CX3CR1 regulates hepatocellular carcinoma(HCC) metastasis via PI3K/AKT pathway

doi:10.21203/rs.2.12811/v1

Download PDF

Research article

CX3CR1 regulates hepatocellular carcinoma(HCC) metastasis via PI3K/AKT pathway

https://doi.org/10.21203/rs.2.12811/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Fractalkine receptor CX3CR1 is differentially expressed in hepatocellular carcinoma and its function is unknown. As a special case of chemokine family, CX3CR1 only binds to its unique ligand CX3CL1, and CX3CL1 also only binds to its only receptor CX3CR1, the unique matching between ligands and receptors is not found in other chemokines, and this specificity is essential for diagnosis, prognosis and clinical target therapy.

Methods

CX3CR1 expression was analyzed by immunohistochemistry, migration and invasion abilities of SMMC-7721 cells were detected by wound-healing and transwell after overexpressing CX3CR1. In addition to overexpression experiments, interfering RNA siCX3CR1 was used for reverse validation in HepG2 cells. To further clarify the mechanism of CX3CR1 regulating HCC metastasis, the classical PI3K/AKT pathway were detected by Western blot.

Results

The CX3CR1 levels were positive correlated with pathological TNM stage, meanwhile a negative correlation between high expression of CX3CR1 and survival rate was found among patients at stageII-III. In our study, overexpression of CX3CR1 promoted migration and invasion ability of SMMC-7721 cells, whereas knockout of CX3CR1 inhibited these abilities of HepG2 cells. Mechanistically, CX3CR1 regulates the metastasis of HCC cells via PI3K/AKT pathway, and the PI3K inhibitor LY294002 could stop the promoting effect of CX3CR1 on SMMC-7721 cells.

Conclusion

CX3CR1 regulated HCC cell metastasis via PI3K/AKT signaling and this effect might be a new target for clinical diagnosis and treatment.

Cancer Biology

Carcinoma

Hepatocellular

CX3CR1

Metastasis

AKT

Hepatocellular carcinoma (HCC) is one of the most common malignant tumors in the world [1]. Although there are many methods to treat hepatocellular carcinoma, such as surgery, radiotherapy and chemotherapy [2-4], but many patients have lost the opportunity of surgical treatment because the early symptoms of primary hepatocellular carcinoma are not obvious [5]. The use of radiotherapy and chemotherapy is also limited because of its toxic and side effects. Therefore, it is particularly important to explore the mechanism of the occurrence and development of hepatocellular carcinoma and find new treatment methods.

Chemokines are 8-10KD proteins which can regulate leukocyte migration to infected sites by binding to their specific chemokine-receptors [6]. Chemokine receptor 1 (CX₃-C motif chemokine receptor 1, CX₃CR1) is the only known member of CX₃C family. It is mainly expressed on the surface of T cells, natural killer cells, monocytes and vascular endothelial cells [7-10]. More and more studies have shown that chemokines and their receptors play an important role in the growth, invasion and metastasis of tumors. It has been confirmed that CX₃CR1 is involved in regulating the occurrence and development of breast cancer [11], prostate cancer [12], pancreatic cancer [13], ovarian carcinoma [14] and other tumors[15], but there are few reports about its role and mechanism in hepatocellular carcinoma.

In this study, the effects of overexpression of CX₃CR1 on the migration and invasion of human hepatocellular carcinoma cells were explored in two aspects: overexpress CX₃CR1 in low-expression cell lines and inhibit CX₃CR1 in high-expression cell lines. The molecular mechanism of CX₃CR1 was preliminarily explored to provide a new basis for the treatment and prognosis of hepatocellular carcinoma.

Specimens and patients data

All 385 HCC patients data were used to analyze. The 20 HCC specimens were collected from the Pathology Archive of the First Affiliated Hospital of Chongqing Medical University (Chongqing, China) between 2018-2019. This study was approved by the Medical Research Ethics Committee of Chongqing Medical University, and informed consent was obtained from all patients. The 365 mRNA expression profile was dowmloaded from The Human Protein Atlas, which patients data were collected from The Cancer Genome Atlas (TCGA) database.

Cell culture

Human normal hepatocyte LO2 cell line, human hepatocellular carcinoma SMMC-7721 and HepG2 cell line were cultured in DMEM medium (HyClone, California, USA) containing 10% FBS, 10U/ml penicillin-streptomycin (complete medium) at 37°C and 5% CO₂ incubator. When density of LO2, SMMC-7721 and HepG2 were reached 70%-80%, these cells were tripsinized by 0.5% trypsinase and carried out to new dishes.

Plasmid transfection

The SMMC-7721 cells in logarithmic growth phase were inoculated into 96-well plate, 24-well plate, 6-well plate and culture dish respectively. When the cell density reached 60%, the complete DMEM medium was replaced with medium without FBS nor penicillin-streptomycin. The mixture of 1μg/ml CX₃CR1 over-expression plasmid, 1μl/ml Lipo2000 (Cat.No.11668019, Invitrogen, California, USA), 100ug/ml medium without FBS was incubated at room temperature for 30 minutes, then the mixture was added into the culture medium evenly. The medium without FBS was changed to complete medium after 4-6 hours. At the same time, the same amount of empty vector plasmid was added in the negative control group (NC group) to exclude the influence of the plasmid itself on the experiment. The overexpression and empty plasmids were purchased from Genechem Co.,Ltd. (shanghai, China). 10nmol/ml LY294002 (Cat.No.HY-10108, MCE, China) was added in the SMMC-7721 cells after transfecting CX3CR1 over-expression plasmid.

Interfering RNA transfection

HepG2 cells in logarithmic growth phase were inoculated into 96-well plate, 24-well plate, 6-well plate and culture dish respectively. When the cell density reached 50%, the mixture of 60μl/ml Buffer, 2.5μl/ml CX₃CR1 interfering RNA and 6μl/ml transfection reagent was evenly divided into the medium. At the same time, the same amount of negative control interfering RNA was added to establish negative control group (NC group). The CX₃CR1 and negative control interfering RNA were purchased from RIBOBIO Co.,Ltd. (Guangzhou, China).

Quantitative real-time polymerase chain reaction (qPCR)

Quantitative real-time PCR was performed in a CFX-connect fast real-time PCR system (Bio-RAD, California, USA). The sample mixture was composed of 5μl SYBR (TaKaRa, Japan) 0.8μl primers 1μl cDNA and 3.2μl ddH₂O. The following touch-down cycling conditions: 1) 95°C for 10min. 2) 95°C for 20s. 3) 56°C for 10s. 4) temperature was reduced 3°C/cycle and the step2-3 were repeated. 5) 95°C for 20. 6) 55°C for 20s.

The primer sequence is as follows, CX₃CR1: Forward 5’CAACAGCAAGAAG CCCAAGAG3’ Reverse 5’TGAAGAAGAAGGCGGTAGTGAA3’;β-actin: Forward 5’CCACGAAACTACCTTCAACTCC3’ Reverse 5’GTAGTCTCCTTCTG CATCCTGT3’ (TaKaRa, Japan).

Western blot

1) Extraction of total cell protein: Collecting cell precipitation and add protein lysate (Roche, Switzerland), after mixing the cell suspension, the supernatant was collected by centrifuging 13000rpm for 15min at 4°C and adding 5 x Buffer to the supernatant (Beyotime, Shanghai, China). In the end, heating proteins to denaturation. 2) SDS-PAGE electrophoresis: 10% separating gum and 5% concentrating gum were prepared in turn, Adding samples containg 20ug protein in each hole, after SDS-PAGE electrophoresis, the membrane were blocked in 5% BSA at 37°C for 2h. After incubating with primary antibodies (CX₃CR1 1:1000, sc-30030, SantaCruz; p-AKT 1:1000, #4060, Cell Signaling Technology; AKT 1:1000, #4685, Cell Signaling Technology; MMP-3 1:1000, YT4465, Immunoway; MMP-9 1:1000, WL01580, Wanleibio ) overnight at 4°C, the membranes were washed by 0.1% TBST for 3 times, 5 minutes at a time. Then the membranes were detected by chemiluminescence after incubating with HRP-anti-mouse/rabbit IgG (1:3000, ZSGB-BIO, Beijing, China) at 37°C for 1h.

Wound-healing test

When the density of cells were reached to 80% in the 6-well plate after transfecting with plasmids or siRNA, the cells were scratched with a small pipette tip, and washed with PBS for 3 times, then replaced with the medium containing 2% serum. The cells were observed and photographed under the microscope at 0 hours, 24 hours and 48 hours. Then, the wound-healing width was recorded at the same observation point. The average wound-healing widthh of multiple observation points was calculated, and the scratch healing rate of each group was obtained.

Transwell

400μL culture medium with 2% serum containing 40000 SMMC-7721 cells or 60000 HepG2 cells was added into the upper chamber (matrix glue was used in invasion experiment, matrix glue and culture medium were 1:5 ratio, 50μL, Cat.No.356234, Corning, USA) and 700μL complete culture medium containing 10% serum was added into the lower chamber. Four parallel controls were set up in each group. After 24 hours, the cells on the lower side of chamber membrane were fixed for 20 minutes with 500μL 4% polyformaldehyde. The cells were stained with 500μL crystal violet for 30 minutes. After washing and drying, the cells were counted under a microscope. At least 10 visual fields were observed in each chamber, and the average values were obtained after counting.

Statistical analysis

SPSS 16.0 statistical software was used to analyze the experimental results. Each experiment was repeated three times. The differences between protein and mRNA expression were compared by t-test or Bonferroni-corrected t-test. The Log-rank(Mantel-Cox) test or Gehan-Breslow-Wilcoxon test was used to analyze difference between survival curves. The difference was statistically significant with *P < 0.05 **P<0.005 ***P<0.001.

CX₃CR1 expression in HCC tissues is related to clinical stages and is a marker of poor prognosis

In order to clarify the relationship between CX₃CR1 and the progression of HCC, we detected the expression level of CX₃CR1 in 20 cases of hepatocellular carcinoma by immunohistochemistry between high-differentiation and low-differention groups, finding that the expression of CX₃CR1 was uniform and higher in the low-differentiated group, but it was not uniform in the high-differentiated group, which had low-expression and high-expression regions. (Fig. 1a). Then we analyzed the mRNA expression data of CX₃CR1 in 365 HCC tissues which were dowmloaded from The Human Protein Atlas. These results showed that the expression level of CX₃CR1 was higher at stageⅢ than that at stageⅠ-Ⅱ (Fig. 1b). The correlation between CX₃CR1 expression and prognosis of HCC patients at stageⅡ-Ⅲ was verified by Kaplan-Meier survival analysis, finding the patients with high expression of CX₃CR1 had lower short-term survival rate (Gehan-Breslow-Wilcoxon test) in total-population (Fig. 1c) and male-popuation (Fig. 1d), the long-term survival rate (Log-rank(Mantel-Cox) test) was also lower in male-population but no difference in total-population. On the contrary, both short-term survival rate and long-term survival rate was no diffrence in female-population (Fig. 1e). In conclusion, there was a negative correlation between high expression of CX₃CR₁ and survival rate was found among patients at stageⅡ-Ⅳ.

CX₃CR1 is expressed at low levels in SMMC-7721 cells and at high levels in HepG2 cells

Western blot analyses were used to detect the mRNA expression and protein expression levels of CX₃CR1 in different HCC cells compared with human normal hepatocytes LO2, finding that CX₃CR1 expression levels were higher in HepG2 and lower in SMMC-7721 cells (Fig. 2a). Therefore, we choose HepG2 cell lines to verify interference experiments, and SMMC-7721 cells lines to verify overexpression experiments. we downregulated CX₃CR1 in HepG2 cells using siRNA and upregulated CX₃CR1 in SMMC-7721 cells by transfecting CX₃CR1-plasmid, the Q-PCR (Fig. 2b c and d) and western blot analyses showed these treatment were effective (Fig. 2e and f).

CX₃CR1 regulates the migration and invasion ability of HCC cells

To explore the role of CX₃CR1 in metastasis, Wound-healing test showed that the migration ability was promoted in SMMC-7721 cells after overexpressing CX₃CR1 (Fig. 4a), and migraion ability of HepG2 was inhibited by knockout of CX₃CR1 (Fig. 4b). Tanswell assays revealed that CX₃CR1 overepression promoted the migraion and invasion of SMMC-7721 cells (Fig. 3a and b), whereas knocked of CX₃CR1 inhibited the migraion and invasion of HepG2 cells as compared with control cells (Fig. 3c and d). Consistent with these results, the protein levels of matrix metalloproteinase [16-17] MMP-3 and MMP-9 were up-regulated in SMMC-7721 cells by overexpressing CX₃CR1 (Fig. 4c), and the level of MMP-3 and MMP-9 were down-regulated in HepG2 by knocking out CX₃CR1 (Fig. 4d). These findings demonstrated that CX₃CR1 regulated the migration and invasion of HCC cells.

CX₃CR1 regulates the migration and invasion of HCC cells via PI3K/AKT pathway

PI3K/AKT pathway has been proved to play an important role in the process of chemokin-axis regulating tumor [18-20]. Western blot test was ued to verify whether PI3K/AKT signaling pathway was involved in regulating metastasis of hepatocellular carcinoma. The results revealed the phosphorylation of AKT(p-AKT) was up-regulated in SMMC-7721 cells by transfecting CX₃CR1-plasmid compared with control group (Fig. 5a) , on the contrary, the phosphorylation-AKT level was down-regulated in the HepG2 cells after koncking out CX₃CR1 (Fig. 5b). To investigate whether CX₃CR1 was mediated through the PI3K/AKT pathway, we added the PI3K/AKT pathway inhibitor LY294002. Wound-healing test showed that LY294002 inhibitedd the migration ability of SMMC-7721 cells after ovexpressing CX₃CR1 (Fig. 5c and d), and the migration and invasion-related protein MMP-9 also reduced by using LY294002 compared with over-expression CX₃CR1 groups (Fig. 5e f and g), these results showed that CX₃CR1 regulated the metastasis of HCC cells via PI3K/AKT pathway.

Hepatocellular carcinoma (HCC) is one of the most common malignant tumors in the world. The death toll of HCC patients is as high as 745,000 [21]. The occurrence and development of HCC is a complex process involving multiple factors. Because of its initial symptoms, most patients have lost the best opportunity for surgical treatment [22]. With the continuous exploration and research, the chemokine axis is becoming increasingly important. More and more attention has been paid to the role of CXCR4 [23-24], CCL20 [25], CCL2-CCR2 [26], CCR4 [27] and other chemokine axes in the occurrence and development of hepatocellular carcinoma [28-30]. As a chemokine receptor, CX₃CR1 has also been proved to be involved in regulating the biological effects of various tumors. In addition , tumor microenvironment, which consists of stromal cells, vascular endothelial cells, immune cells and extracellular matrix, is also an indispensable part of the process of tumorigenesis and development [31-34]. Chemokines and their receptors have been proved to play a very important role in tumor microenvironment. Studies have confirmed that chemokine axis CXCL9/10-CXCR3, CXCL12-CXCR4, CCL20-CCR6, CCL5-CCR5, CXCL5-CXCR2 and so on can regulate the functions of various immune cells in tumor microenvironment to further promote immune escape of tumor cells and angiogenesis of tumors to help metastasis and progress of tumors [35-39]. CX₃CR1 has also been shown to play an important role in regulating tumor and tumor microenvironment [40]. Although there are many studies on CX₃CR1 in tumors, the relationship between CX₃CR1 and hepatocellular carcinoma is still unclear.

In this study, we found that CX₃CR1 was differentially expressed in different stages of HCC and there was a significant negative correlation between higher-level CX₃CR1 and prognosis in male-population. At the same time, CX₃CR1 also showed differential expression in different hepatocellular carcinoma cell lines. In order to explore the direct relationship between CX₃CR1 and biological characteristics of hepatocellular carcinoma cells, the CX₃CR1 overexpression plasmid was transfected with SMMC-7721 cells, which expressed the CX₃CR1 at low-level, on the contrary, the CX₃CR1 interference RNA was transfected with HepG2 cells, which expressed the CX₃CR1 at high-level. The migration and invasion ability of SMMC-7721 cells overexpressing CX₃CR1 was significantly enhanced. At the same time, the levels of MMP-3 MMP-9 and p-AKT were significantly increased, and the migration and invasion ability of HepG2 cells inhibiting CX₃CR1 was significantly weakened. At the same time, the levels of MMP-3 MMP-9 and p-AKT were significantly decreased. In conclusion, while overexpression of CX₃CR1 in SMMC-7721 cells can promote its migration and invasion ability, interferencing with CX₃CR1 can significantly inhibit the migration and invasion of HepG2 cells. Its mechanism may be related to activation of PI3K/AKT signaling pathways. Thus, CX₃CR1 may become a potential new target for the treatment of hepatocellular carcinoma.

Our study reveal for the first time the relationship between CX₃CR1 and HCC metastasis. Here, we find that CX₃CR1 is significantly correlate with the survival of patients with hepatocellular carcinoma, and this phenomenon is more evident in male patients. CX₃CR1 regulates migration and invasion ability of SMMC-7721 and HepG2 cells via PI3K/AKT pathway, and the PI3K inhibitor LY294002 reverse the promoting effect of CX₃CR1 on SMMC-7721 cells. Thereby CX₃CR1 regulates HCC cell metastasis via PI3K/AKT signaling and this effect might be a new target for clinical diagnosis and treatment.

AKT

BSA

ddH₂O

FBS

Min

mRNA

PBS

PI3K

P/S

PVDF

PCR

SDS

TBST

Serin/theronine kinase

Bovine serum albumin

Double distilled water

Eppendorf

Fetal bovine serum

Hour

Minute

Second

Messenger ribonucleic acid

Phosphate buffered saline

Phosphatidylinositol-3kinase

Penicillin/Streptomycin

Polyvinylidene fluoride

Reverse transcription

Polymerase chain reaction

Sodium dodecyl sulfate

Tris buffered saline

1.Atlante, S., A. Visintin, E. Marini, M. Savoia, C. Dianzani et al., 2018 alpha-ketoglutarate dehydrogenase inhibition counteracts breast cancer-associated lung metastasis. Cell Death Dis 9: 756.

2.Bernardini, G., F. Antonangeli, V. Bonanni and A. Santoni, 2016 Dysregulation of Chemokine/Chemokine Receptor Axes and NK Cell Tissue Localization during Diseases. Front Immunol 7: 402.

3.Brackett, C. M., B. Kojouharov, J. Veith, K. F. Greene, L. G. Burdelya et al., 2016 Toll-like receptor-5 agonist, entolimod, suppresses metastasis and induces immunity by stimulating an NK-dendritic-CD8+ T-cell axis. Proc Natl Acad Sci U S A 113: E874-883.

4.Bray, F., J. Ferlay, M. Laversanne, D. H. Brewster, C. Gombe Mbalawa et al., 2015 Cancer Incidence in Five Continents: Inclusion criteria, highlights from Volume X and the global status of cancer registration. International Journal of Cancer 137: 2060-2071.

5.Bray, F., J. Ferlay, I. Soerjomataram, R. L. Siegel, L. A. Torre et al., 2018 Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 68: 394-424.

6.Broutier, L., G. Mastrogiovanni, M. M. Verstegen, H. E. Francies, L. M. Gavarro et al., 2017 Human primary liver cancer-derived organoid cultures for disease modeling and drug screening. Nat Med 23: 1424-1435.

7.Chang, L. Y., Y. C. Lin, J. Mahalingam, C. T. Huang, T. W. Chen et al., 2012 Tumor-derived chemokine CCL5 enhances TGF-beta-mediated killing of CD8(+) T cells in colon cancer by T-regulatory cells. Cancer Res 72: 1092-1102.

8.Cheng, X., H. Wu, Z.-J. Jin, D. Ma, S. Yuen et al., 2017 Up-regulation of chemokine receptor CCR4 is associated with Human Hepatocellular Carcinoma malignant behavior. Scientific Reports 7.

9.Cianciaruso, C., T. Beltraminelli, F. Duval, S. Nassiri, R. Hamelin et al., 2019 Molecular Profiling and Functional Analysis of Macrophage-Derived Tumor Extracellular Vesicles. Cell Rep 27: 3062-3080 e3011.

10.Cutano, V., E. Di Giorgio, M. Minisini, R. Picco, E. Dalla et al., 2019 HDAC7-mediated control of tumor microenvironment maintains proliferative and stemness competence of human mammary epithelial cells. Mol Oncol.

11.Eggert, T., and T. F. Greten, 2017 Current Standard and Future Perspectives in Non-Surgical Therapy for Hepatocellular Carcinoma. Digestion 96: 1-4.

12.Eggert, T., K. Wolter, J. Ji, C. Ma, T. Yevsa et al., 2016 Distinct Functions of Senescence-Associated Immune Responses in Liver Tumor Surveillance and Tumor Progression. Cancer Cell 30: 533-547.

13.Feng, X., N. Yan, W. Sun, S. Zheng, S. Jiang et al., 2019 miR-4521-FAM129A axial regulation on ccRCC progression through TIMP-1/MMP2/MMP9 and MDM2/p53/Bcl2/Bax pathways. Cell Death Discov 5: 89.

14.Garre, J. M., H. M. Silva, J. J. Lafaille and G. Yang, 2017 CX₃CR1(+) monocytes modulate learning and learning-dependent dendritic spine remodeling via TNF-alpha. Nat Med 23: 714-722.

15.Gerlach, C., E. A. Moseman, S. M. Loughhead, D. Alvarez, A. J. Zwijnenburg et al., 2016 The Chemokine Receptor CX₃CR1 Defines Three Antigen-Experienced CD8 T Cell Subsets with Distinct Roles in Immune Surveillance and Homeostasis. Immunity 45: 1270-1284.

16.Gurler Main, H., J. Xie, G. G. Muralidhar, O. Elfituri, H. Xu et al., 2017 Emergent role of the fractalkine axis in dissemination of peritoneal metastasis from epithelial ovarian carcinoma. Oncogene 36: 3025-3036.

17.Haider, C., J. Hnat, R. Wagner, H. Huber, G. Timelthaler et al., 2019 Transforming Growth Factor-beta and Axl Induce CXCL5 and Neutrophil Recruitment in Hepatocellular Carcinoma. Hepatology 69: 222-236.

18.Hamon, P., P. L. Loyher, C. Baudesson de Chanville, F. Licata, C. Combadiere et al., 2017 CX₃CR1-dependent endothelial margination modulates Ly6C(high) monocyte systemic deployment upon inflammation in mice. Blood 129: 1296-1307.

19.Ikeda, M., C. Morizane, M. Ueno, T. Okusaka, H. Ishii et al., 2018 Chemotherapy for hepatocellular carcinoma: current status and future perspectives. Jpn J Clin Oncol 48: 103-114.

20.Kawaguchi, N., T. T. Zhang and T. Nakanishi, 2019 Involvement of CXCR4 in Normal and Abnormal Development. Cells 8.

21.Kim, E., A. Lisby, C. Ma, N. Lo, U. Ehmer et al., 2019 Promotion of growth factor signaling as a critical function of beta-catenin during HCC progression. Nat Commun 10: 1909.

22.Li, Z., J. Zhang, J. Zhou, L. Lu, H. Wang et al., 2019 Nodal Facilitates Differentiation of Fibroblasts to Cancer-Associated Fibroblasts that Support Tumor Growth in Melanoma and Colorectal Cancer. Cells 8.

23.Liu, H., Y. Liu, W. Liu, W. Zhang and J. Xu, 2015 EZH2-mediated loss of miR-622 determines CXCR4 activation in hepatocellular carcinoma. Nat Commun 6: 8494.

24.Ma, S., Q. Cheng, Y. Cai, H. Gong, Y. Wu et al., 2014 IL-17A produced by gammadelta T cells promotes tumor growth in hepatocellular carcinoma. Cancer Res 74: 1969-1982.

25.Marchesi, F., L. Piemonti, G. Fedele, A. Destro, M. Roncalli et al., 2008 The chemokine receptor CX₃CR1 is involved in the neural tropism and malignant behavior of pancreatic ductal adenocarcinoma. Cancer Res 68: 9060-9069.

26.Marchica, V., D. Toscani, A. Corcione, M. Bolzoni, P. Storti et al., 2019 Bone Marrow CX₃CL1/Fractalkine is a New Player of the Pro-Angiogenic Microenvironment in Multiple Myeloma Patients. Cancers (Basel) 11.

27.Mazzoni, M., G. Mauro, M. Erreni, P. Romeo, E. Minna et al., 2019 Senescent thyrocytes and thyroid tumor cells induce M2-like macrophage polarization of human monocytes via a PGE2-dependent mechanism. J Exp Clin Cancer Res 38: 208.

28.Miething, C., C. Scuoppo, B. Bosbach, I. Appelmann, J. Nakitandwe et al., 2014 PTEN action in leukaemia dictated by the tissue microenvironment. Nature 510: 402-406.

29.Ohri, N., L. A. Dawson, S. Krishnan, J. Seong, J. C. Cheng et al., 2016 Radiotherapy for Hepatocellular Carcinoma: New Indications and Directions for Future Study. J Natl Cancer Inst 108.

30.Righi, E., S. Kashiwagi, J. Yuan, M. Santosuosso, P. Leblanc et al., 2011 CXCL12/CXCR4 blockade induces multimodal antitumor effects that prolong survival in an immunocompetent mouse model of ovarian cancer. Cancer Res 71: 5522-5534.

31.Shen, F., Y. Zhang, D. L. Jernigan, X. Feng, J. Yan et al., 2016 Novel Small-Molecule CX₃CR1 Antagonist Impairs Metastatic Seeding and Colonization of Breast Cancer Cells. Mol Cancer Res 14: 518-527.

32.Shulby, S. A., N. G. Dolloff, M. E. Stearns, O. Meucci and A. Fatatis, 2004 CX₃CR1-fractalkine expression regulates cellular mechanisms involved in adhesion, migration, and survival of human prostate cancer cells. Cancer Res 64: 4693-4698.

33.Tyner, J. W., O. Uchida, N. Kajiwara, E. Y. Kim, A. C. Patel et al., 2005 CCL5-CCR5 interaction provides antiapoptotic signals for macrophage survival during viral infection. Nat Med 11: 1180-1187.

34.Walch-Ruckheim, B., R. Mavrova, M. Henning, B. Vicinus, Y. J. Kim et al., 2015 Stromal Fibroblasts Induce CCL20 through IL6/C/EBPbeta to Support the Recruitment of Th17 Cells during Cervical Cancer Progression. Cancer Res 75: 5248-5259.

35.Wang, Q., W. Lu, T. Yin and L. Lu, 2019 Calycosin suppresses TGF-beta-induced epithelial-to-mesenchymal transition and migration by upregulating BATF2 to target PAI-1 via the Wnt and PI3K/Akt signaling pathways in colorectal cancer cells. J Exp Clin Cancer Res 38: 240.

36.Wu, Q., J. X. Chen, Y. Chen, L. L. Cai, X. Z. Wang et al., 2018a The chemokine receptor CCR10 promotes inflammation-driven hepatocarcinogenesis via PI3K/Akt pathway activation. Cell Death Dis 9: 232.

37.Wu, S., Q. Zheng, X. Xing, Y. Dong, Y. Wang et al., 2018b Matrix stiffness-upregulated LOXL2 promotes fibronectin production, MMP9 and CXCL12 expression and BMDCs recruitment to assist pre-metastatic niche formation. J Exp Clin Cancer Res 37: 99.

38.Xu, J., J. Liang, Y. M. Meng, J. Yan, X. J. Yu et al., 2017 Vascular CXCR4 Expression Promotes Vessel Sprouting and Sensitivity to Sorafenib Treatment in Hepatocellular Carcinoma. Clin Cancer Res 23: 4482-4492.

39.Ye, L. Y., W. Chen, X. L. Bai, X. Y. Xu, Q. Zhang et al., 2016 Hypoxia-Induced Epithelial-to-Mesenchymal Transition in Hepatocellular Carcinoma Induces an Immunosuppressive Tumor Microenvironment to Promote Metastasis. Cancer Res 76: 818-830.

40.Zheng, J., M. Yang, J. Shao, Y. Miao, J. Han et al., 2013 Chemokine receptor CX₃CR1 contributes to macrophage survival in tumor metastasis. Mol Cancer 12: 141.

Ethics approval and consent to participate

This study was approved by the Medical Research Ethics Committee of Chongqing Medical University, and informed consent was obtained from all patients.

Consent for publication

Not applicable.

Availability of data and materials

The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.

Competing interests

The authors declare that they have no competing interests.

Funding

The trial was supported by the Natural Science Foundation of China (NSFC 81672103 to QS). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Author’s contributions

Q.S. supervision, conceived of the study. M.T.F. obtained most part of the data. Y.G.W. was responsible for collating experimental data and writing manuscript. X.L. provided HCC specimens. Y.J.J. provided the methods of experiments. X.W.W. provided the methods of experiments. M.J.B. was responsible for analysing data. L.Q.A. was responsible for analysing data. All authors interpreted the data and contributed to the final version of this report. All authors approved the final manuscript.

Acknowledgements

We wish to thank the ministry of education key laboratory of diagnostic medicine, and school of laboratory medicine (Chongqing Medical University) for providing the ascites samples.

Author’s information

Qiong Shi	[email protected]
Mengtian Fan	[email protected]
Yaguang Weng	[email protected]
Xian Li	[email protected]
Yingjiu Jiang	[email protected]
Xiaowen Wang	[email protected]
Mengjun Bie	[email protected]
Liqin An	[email protected]

Download PDF

Version 1

posted

You are reading this latest preprint version

CX3CR1 regulates hepatocellular carcinoma(HCC) metastasis via PI3K/AKT pathway

Status:

Version 1

Abstract

Figures

Background

Methods

Results

Discussion

Conclusions

Abbreviations

References

Declarations

Status:

Version 1