Plasmid construction
E. coli K4 serotype O5:K4:H4 (U141, 11307) was engineered for the synthesis of chondroitin sulfate. The fructosyltransferase encoded by kfoE was deleted using λ red recombinase (Datsenko and Wanner 2000), resulting in strain K4_ΔkfoE. The FRT-flanked kanamycin resistance cassette was PCR amplified from pKD4 by deletion primers with 40 nucleotides homologous regions with a target gene on the genome. The PCR product was purified by a PCR cleanup kit (Cycle Pure Kit, Omega) and transformed into the λ red recombinase expressing E. coli K4 strain by electroporation. This system enabled the deletion of the kfoE gene and its replacement with an antibiotic resistance gene. Finally, positive knockout strains were screened by colony PCR. Two primers were used in this study. The k4_dkfoE_F primer was 5’ TGCAATATGACCTTAGAAGAGATTTCTAATATGTTAGAACAGGAGAAAAAACACGTCTTGAGCGATTGTG3’. The k4_dkfoe_R primer was 5’ ATATCCAGCCTTGAAAAAACGCGAACTCATCCCCGCCATTGGAATTATAA ACGGCTGACATGGGAATTAG3’.
Media
Shake flask fermentations utilized rich defined medium developed from modified protocols (Cirino et al. 2006; Neidhardt et al 1974) (5.0 g/L K2HPO4, 3.5 g/L KH2PO4, 3.5 g/L (NH4)2HPO4, 100 mL of 10X MOPS buffer, (83.7 g/L MOPS, 7.2 g/L Tricine, 28 mg/L FeSO4.7H2O, 29.2 g/L NaCl, 5.1 g/L NH4Cl, 1.1 g/L MgCl2, 0.5 g/L K2SO4, 0.2 mL micronutrient stock), 1 mL of 1 M MgSO4, 1 mL of 0.5 g/L thiamine HCl, 0.1 mL of 1 M CaCl2, 20 g/L glucose, with 12.5 mM GlcNGc. Micronutrient Stock consisted of 0.2 g/L (NH4)6Mo7O24, 1.2 g/L H3BO3, 0.1 g/L CuSO4, 0.8 g/L MnCl2, and 0.1 g/L ZnSO4. E. coli K4 serotype O5:K4 (L):H4 was from American Type Culture Collection (ATCC 23502). All reagents for medium preparation were from Sigma Chemical Co. (St. Louis, MO).
Shake flask experiments
Shake flask experiments were used to evaluate the N-glycolyl glucosamine feeding experiments. E. coli K4 ΔkfoE, cells from 15% glycerol stock were streaked on an agar plate containing 50 mg/ml of kanamycin and grown overnight. Two colonies from the plate were picked for duplicate sample analysis, and pre-cultures were grown overnight at 37 °C. The samples were then diluted to 100 ml at an optical density (OD) 0.05 and transferred to a 250 ml Erlenmeyer flask and incubated at 37 °C with shaking at 220 rpm. The cultures were left to grow under the same conditions for an additional 48 h. The cell growth and chondroitin production was similar to that previously reported in our laboratory (He et al. 2015).
N-glycolyl chondroitin purification
CPS was purified from the cell pellet by re-suspending in water and autoclaving in the liquid cycle for 15 min. The autoclaved solution was centrifuged, and the supernatant was collected. Autoclaved supernatant from the cell pellet and cell culture supernatant were precipitated with 80 vol% cold ethanol and stored in an explosion-proof refrigerator overnight at 20 °C. Both intracellular and extracellular chondroitin were recovered. The pellet was collected and re-suspended in buffer (100 mM Tris, pH 7.5, 50 mM MgCl2, 10 mM CaCl2) and DNAse (1 mg/L, Sigma) was added. The sample was incubated at 37 °C for 1 h after which protease K (2.5 mg/mL, Sigma) was then added, and the sample was incubated at 56 °C for 2 h. After a second precipitation from 80% cold ethanol, the dry pellet was collected, re-dissolved in water (~1 mL), and filtered using a 10 KDa spin column (Amicon Ultra, Millipore) to remove small peptides and salt. The chondroitin obtained was sufficiently free of other impurities or other polysaccharides to undertake disaccharide analysis.
Sample digestion into GAG disaccharides
Digestion buffer (50 mM NH4OAc containing 2 mM CaCl2 adjusted to pH 7.0) was added to the sample. Recombinant chondroitin lyase ABC (10 mU each, pH optimum 7.4) was added to each sample and mixed. The samples were incubated at 37 °C for 3 days. Under these reaction conditions, chondroitin lyase ABC could depolymerize their GAG substrates (in amounts of over 100 μg) into GAG disaccharides. The samples were washed twice with 100 μL distilled water in 3K MWCO filter unit. The filtrates passing through the filter unit contained disaccharide products, and these were dried using a vacuum centrifuge and stored at −20 °C for AMAC-labeling.
AMAC labeling
The dried samples were AMAC-labeled by adding 10 μL of 0.1 M AMAC in DMSO/acetic acid (17/3, V/V) and incubating at room temperature for 10 min, followed by the addition of 10 μL of 1 M aqueous NaBH3CN and incubating for 1 h at 45 °C. After the AMAC-labeling reaction, the samples were centrifuged, and each supernatant was recovered. Samples were stored in a light-resistant container at room temperature until analyzed by LC-MS/MS.
LC-MS/MS Analysis
LC was performed on an Agilent 1200 LC system at 45 °C using an Agilent Poroshell 120 ECC18 column (2.7 μm, 3.0 × 50 mm) with a flow rate of 300 μL/min. Mobile phase A (MPA) was 50 mM NH4OAc aqueous solution, and the mobile phase B (MPB) was pure methanol. The concentration of MPB increased from 5% to 45% for 10 min, then rose to 100% MPB in the next 0.2 min, and a 4 min flow of 100% MPB was applied to elute all compounds. A triple quadrupole mass spectrometer equipped with an ESI source (Thermo Fisher Scientific, San Jose, CA) was used as a detector. The online MS analysis was at the multiple reaction monitoring (MRM) mode. The conditions and collision energies for all of the disaccharides MRM transitions are listed in our previous publication (Sun et al. 2015). The data analysis was performed on Thermo Xcalibur software.
N-glycolyl glucosamine (GlcNGc)-synthesis and chemical characterization
All reagents were purchased from commercial vendors and, unless otherwise noted, used without further purification. “Brine” refers to a saturated aqueous solution of sodium chloride. Thin-layer chromatography (TLC) was performed using Merck Kieselgel 60F254 pre-coated aluminum backed plates. Plates were visualized using 5% H2SO4 in methanol. NMR experiments were performed on a Bruker Advance III 600 MHz spectrometer (Bruker Bio Spin, Billerica, MA) with Topspin 3.2 software (Bruker). N-glycolyl glucosamine (GlcNGc) was synthesized following a previously published strategy (Fig. 3). Briefly, the hydrochloride salt of 2-amino-2-deoxy-1,3,4,6-tetra-O-acetyl-b-D-glucopyranose 1 was treated with acetoxyacetyl chloride in the presence of triethylamine to afford acetoxyacetyl residue on the amine group. By applying Zemplen conditions, fully protected intermediate 2 was next deprotected, and GlcNGc was achieved in good yield. Spectral properties of the desired products compounds 2, and GlcNGc matched those described previously (Sinaÿ 1971; Bergfeld et al. 2012; Macauley et al. 2012).
1,3,4,6-Tetra-O-acetyl-2-acetyloxyacetamido-2-deoxy-glucopyranose 1
The hydrochloride salt of 2-amino-2-deoxy-1,3,4,6-tetra-O-acetyl-b-D-glucopyranose 1 (2.0 g, 5.2 mmol) was dissolved in CH2Cl2 (20 mL), then triethylamine (2.2 mL, 16 mmol) was added to the solution. The reaction mixture was cooled to 0 °C, and acetoxyacetyl chloride (0.7 mL, 6.5 mmol) was added. The resultant mixture was stirred for 3 h at room temperature. The reaction was monitored by TLC. When the reaction was completed, the mixture was diluted with EtOAc, and the organic phase was washed successively with water, 1 M NaOH, 0.1 M HCl and, brine. The organic phase was dried over MgSO4, filtered, and concentrated to yield a white crystalline solid. The material was recrystallized using a mixture of ethyl acetate and hexanes to yield the desired compound 2 as a white solid (1.9 g, 81%). 1H NMR (600 MHz, CDCl3), d (ppm) 6.18 (1H, d, J = 9.2 Hz), 5.68 (1H, d, J = 8.8 Hz), 5.17–5.10 (2H, m), 4.52 (1H, d, J = 15.4 Hz), 4.39 (1H, d, J = 15.4 Hz), 4.30 (1H, ddd, J = 9.1 Hz), 4.23 (1H, dd, J = 4.3 Hz, J = 12.3 Hz), 4.10 (1H, dd, J= 2.2 Hz), 3.78 (1H, ddd, J = 9.2 Hz), 2.14 (3H, s), 2.09 (3H, s), 2.07 (3H, s), 2.02 (3H, s), 2.01 (3H, s). 13C NMR (150 MHz, CDCl3), d (ppm) 171.3, 170.6, 169.7, 169.6, 169.2, 167.5, 92.4, 73.0, 72.1, 67.6, 62.6, 61.6, 52.7, 20.8, 20.7, 20.5. ESI (m/z): [M-H]- calcd. for C18H24NO12 446.1298, found m/z 446.1296.
2-Deoxy-2-hydroxyacetamido-D-glucopyranose GlcNGc
To a solution of 1,3,4,6-tetra-O-acetyl-2-acetyloxyacetamido-2-deoxy-b-D-glucopyranose 2 (1.5 g, 3.35 mmol) in MeOH (50 ml) at 0°C, 0.5 M NaOMe (5 ml) was added dropwise. The solution was stirred 2 h at room temperature. Amberlite IR 120 H+ resin was added to neutralize the reaction and was filtered. The filtrate was concentrated under reduced pressure to afford the desired product as a white solid (693 mg, 80%). 1H NMR (600 MHz, H2O) d (ppm) 5.12 (0.7H, d, J =3.0 Hz), 4.04 (s, 2H), 3.86 (1H, dd, J = 3.0 Hz, J = 10.2 Hz), 3.79 (1H, m), 3.75 (1H, m), 3.72 (1H, m), 3.42 (1H, t, J =9.6 Hz), 3.39 (1H, m). ESI (m/z): [M-H]- calcd. for C18H24NO12 236.0770, found m/z 236.0772.