Bands
Amplified DNA fragments were run on agarose gel to score for the presence (1) or absence (0) of bands (Resistance gene) in the regenerated plantlets compared with mother plants. All reactions were repeated at least twice, and only distinct, reproducible, polymorphic and well-resolved bands across all runs were considered for analysis.
Experimental Design And Data Analysis
All experiments on both shoot and root induction were laid out in completely randomized design (CRD) with 10 replicates per treatment and the experiment repeated three times. The data was subjected to one-way analysis of variance and the significant differences between treatments means were assed using MINITAB version 19 software and Tukey analysis at 5% level were performed to assess difference between means.