Animal research
Animal research was performed in agreement with the EC directive 2010/63/UE86/609/CEE, in compliance with the animal welfare policies of the French Ministry of Agriculture (Art. R. 214 − 107 and 214 − 122). Animal were bred and maintained in our animal facility which is accredited by the French Ministry for Superior Education and Research and the French Ministry of Agriculture (agreement #C67-218-40) following the French Law (Decree n° 2013 − 118 01 and its supporting annexes entered into legislation on 01 February 2013) relative with the protection of animals used in scientific experimentation. All experiments were done in agreement with the local ethical committee. Studies are reported in accordance with the ARRIVE 2.0 guidelines. Mouse breeding and behavior experiments were conducted in SPF (Specific Pathogen Free) conditions in our animal facility at PHENOMIN-ICS, following the 3R principle. Mice were kept grouped in two to five animals in each cage. Mice were kept in the controlled light cycle at 12 h light and 12 h dark (light turned on at 7 AM and off at 7 PM through an automated control system). Mice were kept under a controlled temperature of 21 ± 1°C and humidity of 55 ± 10% and had free access to food (standard chow) and autoclaved tap water. For all experiments, mice were transferred to the experimental facility of ICS two weeks prior to behavior tests so that they have some time for habituation to the experimental facility of ICS. Animals were transferred to the experimental room 30 min before each experimental test.
Generating the COL6A5-p.Glu2272* mice model using CRISPR/Cas9
The mutant mouse line Col6a5em1YahICS, also named Col6a5E2302*, for the human COL6A5-p.Glu2272* mutation, was generated in ICS using CRISPR-Cas9 technology. In the mouse, the mutant codon is located in exon 38 (Ensembl ID ENSMUSE00000891350.1; figure S1). The guide RNA had to drive the double strand break generated by the Cas9 protein very close to the site of insertion of the selection mutation (leading to a STOP codon). We used the CRISPOR online software (http://crispor.tefor.net/crispor.py) to select high specificity-score sgRNAs with a low number of predicted off-target sequences. This guide RNA, AGTCATGGCAGAGAAGAACT, had a specificity score of 52 (internal name gR52). The guide RNA was validated in vitro for its ability to drive DSB (Double Strand Break) on a PCR fragment containing the targeted sequence in the presence of Cas9 protein. A donor single-stranded oligonucleotide (donor ssODN) was designed that bares the expected mutation (G > T, corresponding to the rs11537567 human variant) as well as 2 silent mutations (A > G and A > C). Its sequence was AGCCACGTCCATGTAATATTCTTGAAGAGAAGCATCCCCAGGCT-CATGAGCAAGACCCAGCTCTTATCGGCCATGACTTTCATGTTCTGCAACAGAATAACTTTAGTCACTAGTGGTGAAAGGGTTAACTTG. Together, these 2 mutations generate a new HaeIII restriction site. In addition, a third A > G mutation was introduced after the new STOP codon. These 3 mutations generated 3 mismatches in the donor DNA that allowed to avoid new double strand breaks after the occurrence of homology directed repair.
The CRISPR guide efficiency was tested in vitro using a Sureguide kit (Agilent Technologies 5190–7716). In the presence of the Cas9 protein, the PCR product, including the region of interest, should be cut. A guide is validated if it cuts the target PCR fragment. A mix containing the Cas9 mRNA, the guide RNA and the ssODN was microinjected in fertilized C57BL/6N oocytes, and PCR screened the newborn offspring. The microinjection of a mix of gR52 guide RNA (12 ng/µl), spCas9 mRNA (25 g/µl), and 10 ng/µl ssODN in the male pronuclei of 355 C57BL/6N fertilized oocytes led to 28 pups. PCR followed by HaeIII restriction digests, screened the pups. Primers F1 (AATGGAAATAATTCTGCACCAAGTG) and R1 (TAAGACAGAGGTCAGTGGAGCTGGG) were used to amplify a PCR fragment of expected size 426 bps. In the presence of the mutations of interest, 2 fragments of 245 bps and 181 bps were detected after HaeIII restriction digest. All undigested PCR products from pups showing HaeIII digests were subsequently sequenced by Sanger sequence. The insertion of the new STOP codon was confirmed by Sanger sequencing. Eleven F0 pups (> 39%) had the expected mutations. Five F0 animals were bred with wild type (wt) C57BL/6N mice to generate F1 founders. F1 mice were analyzed for germline transmission by Sanger Sequencing to establish the Col6a5em1 − E2302* mouse line. All founders gave heterozygous pups. Two lines were fully established and cryopreserved, and one was further studied, as shown in the present paper.
Determination of genotype
Crude genomic DNA was extracted from mouse tail samples through Direct PCR Lysis Reagent-Tail (Viagen Biotech, Cat # 101-T) according to the manufacturer’s instructions. Subsequently, the Phusion Hot Start II High-Fidelity DNA polymerase kit (Thermo Scientific) was used with primers specific for the wt (+) and mutant (Col6a5E2302*) alleles. Moreover, PCR reaction containing the following: 500 ng genomic DNA extracted from a wt or mutant mouse, 4 µl 5×Phusion HF Buffer, 0.4 µl dNTP mix (dATP, dCTP, dGTP, dTTP at 10 mM, Thermo Scientific), 0.2 µl each primer at 0.5 µM and H2O in a total volume of 20 µl. Using a T100 thermocycler (Bio-Rad), PCR was performed with the following thermal condition: 96°C for 5min followed by 30 cycles of 96°C for 8s, 62°C for 10s and 68°C for 45s, and then annealing temperature as 68°C for 5min with final elongation step for 5min at 72°C. Next, 10 µl of PCR outcome was used to digest with enzyme HaeIII 0.2 µl, 10X Buffer of volume 2 µl, and remaining H2O to make a total volume of 20 µl for each reaction and kept at 37°C incubator for 15min. 2% agarose gel was run for both digested and non-digested PCR outcomes and differentiated between wt and mutant mice. Our point mutation (PM) containing sequence of DNA was digested by HaeIII restriction enzyme into further 236 bps and 190 bps Col6a5E2302*allele along with 426 bps wt allele. In contrast, the non-digested = uncut PCR outcome gave only a wt allele of 426 bps. Mice genomic DNA showing only one band of the wt allele (+) of 426 bps in digested PCR outcomes were identified as wild-type littermate mice (wt lit). When both the wt allele band of 426 bps and the 236 bps & 190 bps PM alleles (mut) in digested PCR outcome, mice were heterozygous. Similarly, when mice genomic DNA showed no wt allele of 426 bps and only two bands of 236 bps and 190 bps of PM allele in digested PCR outcome they were genotyped as homozygous mice. Primer sequence information is shown in Table S1.
Analysis of transcript expression level by Droplet digital PCR (ddPCR)
We determined Col6a5 mRNA expression using Real-Time droplet digital PCR (RT-ddPCR) on 42-week aged mice that underwent the previous behavioral characterization. Eight control (wt), 5 heterozygotes (hets) and 6 homozygotes (homs) males, plus 10 wt, 7 hets and 6 homs females were used. Dorsal root ganglions (DRGs) were collected from wt and mutant mice and frozen in liquid nitrogen. Later, samples were lysed in TRIzol Reagent through magnetic beads containing Precellys®CK14 tubes. Total RNA was collected and purified using RNeasy Mini Kit (Qiagen) according to the protocol of the manufacturer company. Afterward, cDNA was synthesized by using the cDNA synthesis Kit “SuperScript™VILO™cDA Synthesis Kit” (Invitrogen). Then, ddPCR was performed for mRNA amplification in the volume of 20µL reactions for each sample. According to the manufacturer's recommendation, 250 nM specific primers, 125 nM of each probe, 1× ddPCR Supermix for Probes, and 50 ng DNA were used. PCR machine was run with the thermal condition as following: 10 min at 95°C, 40 cycles of 20s at 95°C, 30s at 59.2°C, 2min at 72°C, and 10min at 98°C. Droplet Digital PCR System (Bio-Rad) was used for droplet generation and quantification. Data were further analyzed using QuantaSoft Software (Bio-Rad). The sequences of primers and probes are shown in Table S2.
Evans Blue dye penetration assay for skin permeability
To examine the skin barrier integrity of mice, the Evans blue dye assay was performed on 42-week aged mice that underwent the previous behavioral characterization. This assay allows to detect skin barrier impairment as described previously (Zhang et al. 2018). Ten wt, 9 hets and 10 homs males, with 14 wt, 12 hets and 11 homs females were used. Just after euthanasia with cervical dislocation, the back of each individual was shaved, and Evans blue dye (Sigma, Ref# E2129) was applied as 1% in PBS and 50 µl/mouse. After two hours, the skin was collected and homogenized in formamide (Sigma, Ref#7503-). Subsequently, Evans blue dye extracted from skin samples was quantified by recording each sample by optical density (OD) at 620nm with a microplate reader.
Functional exploration and assessment
The behavioral characterization was performed on two experimental cohorts of males and females, ages 6 to 32 weeks. We used 13 B6N wt from the commercial breeders, 10 wt littermates, 12 hets and 10 homs males to evaluate scratching and grooming behaviors. For the female, 13 B6N wt, 14 wt littermates, 12 hets and 11 homs females were used. The same cohorts or parts of these cohorts were used for recording anxiety- and despair-like behaviors and social behavior. The experimenter was blind to the mouse genotype.
Scratching and grooming behaviors
Scratching and grooming behaviors were recorded during different sessions at 6, 12, 18, 26 and 32 weeks of age. To assess behaviors, mice were given 2 weeks in the experimental facility for adaption before assessment. For each session, mice were transferred 30 min prior to the beginning of the observations in the experimental room. Further, one day before the scratching observation, mice were placed for 30 min in transparent plastic experimental boxes for habituation. On the day of the experiment, mice were given 10 min in transparent plastic boxes for habituation before the evaluation began. Behind the transparent plastic boxes, a mirror was also positioned to assess mice behavior from the front and back view, as mentioned previously (Shimada and LaMotte 2008). Subsequently, mice behavior was video-recorded in the plastic box for 30 min as previously reported (Sun and Chen 2007; Shimada and LaMotte 2008; Liu et al. 2016). While analyzing the videos, different parameters were scored, including scratching time (i.e. the time of lifting of the hind paw to the region of the body that is scratched (back and face) and returning to the cage floor) (Figure S2). While grooming behavior was analyzed for whipping mice with forelimbs and licking their body and tail (Shimada and LaMotte 2008). All scratching and grooming tests were performed between 8:00 AM and 2:00 PM.
Exploration and anxiety-like behaviors
Anxiety-related behavior was evaluated at 36 weeks of age on the same animals as those used for scoring scratching and grooming behaviors through an elevated plus maze experiment as previously described (Dubos et al. 2018). For locomotor and exploration activity, we also performed an open field test (Dubos et al. 2018). In an open-field experiment, a square apparatus (Panlab Harvard apparatus IR ACTIMETER, Bioseb, Vitrolles, France) containing all required sensors was used, and a polypropylene sheet covered the arena. Light for the open-field experiment was measured and kept at 150 lux in the center of the arena. Mice were placed at the periphery of the open field apparatus and were allowed to explore the arena freely for 30 min. The experiment was performed in a closed room without any experimenter disturbance. The automated system measured the total distance, number of rearings, and time spent in center and peripheral regions with video tracking and infrared sensors. Mice activity was recorded with a video tracking system (Ethovision, Noldus, France) during this session of 30 min.
Further, anxiety-like behavior was assessed with the elevated plus maze. The elevated plus maze apparatus was placed at a height of 50 cm above the floor. It was made of PVC and completely automated (Imetronic, Pessac, France). It has two enclosed arms with dimensions (30 X 5 X 15 cm) and two open arms with dimensions (30 X 5 cm). The apparatus has infrared sensors to detect different parameters for anxiety, such as the number of entries in open arms, time spent in the open or closed arms, and the number of attempts made by mice etc. Mice were placed on a central platform and their exploration of the maze was recorded for 5 min.
Despair-like behavior
Despair-like behavior was evaluated at the age of 38 weeks on the same animals as those used for scoring scratching, grooming, and anxiety-like behaviors through the tail suspension test as described previously (Dubos et al. 2018). In this experiment, mice were suspended with the help of tape and hanged for 6min, and immobility time was monitored using video recording. An increased immobility time is indicative of a despair-like phenotype.
Social behavior
Social behavior was determined at the age of 38-weeks on the same cohorts and before scoring of despair-like behavior. The Stoelting system (Dublin, Ireland) was composed of three successive identical chambers (20 cm × 40 cm × 22 cm) with (5 cm × 8 cm) openings to allow access between the chambers. The protocol used was similar to the previously described (Duchon et al. 2011; Arbogast et al. 2016). We used adult C57BL/6N mice as stranger mice (unfamiliar mice). The age and sex of stranger mice and the mice tested for their social behavior were the same. Stranger mice were kept separately to avoid any olfactory or visual contact with test mice. Before the day of the experiment, stranger mice were habituated in wire cages for 10min for 3–5 days until they felt comfortable staying in wire cages. The experiment was divided into three phases. In the first phase, test mice were placed in the middle chamber and allowed to habituate for 10min. In the second phase (social exploration), the test mouse was enclosed in the central box, an unfamiliar mouse (stranger 1 or S1) was placed randomly in one of the wire cages, and on another side, an empty wire cage was placed. The doors were re-opened, and the test mouse was allowed to explore the entire social test box for 10 min. Time spent in each chamber, the number of entries into each chamber and the time spent sniffing each wire cage were recorded. In the third phase (social discrimination), a new, unfamiliar mouse (stranger 2 or S2) was placed by replacing the empty wire cage, and the test mouse was allowed to explore for 10 more min. During this time, the test mouse could explore or sniff the already-investigated mouse (S1) and the novel unfamiliar mouse (S2). The entire social test box was washed with tap water and dried with absorbent paper between each test to remove odors.
Statistical analysis
The results are expressed as mean ± standard error of the mean (SEM) for each experimental group. Student's t-test (two-tailed) was used to compare the two groups' differences. In addition, multiple groups were compared using one-way or two-way repeated measures analysis of variance (ANOVA) with a Tukey post-hoc test where appropriate. Data was analyzed by using GraphPad Prism 9 software. For all analyses, a p-value was considered significant as *p < 0.05, **p < 0.01, and ***p < 0.001.