Experiment 1
Observation of differences in Piezo2 expression in brain tissues between the TBI group and Sham group.
Mice were divided into a Sham group and a TBI model group (TBI group). One day before modeling and 12 hours and 1, 3, and 5 days after modeling, the neurological severity scores (NSSs) of the mice were evaluated. Each group underwent the Morris water maze (MWM) test on days 16–21. Western blotting (WB) was used to measure the expression of Piezo1 and Piezo2 in the brain tissues around the injury site and contralateral brain tissues at each time point mentioned above. Frozen brain tissue sections were prepared 3 days after TBI modeling, and single immunofluorescence staining was used to assess the expression of Piezo2, while double immunofluorescence staining was used for localization analysis of Piezo2 in microglia (Iba1), astrocytes (GFAP), and neurons (NeuN).
Experiment 2
Evaluation of the effects of knocking down or inhibiting the function of Piezo2 in TBI mice and changes in the expression of the downstream molecules RhoA/ROCK1.
The mice were divided into the sham surgery + scramble RNA negative control (Sham + NC), model + shRNA negative control (TBI + NC), model + Piezo2-shRNA (TBI + shRNA), Sham surgery + Piezo2-shRNA (Sham + shRNA), Sham + vehicle, TBI + vehicle, TBI + D-GsMTx4 and Sham + D-GsMTx4 groups. At 3 days after TBI modeling, the NSSs of the mice were determined, followed by HE staining and Nissl staining of frozen brain tissue sections. All groups underwent the MWM test on days 16–21. WB was used to measure the protein expression of Piezo2, Iba1, GFAP, IL-1β, TNF-α, ROCK1, total RhoA and RhoA-GTP in the brain tissue surrounding the injury in each group. Three days after modeling, double immunofluorescence staining for Piezo2 and ROCK1 or RhoA was performed.
1. Experimental Animals
A total of 154 healthy clean-grade C57BL/6J mice aged 8–12 weeks and weighing 21–24 g were provided by the Animal Experimental Center of Yangzhou University and randomly assigned to groups using a random number table. The mice were housed in clean animal rooms with adequate food and water on a 12-hour light/dark cycle.
2. Construction of a Traumatic Brain Injury Mouse Model
Mice were anesthetized with 5% isoflurane, and anesthesia was maintained with 2% isoflurane. The mouse's head was fixed in a stereotactic frame, and a constant temperature blanket was used to maintain the body temperature at 37.0 ± 0.5°C. A midline incision was made to expose the coronal suture, sagittal suture, and bilateral coronal ridges. A 4 mm diameter hole was drilled in the right coronal ridge, with the center of the hole located being between the coronal suture and the coronal ridge, while keeping the dura mater intact. CCI injury was induced as previously described [11]. A PinPoint Precision Cortical Impactor PCI3000 (Hateras) with a 3 mm diameter cylindrical impactor was used to strike the cortical surface vertically. The impact parameters used in this experiment were as follows: speed: 1.5 m/s, impact depth: 1.5 mm, and duration: 100 ms. After impact, the cortex was covered with sterile cotton, and the skin was sutured with 6 − 0 silk. Body temperature was maintained at 37.0 ± 0.5°C throughout the experiment until full consciousness was restored. In the Sham group, the scalp was incised, the skull was exposed; however, the brain was not impacted.
3. shRNA and D-GsMTx4 Injection
pAAV-U6-shRNA(Piezo2)-CMV-MCS-WPRE and pAAV-U6-shRNA(NC)-CMV-MCS-WPRE were designed and synthesized by Obio Technology Corporation (Shanghai, China). The Piezo2-siRNA sequence was CCTCTTCTTGTTTCAAGGGTT, and the NC-siRNA sequence was CCTAAGGTTAAGTCGCCCTCG. Injection was performed after the plasmid was packaged into an adeno-associated virus vector. D-GsMTx4 (Tocris) was dissolved in saline to a concentration of 5 µg/µl (for WB and slice staining), 10 µg/µl, or 15 µg/µl. Ten minutes after modeling, the left lateral cerebral ventricle was located using a brain stereotaxic apparatus and the following coordinates: 0.5 mm posterior to bregma, 1 mm left of bregma and 2.5 mm below the skull surface. A hole was slowly drilled using a microperforated dental drill, and a fixed microinjector was used to inject 300 nl of the appropriate shRNA solution, 1 µl of D-GsMTx4, or an equivalent amount of scrambled shRNA or saline into each mouse. The injection time was 5 minutes, and the needle was left in place for 10 minutes after injection to ensure full absorption of the solution. The needle was slowly withdrawn, the drilling site was coated with bone wax, and the scalp was sutured.
4. NSSs
NSSs were used to evaluate the mice’s motor (muscle strength and abnormal movements), sensory (vision, touch, and balance), and reflex function, as described previously [12]. TBI modeling was considered successful for mice with an NSS more than 2 and 5 on the first day after modeling, with reference to a previous study [13]. A point was awarded when a mouse failed to complete a task or exhibited loss of a reflex. A higher score indicates more severe nerve damage.
5. MWM Test
Referring to the study of Ge [14], the maze consisted of a circular tank with a diameter of 120 cm and a height of 50 cm that was filled with water dyed white with nontoxic titanium dioxide dye; the water temperature was kept at 24–26°C, and the pool was surrounded by blue blackout curtains. The pool was divided into four quadrants, and in the fourth quadrant, there was a movable circular platform, 15 cm in diameter, submerged approximately 1 cm below the surface. The positioning navigation training phase, which was performed at 8:00 am every day from the 16th to 20th day after TBI, the mice were placed in the water from different quadrants for training. The were given 60 s to find the platform and were allowed to stayed on the platform for 5 s. If the platform was not found within 60 s, the mouse was guided to the platform and allowed to stay there and learn its location for 30 s. ANY-maze (Stoelting, USA) was used to obtain video recordings and data and calculate the latency of animals to reach the platform (escape latency). In the spatial exploration phase, which was performed on the 21st day after TBI modeling, the platform was removed, and the mice were placed in the third quadrant, which was farthest from the original platform location. The time the mice spent in the target quadrant, the number of times they crossed the platform, and their swimming speed over 60 s were recorded for each group.
6. WB
WB was used to measure target protein expression. Brain tissue surrounding the injury or matching brain tissue from mice without TBI was collected and homogenized in RIPA lysis buffer with PMSF. The sample was centrifuged at 12000 rpm for 10 minutes at 4°C, the supernatant was collected and the protein concentration was quantified using the BCA method. Equal amounts of protein were separated by 8% SDS‒PAGE and then transferred to nitrocellulose membranes by wet transfer. After blocking with 5% skim milk for 2 hours, the membranes were probed with rabbit anti-Piezo2 (Thermo Scientific, 1:500), rabbit anti-Piezo1 (Thermo Scientific, 1:500), rabbit anti-Iba-1 (Thermo Scientific, 1:2000), rabbit anti-GFAP (Thermo Scientific, 1:1000), rabbit anti-TNF-α (Cell Signaling Technology, 1:1000), rabbit anti-IL-1β (Thermo Scientific, 1:1000), rabbit anti-ROCK1 (Thermo Scientific, 1:3000), rabbit anti-phospho-RhoA (1:2000), rabbit anti-RhoA (1:1500), and rabbit anti-GAPDH (Santa Cruz, 1:3000) antibodies overnight at 4°C. After washing with PBST, the membranes were probed with goat anti-rabbit IgG secondary antibody (1:3000, Jackson ImmunoResearch) at room temperature for 2 hours, and the protein bands were visualized using an enzyme-based detection system followed by scanning. The expression level of the target protein was calculated as the ratio of the gray value of the target protein band to that of the GAPDH band using ImageJ.
7. HE Staining and Nissl Staining
Mice were anesthetized with 5% isoflurane, and the thorax was exposed. The right atrium was cut, and PBS (40 ml) and 4% PFA (40 ml) were sequentially perfused through the left ventricle. The brain tissue was fixed in 4% PFA at 4°C overnight and dehydrated with 15% and 30% sucrose for 24 h each, and frozen sections (30 µm) were obtained and subjected to HE and Nissl staining by toluidine blue (Servicebio). The samples were observed and photographed under a microscope. Nissl bodies were counted in ImageJ.
8. Immunofluorescence Staining
Immunofluorescence staining was performed according to the methods previously reported by our research group [15]. Frozen sections were blocked with PBS containing 5% goat serum and 0.3% Triton X-100 at 37°C for 1 hour and then incubated with a mixture of rabbit monoclonal anti-Piezo2 antibody (Thermo Scientific, 1:200), goat polyclonal anti-NeuN antibody (Thermo Scientific, 1:500), goat polyclonal anti-GFAP antibody (Sigma, 1:500), goat polyclonal anti-Iba1 antibody (FUJIFILM Wako Chemicals, 1:1000), mouse monoclonal anti-ROCK1 antibody (Thermo Scientific, 1:500), and goat polyclonal anti-RhoA antibody (Thermo Scientific, 1:500) at 4°C overnight. After washing, the sections were incubated with corresponding secondary antibodies, including Cy3-labeled goat anti-rabbit IgG (Jackson ImmunoResearch, 1:500), Cy2-labeled donkey anti-goat IgG (Jackson ImmunoResearch, 1:500), Cy2-labeled goat anti-rabbit lgG (Jackson ImmunoResearch, 1:500), Cy3-labeled donkey anti-mouse IgG (Jackson ImmunoResearch, 1:500), and Cy3-labeled donkey anti-goat IgG (Jackson ImmunoResearch, 1:500), at room temperature for 1 hour. Finally, the sections were counterstained with DAPI for 1 minute to label the cell nuclei. All sections were observed and photographed using a Leica DMI4000 fluorescence microscope. Cells labeled with a single probe were counted using ImageJ.
9. Statistical Analysis
SPSS 23.0 was used for statistical analysis. All data are presented as the mean ± standard deviation. One-way analysis of variance (ANOVA) or two-way repeated measures ANOVA followed by Bonferroni’s post hoc test was used for comparisons among multiple groups, while two independent samples were compared by two-tailed independent sample t test. P < 0.05 was considered to indicate statistical significance.