Animals
Altogether 7 dead crossbred piglets (male-5, female-2) of weaning age (18–30 day) group, originated from Swine Production Farm, ICAR-IVRI (UP, India) with a history of no observable clinical signs, were received for disease diagnosis. During the necropsy procedure, anatomic abnormalities in different vital organs, namely the heart, lungs, liver, kidney, intestine; and lymphatic organs, namely lymph nodes, spleen, and palatine tonsils were recorded. The representative tissues were collected in 10% neutral buffered formalin (10% NBF) for histopathological and immuno-histopathological investigations. In addition, heart blood, pericardial fluid, and lesional sites from the heart and spleen were collected ascetically in sterile cryo-vials at 40C and − 200C, respectively, for other ancillary tests.
Histopathological investigation
The NBF fixed tissues were paraffin-wax embedded, micro-sectioned (4–5 µm thick), deparaffinized, and stained with Haematoxylin and Eosin (HE). The HE sections were observed under the wide field light microscope (Olympus BX41, USA) and tissue abnormalities were recorded and photographed for descriptive histopathology. The lesion scoring was assigned on the scale of 0–3 (0 = no change, + = mild change, ++ = moderate change, +++ =severe change). The maximum score was taken as the most severe inflammatory/pathological changes.
Immunohistochemistry investigation
The duplicate sections of heart, lungs, and lymph nodes taken on poly-L-lysin coated glass slides were used for the in-situ demonstration of M. hyopneumoniae antigen using rabbit polyclonal antibody (Orb-243571, Biorbyt, USA) at a dilution of 1:200, followed by incubation with prediluted ImmPRESS® HRP secondary antibody (MP-7500, Vector laboratories, USA) for 30 min incubation. Negative controls were run parallel for each block tested with substitution of similar dilutions of PBS with 1% BSA and rabbit isotype control (ThermoFisher Scientific, USA) to rule out the false positive staining.
Microbiological investigation
The aseptically collected samples of blood, pericardial fluid, heart, and spleen were processed for the bacterial isolation by plating on 5% sheep blood agar (SBA), chocolate agar, and MacConkey agar (MLA) Petri plates. One set of plates was incubated aerobically at 37°C, and other set with 5–10% CO2 tension for the isolation of bacteria.
Molecular detection of microbial agents
The DNA was extracted from the tissue samples using commercial DNeasy Blood and Tissue Mini Kits (Qiagen, USA) and screened against Mycoplasma spp. including at species level (M. hyopneumoniae (Mhp), M. hyorhinis, and M. hyosynoviae), HPS, PM, APP, SS, B. bronchiseptica, Chlamydia and viruses i.e. Porcine Circovirus 2 (PCV2), PRRSV, Swine Influenza virus (SIV), and Encephalomyocarditis virus (ECMV) for their probable association with mortality using gene specific primers as presented in the Table 1. The amplified PCR products (n = 2) were commercially sequenced, and phylogenetic tree was constructed by ‘MEGA 10’ programme using Maximum Likelihood method based on the General time reversible (GTR) model with a total of 1000 replicates.
Table I. List of PCR primers used for the detection of pathogens associated with fibrinous pericarditis in piglets
Pathogen | Gene | Primer sequence (5’–3’) | product size (bp) | Reference |
Actinobacillus pleuropneumoniae | dsbE | F: GATAAACCTTTTCCGGAATT R: TACCACACCGTGTTTATCAA | 342 | Chiers et al. 2001 |
Mycoplasma sp. | 16s r-RNA | F:GGCGAATGGGTGAGTAACACG R:CGGATAACGCTTGCGACCTATG | 460 | Wong-Lee and Lovett 1993 |
M. hyorhinis | 16s r-RNA | F:AACGGGATGTAGCAATACATTC R:AGCGGACTGAAGTTGAGCTTCAG | 604 | Morales al. 2006 |
M. hyopneumoniae | P36 | F:CCGATTAGTGTCTCCCGTTATG R:GGGCCGATGAAACCTATTAAAATAGCT | 853 | Caron et al. 2000 |
M. hyosynoviae | 16s r-RNA | F:CAGGGCTCAACCCTGGCTCGC R:GACGTCAAATCATCATGCCTCT | 585 | Morales et al., 2020 |
P. multocida | KMT17 and KMT1SP6 | F: TATTTA GGTGACACTATAG R: TAATACGACTCACTAT AGGG | 460 | Townsend et al. 1998 |
S. suis | gdh | F: GCAGCGTATTCTGTCAAACG R: CCATGGACAGATAAAGATGG | 688 | Okwumabua et al. 2003 |
Bordetella bronchiseptica | fla | F :CCCCCGCACATTTCCGAACTTC R: AGGCTCCCAAGAGAGAAAGGCTT | 164 | Hozbor et al. 1999 |
Haemophilus parasuis | 16s r-RNA | F: GTGATGAGGAAGGGTGGTGT R: GGCTTCGTCACCCTCTGT | 821 | Oliveira et al. 2001 |
Chlamydia | Omp2 | F: CAAACTCATCAGACGAG R: CCT TCT TTA AGA GGT TTT ACC | 590 | Hoelzel et al. 2000 |
(Porcine circovirus 2) PCV2 | ORF2 | F: CGGATATTGTAGTCCTGGTCG R: ACTGTCAAGGCTACCACAGTCA | 481 | Ellis et al. 1999 |
Porcine reproductive and respiratory syndrome Virus (PRRSV) | Orf 5 | F: TGACACCTGAGACCATGAGG R: GTGCAGAAGCCCTAGCAGTC | 803 | Rajkhowa et al. 2016 |
Swine Influenza Virus (SIV) | Matrix (M) Protein | F: CTTCTAACCGAGGTCGAAACG R: AGGGCATTTTGGACAAAG/TCGT CTA | 244 | Schmidt et al. 2016 |
Encephalomyocarditis virus (ECMV) | 3D glycoprotein | F : CCTCTTAATTCGACGCTTGAA R: GGCAAGCATAGTGATCGAAG | 165 | Perez et al. 2006 |