Melatonin inhibits small extracellular vesicle delivery and CTNND1 reduces the migration ability of bladder cancer cells

doi:10.21203/rs.3.rs-3582008/v1

Download PDF

Research Article

Melatonin inhibits small extracellular vesicle delivery and CTNND1 reduces the migration ability of bladder cancer cells

https://doi.org/10.21203/rs.3.rs-3582008/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Purpose

Small extracellular vesicles (sEVs) have emerged as critical mediators of intercellular communication, capable of shuttling functional molecules from donor to recipient cells. Their direct impact on target cells can profoundly influence local and systemic environments, thereby promoting cancer growth and metastasis. Although several studies have explored the relationship between sEVs and various types of cancer, only few studies have been conducted on bladder cancer specifically.

Methods

This study used an in vitro approach and multiple assays to investigate whether melatonin affects catenin delta 1 (CTNND1) transmission through sEVs and how CTNND1 regulates the growth and migration of bladder urothelial carcinoma (BLCA) cells.

Results

We observed significantly elevated CTNND1 levels in BLCA cells. CTNND1 secreted by these cells could be delivered to recipient cells via sEVs. We further uncovered significant alterations in cellular behaviors upon delivery of sEVs, namely in terms of proliferation and migration. By delineating the biological functions of CTNND1 in BLCA cells, we have unveiled the potential of modulating CTNND1 expression as a promising avenue for clinical therapeutic intervention.

Conclusion

Our findings shed light on the intricate interplay between sEV-mediated cargo transfer and the regulation of CTNND1, offering valuable insights into novel therapeutic strategies for BLCA.

small extracellular vesicles

bladder cancer

catenin delta 1

melatonin

Bladder cancer is one of the most prevalent malignant tumors within the urinary system, leading to 57,3000 new cases and 21,3000 deaths annually (Sung et al. 2021). Urothelial carcinomas account for approximately 90% of bladder tumors, with squamous cell carcinomas, adenocarcinomas, and small cell carcinomas representing rarer variants, all of which are prone to recurrence and metastasis (Clark et al. 2013). Disrupted endogenous melatonin secretion has been reported in several patients with cancer (Xin et al. 2015; Gil-Martin et al. 2019; Kong et al. 2020), and melatonin has been found to partially inhibit the migration of cancer cells (Tian et al. 2021; Chen et al. 2021).

The epithelial-mesenchymal transition (EMT) process involves the loss of cell polarity by epithelial cells and the acquisition of enhanced migration, invasion, anti-apoptosis, and other mesenchymal phenotypes (Lamouille et al. 2014). EMT can promote tumor cell invasion, metastasis, and evasion to apoptosis-inducing factors (Pastushenko et al. 2018). Studies suggest that the metastasis of bladder cancer may be associated with high expression of adhesion factors in bladder mucosal cells. P120 catenin (p120ctn), a member of the subfamily of armadillo repeat-containing proteins, is encoded by the catenin delta 1 gene (CTNND1) (Yang et al. 2022). CTNND1 interacts with E-cadherin, promoting the formation of adherens junctions through its juxtamembrane structural domain (Liu et al. 2009). CTNND1 has been linked to cancer metastasis, with cytoplasmic expression of CTNND1 being associated with metastasis in gastric cancer, hepatocellular carcinoma, and colon carcinoma (Xing et al. 2015; Tang et al. 2016; Bellovin et al. 2005). CTNND1 is associated with cancer development and progression, exhibiting a dual role as an oncogene or tumor suppressor, depending on the cell and cancer type (Lin et al. 2021). However, whether the expression of CTNND1 contributes to the development and progression of bladder urothelial carcinoma (BLCA) remains unexplored.

Small extracellular vesicles (sEVs) are spherical double-membrane vesicles with a diameter of 30–100 nm, which are released after the fusion of multivesicular bodies with plasma membranes from various cell types (Kalluri and LeBleu 2020). sEVs predominantly carry membrane transporters, fusion proteins, lipid microdomain-related proteins such as integrins and tetraspanins, cell signaling proteins, and a variety of RNAs, such as microRNAs (miRNAs) and messenger RNA (mRNA) (Garcia-Martin et al. 2022; Raposo and Stoorvogel 2013). The involvement of sEVs in intercellular communication, intracellular homeostasis, and tumor development has been well documented (Mashouri et al. 2019; Riches et al. 2014). sEVs can shuttle from donor to recipient cells (Kahlert and Kalluri 2013), playing an important regulatory role in the transfer cascade reaction by transmitting functional molecules and directly affecting target cells (Steinbichler et al. 2017). Moreover, sEVs can influence local and systemic environments, promoting cancer growth and metastasis (Zhao et al. 2020). However, sEVs can also program the immune system, triggering antitumor responses (Raposo et al. 1996). sEVs have demonstrated utility in tumor diagnosis and cancer treatment (Lu et al. 2017).

Although several studies have explored the relationship between sEVs and various types of cancer, only few studies have been conducted on bladder cancer specifically. This study aimed to explore the impact of melatonin on the transmission of CTNND1 through sEVs and the mechanism by which CTNND1 regulates the growth and migration of BLCA cells. This study may provide valuable insights into the application of new clinical biomarkers and the use of sEVs in cancer treatment.

2.1. Cell lines and cell culture

The malignant human invasive bladder cancer cell line YTS-1 and the normal human bladder mucosal epithelial cell line HCV29 were obtained from Dr. Sen-itiroh Hakomori (The Biomembrane Institute, Seattle, WA, USA). Both cell lines were grown in RPMI 1640 medium (HyClone, Provo, UT, USA) supplemented with 10% fetal bovine serum (FBS; Biological Industries, Beit Haemek, Israel) at 37°C in a 5% CO₂ atmosphere.

2.2. sEV isolation

sEVs were isolated using differential ultracentrifugation. Briefly, when bladder cells reached 80% confluence in a 15-cm Petri dish after approximately 48 h, the growth medium was replaced with a sEV-depleted FBS medium. After 48 h of incubation, culture supernatants were collected and underwent a series of centrifugation steps: 300 × g for 10 min to pellet cellular debris, 2,000 × g for 10 min to pellet apoptotic bodies and microparticles, 10,000 × g for 30 min, and 100,000 × g for 70 min at 4°C. The resulting pellet was resuspended in 100 µL phosphate-buffered saline (PBS). The resulting supernatant was then centrifuged at 10,000 × g for 15 min at room temperature (RT; 25°C) and filtered through a 0.22 µm-diameter membrane. The final sEV pellet was stored at − 80°C until use.

2.3. Transmission electron microscopy (TEM)

Purified sEV samples were pipetted onto carbon-coated 400 mesh grids, incubated for 5 min, and washed twice with PBS. Uranyl acetate (2%) was pipetted onto the copper mesh and incubated for 30 s. Images were acquired using a transmission electron microscope (model H-7650; Hitachi, Tokyo, Japan) at 80 kV.

2.4. Nanoparticle tracking analysis

sEVs were loaded into a NanoSight LM10 instrument (Malvern Panalytical, Malvern, UK), and particles tracked for 60 s using the NanoSight nanoparticle tracking analysis software.

2.5. Cellular sEV uptake

When cells reached 80% confluence in a well, the ExoTracker probe was incubated with sEVs at a 1:500 volume ratio at 25°C for at least 40 min in the dark. After incubation, unlabeled sEVs were centrifuged at 1,000 × g for 5 min at 4°C through a 10 KD filter membrane, with this process repeated thrice. The probes containing sEVs were then incubated with cells for 1 h. After trypsin digestion, the cells were collected, centrifuged at 1,000 × g for 5 min at room temperature (RT; 25°C), washed with PBS, suspended in 500 µL PBS, and analyzed using flow cytometry.

2.6. Total protein extraction

Cells were detached using trypsin, washed three times with cold PBS, and lysed in RIPA buffer (50 mM Tris, pH 7.2, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, 150 mM NaCl, 10 mM MgCl₂, and 5% glycerol) containing protease inhibitors. The lysate was centrifuged at 14,000 × g for 15 min at 4°C, and the supernatant was collected. Protein concentration was determined using the bicinchoninic acid assay (Beyotime Biotechnology, Jiangsu, China), following the manufacturer’s instructions.

2.7. Western blotting

Proteins were separated using sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto polyvinylidene difluoride membranes (Bio-Rad, Hercules, CA, USA). Membranes were blocked with 5% skim milk in TBST (20 mmol/L Tris-HCl, 150 mmol/L NaCl, 0.05% Tween 20, pH 8.0) for 1 h at 37°C, probed with primary antibodies overnight at 4°C, and incubated with the appropriate HRP-conjugated secondary antibodies (Beyotime Biotechnology, Jiangsu, China). The bands were visualized using enhanced chemiluminescence (Vazyme Biotech, Nanjing, China) and photographed using a gel documentation system (Tanon Science & Technology Co., Shanghai, China).

Antibodies used in this study CTNND1 (A11399) was from ABclonal Technology (ABclonal, Wuhan, China). AKT (4685s), phosphorylated-AKT (4060s), erk (4696s), phosphorylated-erk (4370s), Alix (2171s), Calnexin (2679s), STAT3 (9139s) and phosphorylated-STAT3 (p-STAT3) (9145s) were from Cell Signaling Technology (Beverly, MA, USA). E-Cadherin (sc-8426) and N-Cadherin (sc-59987) were from Santa Cruz Biotechnology (Santa Cruz, CA, USA). GAPDH (G-9545) was from Sigma-Aldrich (St. Louis, MO, USA). CD63 (ab134045) and TSG101 (ab125011) were from Abcam (Cambridge, MA, USA).

2.8. CTNND1 knockdown

A short hairpin RNA (shRNA) targeting CTNND1 was subcloned into a lentivirus vector (pLKO-puro vector; Addgene, Cambridge, MA, USA) to construct the sh-CTNND1 vector, and shRNA sequences were listed. Lentiviral particles were generated in HEK293T cells using a packaging system with two assistant vectors (pMD2.G and psPAX2) with PEI MAX 40000 (Polysciences, Warrington, PA, USA). These lentiviral particles were collected from the supernatant after 48 h and used to infect YTS-1 cells. Stably transfected cells were selected using puromycin.

List of shRNA primers

Primer name	Primer sequences (5′-3′)
shRNA1-F	CCGGTCACCGGAGGTGCCATCGGATCAATACGA ATATTGATCCGATGGCACCTCC
shRNA1-R	AATTCAAAAGGAGGTGCCATCGGATCAATATTC GTATTGATCCGATGGCACCTCC
shRNA2-F	CCGGTCACCGCATGAGCGAGGAAGTTTAGCCGA AGCTAAACTTCCTCGCTCATGC
shRNA2-R	AATTCAAAAGCATGAGCGAGGAAGTTTAGCTTC GGCTAAACTTCCTCGCTCATGC

2.9. CTNND1 overexpression

CTNND1 was amplified from the cDNA of the YTS-1 cells and was cloned into a pLVX-IRES-Hyg lentiviral vector (Takara, Shiga, Japan). Lentiviruses were packaged in HEK293T cells and collected. HCV29 cells were infected with these lentiviruses, and stable transfectants were selected using puromycin.

2.10. Cell apoptosis

Cells were stained with annexin V-conjugated FITC and 7-AAD-conjugated APC (BioLegend, San Diego, CA, USA) for 15 min at RT in annexin V binding buffer. Flow cytometry (ACEA Biosciences, San Diego, CA, USA) was used to quantify cells in early (annexin V-positive) and late apoptosis (annexin V-positive and 7-AAD-positive).

2.11. Cell cycle detection

Cells were fixed with 70% ethanol, stained with propidium iodide (BioLegend), and treated with RNase (CoWin, Suzhou, China) in PBS. A flow cytometer (ACEA Biosciences) was employed to evaluate the cell cycle.

2.12. Cell proliferation assay

For the Cell Counting kit-8 (CCK-8) assay, 1500 cells were plated in a 96-well plate and incubated with 10 µL CCK-8 solution (Beyotime Biotechnology) for 4 h. Absorbance at 450 nm was measured using a microplate reader. For the EdU cell proliferation assay, cells were incubated with 10 µM EdU for 12 h, fixed with 2% paraformaldehyde, permeabilized with 0.2% Triton X-100, stained with iClick EdU solution (Genecopoeia, Rockville, MD, USA) for 30 min, rinsed with 1x iClick permeabilization wash reagent, and finally evaluated using flow cytometry.

2.13. Transwell assay

Transwell chambers (24-mm diameter, 8-µm pore size; Corning Life Sciences, Corning, NY, USA) were used for this assay. Cells at a density of 2 × 10⁴ were seeded into the upper chamber and starved overnight in a serum-free medium. Complete medium was added to the bottom chamber, and cells were grown for 24 h. Migrated cells were fixed with 4% paraformaldehyde(Sigma-Aldrich, St. Louis, MO, USA)for 15 min, stained with 0.1% crystal violet for 15 min, and photographed under a microscope ༈Ningbo Shunyu Optical Technology, Ningbo, China༉.

2.14. Wound-healing assay

The wound-healing assay was performed as previously described (Tan et al. 2020). Briefly, confluent cells in 6-wells plates were pretreated with 0.4 µg/mL mitomycin C (Sigma-Aldrich) for 30 min and scratched with a pipette tip. Cells were then rinsed with PBS, placed in RPMI 1640 medium supplemented with 0.04 µg/mL mitomycin C, and photographed under a microscope after 24 h. Wound tracks were marked, and relative migration distances were calculated using Image Pro Plus software (Media Cybernetics, Silver Spring, MD, USA).

2.15. Statistical analyses

All experiments were independently repeated at least three times. Results are presented as the mean ± standard deviation (SD). A normality test was applied, and Student's t-test was used to assess differences between the two groups. Statistical analyses were conducted using GraphPad Prism software (GraphPad Software, San Diego, CA, USA). Differences were considered statistically significant at p < 0.05.

3.1. Effect of conditioned medium on BLCA cells

Prior research has demonstrated the inhibitory effects of melatonin treatment on bladder cancer cell growth (Wu et al. 2021). Here, we sought to investigate whether the secreted components from malignant cells treated with melatonin affect the behavior of recipient cells. To achieve this, melatonin was added to the complete medium of YTS-1 cells for 48 h, followed by an additional 48 h incubation in serum-free medium to ensure melatonin metabolization. Subsequently, the medium was collected and centrifuged to remove cell debris, resulting in the conditioned medium.

Normal HCV29 cells were treated with conditioned medium from YTS-1 cells (referred to as YTS-1-CM) and from YTS-1 cells treated with melatonin (referred to as Mel-CM). Flow cytometry analysis revealed decreased apoptosis in HCV29 cells treated with YTS-1-CM but not in HCV29 cells treated with Mel-CM (Fig. 1A, B). Furthermore, when compared to cells treated with the control conditioned medium, cells treated with Mel-CM exhibited a higher proportion of cells arrested at the G1 phase (Fig. 1C, D). We observed that the migration capability of HCV29 cells was enhanced when exposed to the control conditioned medium but slightly inhibited when exposed to Mel-CM, as evidenced by the transwell and wound-healing assays (Fig. 1E–H). Moreover, HCV29 cells treated with Mel-CM showed a lower degree of proliferation than those treated with YTS-1-CM (Fig. 1I). These results demonstrate that the conditioned medium secreted by cancer cells can reduce apoptosis and increase proliferation, migration, and invasion in normal cells. These effects were attenuated when normal cells were treated with Mel-CM.

3.2. Effect of sEV treatment on bladder cells

We investigated the impact of conditioned medium on YTS-1 cells. Melatonin added to the medium was metabolized by the cells within 48 h; therefore, we focused on sEVs that can translocate substances. We extracted sEVs from the two conditioned media: first from YTS-1-CM and second from Mel-CM (referred to as YTS-1-sEVs and Mel-sEVs, respectively). These sEVs were isolated from cell culture conditioned media via differential ultracentrifugation. The isolated vesicles were enriched in endosomal markers (Alix and TSG101) and tetraspanins (CD63), while lacking markers for specific intracellular endoplasmic reticulum molecules (calnexin; Fig. S1A). These two types of sEVs were purified using TEM and NanoSight nanoparticle tracking analysis (Fig. S1B and S1C), demonstrating homogeneity in morphology and modal sizes within the range of 90–120 nm. Furthermore, both types of sEVs were effectively taken up by recipient cells (Fig. S1D).

To validate our hypotheses, the two types of sEVs were administered to HCV29 cells. Compared with the control group, YTS-1-sEV treatment reduced apoptosis, while the number of apoptotic cells increased when exposed to sEVs derived from melatonin-treated cells (Fig. 2A, B). Similarly, YTS-1-sEV-treated HCV29 cells displayed an increase in G2 phase arrest, whereas Mel-sEV-treated HCV29 cells exhibited a decrease in G2 phase arrest (Fig. 2C, D). As measured through the transwell assay, Mel-sEV treatment resulted in a marked reduction in cell migration (Fig. 2E, F). In the wound-healing assay, the migration ability of HCV29 cells was enhanced upon treatment with YTS-1-sEVs but inhibited upon treatment with Mel-sEVs (Fig. 2G, H). Lastly, the CCK-8 cell proliferation analysis revealed increased proliferation of HCV29 cells treated with YTS-1-sEVs but reduced proliferation of HCV29 cells treated with Mel-sEVs (Fig. 2I). These findings underscore the distinct functions of sEVs extracted from YTS-1-CM and Mel-CM in recipient cells.

3.3. CTNND1 regulates EMT in BLCA cells

We investigated the influence of the EMT pathway, a critical regulator of cell migration, and observed significant alterations in the expression of key markers. Specifically, the expression of N-cadherin, a mesenchymal marker, increased in HCV29 cells treated with YTS-1-sEVs but decreased in those treated with Mel-sEVs. The epithelial marker E-cadherin displayed an opposing pattern of expression. Notably, sEV treatment elicited downstream signaling changes in recipient cells (Fig. 3A–C).

Using a TMT-based quantitative proteomics approach, 400 proteins were identified in melatonin-treated and non-treated YTS-1 cell derived sEVs (Fig. 3G). Subsequently, we identified several proteins that were either upregulated or downregulated in melatonin-treated YTS-1 sEVs (Fig. 3E). The protein CTNND1, which is associated with cell migration, was analyzed in the following order according to p-value. In parallel, we subjected these proteins to gene ontology (GO) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses (Fig. 3D, F). KEGG pathway analysis identified enriched pathways related to cell adhesion: cell-cell adhesion, focal adhesion, and cadherin binding. GO analysis underscored the significance of the adherens junction, focal adhesion, regulation of the actin cytoskeleton, and tight junctions in cell migration and invasion. Proteomic analysis revealed that CTNND1 expression was higher in YTS-1 than in HCV29 cells (Fig. 3H). The expression of CTNND1 slightly increased in YTS-1 cells treated with melatonin (Fig. 3I). Similarly, we compared the expression of CTNND1 in the two types of sEVs. The expression of CTNND1 in Mel-sEVs was lower than that in YTS-1-sEVs (Fig. 3J). Compared with that in the control group, the expression of CTNND1 clearly increased in HCV29 cells treated with YTS-1-sEVs and slightly increased in HCV29 cells treated with Mel-sEVs (Fig. 3K). Collectively, these findings suggest that CTNND1 expression is increased in bladder cancer cells compared to that in normal bladder cells and that it can be transmitted through sEVs to recipient cells.

3.4. Silencing CTNND1 reduces cell growth and migration

To better understand the mechanisms of action of CTNND1, we silenced its expression in YTS-1 cells using shRNA (Fig. 4A). Flow cytometry analysis revealed an increase in apoptosis of CTNND1-silenced YTS-1 cells (Fig. 4B, B) and a reduction in cell cycle arrest at the G2 phase (Fig. 4D, E). Moreover, silencing CTNND1 markedly reduced the migration capacity of YTS-1 cells in the transwell assay (Fig. 4F, G). To further evaluate the impact of CTNND1 on cell migration, we conducted a wound-healing assay (Fig. 4H, I). The proliferation of sh-CTNND1 YTS-1 cells clearly decreased compared to that in the control (Fig. 4J).

3.5. Overexpressing CTNND1 promotes cell growth and migration

We further overexpressed CTNND1 in HCV29 cells to clarify its function (Fig. 5A). CTNND1-overexpressing cells exhibited reduced apoptosis (Fig. 5B, F) and a higher proportion of cells arrested in the G2 and S phases (Fig. 5C, G) compared with the control cells. Furthermore, CTNND1-overexpressing cells showed a greater degree of migration in the transwell assay (Fig. 5D, H). In the wound-healing assay, CTNND1-overexpressing cells exhibited faster closure of the wound area than control cells, suggesting higher migration (Fig. 5E, I). CTNND1 overexpression in YTS-1 cells also resulted in a significant increase in cell proliferation (Fig. 5J). These findings suggest that CTNND1 promotes the migration of HCV29 cells.

Melatonin is a natural, hydrophilic, and lipophilic tryptophan-derived indole compound, which can cross the cell membrane and exert various biological functions in different tissues and cell types (Opie and Lecour 2016). Its influence on cancer development, progression, and metastasis has been documented across multiple types of tumor cells. Specifically, melatonin reduces the cellular levels of O-GlcNAc, thereby inhibiting the proliferation and migration of bladder cancer cells (Wu et al. 2021). In this study, melatonin inhibited the expression of CTNND1, which suppressed the proliferation and migration of bladder cancer cells.

Migration and dissemination are pivotal for bladder cancer cells to spread from adjacent tissues and establish new tumors at distant sites. Several studies have reported elevated CTNND1 expression in tumors compared to that in normal tissues, supporting its putative role as an oncogene implicated in cancer development (Tang et al. 2016; Zeng et al. 2009; Zhang et al. 2015). For instance, in hepatocellular carcinoma, CTNND1 promotes tumor formation and metastasis by facilitating cell proliferation, migration, and invasion [13]. Increased CTNND1 expression alters the cell cycle and survival gene profile, which may drive tumor progression in human prostate cancer (Zeng et al. 2009). Moreover, CTNND1 mRNA and protein levels are significantly upregulated in colorectal cancer; this upregulation is associated with poorer prognosis (Zhang et al. 2015). The upregulation of p120ctn in pancreatic cancer cells is significantly correlated with a more malignant phenotype (Mayerle et al. 2003). Additionally, the interaction of CTNND1 with its specific partner, Kaiso, has been shown to regulate downstream effectors and enhance cancer metastasis through the Wnt signaling pathway (Tang et al. 2016). In this study, we detected elevated levels of CTNND1 in bladder cancer cell lines and demonstrated that CTNND1 overexpression promoted EMT, migration, and proliferation of bladder cancer cells. Conversely, silencing CTNND1 reversed these effects.

Since Paget's “seed-and-soil” hypothesis was first proposed, several studies have demonstrated that tumor-derived sEVs play a pivotal role in establishing a conducive microenvironment at future metastatic sites. These sEVs can carry proteins, mRNA, miRNAs, long non-coding RNAs, and other biologically active substances that are transported to the recipient cell and regulate its behavior. For example, the loss of PRKD1 increases the release of sEVs, promoting pancreatic tumor metastasis to the lungs in murine models (Armacki et al. 2020). Nerve growth factor receptor (NGFR) is secreted by melanoma-derived sEVs and induces lymphangiogenesis and metastasis (Garcia-Silva et al. 2021). Furthermore, the exosome-associated GKN1 protein suppresses the migration and invasion of gastric cancer cells by inhibiting EMT (Yoon et al. 2020). Although numerous studies have explored the relationship between sEVs and various types of cancer, few studies have been conducted on bladder cancer. In this study, we demonstrated that the transfer of biomolecular cargo driven by sEVs can effectively promote a favorable microenvironment for cancer growth in tumor and normal cells.

Overall, we showed that sEVs secreted by bladder cancer cells promote proliferation, migration, and EMT of normal bladder cells. This effect was inhibited by the sEVs secreted by melatonin-treated bladder cancer cells. This promotes the formation of pre-metastatic niches in distant organs. Additionally, we uncovered the underlying mechanism by which CTNND1, carried by exosomes, regulates bladder cancer cell proliferation and metastasis. Importantly, inhibiting CTNND1 expression reversed these effects, suggesting the potential clinical significance of regulating CTNND1 levels as a therapeutic option for bladder cancer. The downside is that our study is more of a phenotypic elaboration, and more in-depth studies of the mechanisms are needed subsequently.

Data availability

The data of this study are available from the corresponding author upon reasonable request.

Funding

This work was supported by Science Foundation for Distinguished Young Scholars of Shaanxi Province [grant number 2021JC-39], the Natural Science Foundation of Shaanxi Province [grant number 2021SF-294], and the Youth Innovation Team of Shaanxi Universities.

Author information

Authors and Affiliations

Key Laboratory of Resource Biology and Biotechnology in Western China, Ministry of Education, College of Life Sciences, Northwest University, Xi'an, China

Jinhua Cao, Jinpeng Wu, Ning Fan, Miaomiao Ge, Yurong Lu

Contributions

Yurong Lu: Conceptualization. Jinhua Cao: Investigation, Data curation, Formal analysis, Writing–Original draft preparation. Jinpeng Wu: Supervision. Miaomiao Ge and Ning Fan: Investigation.

All authors have read and approved the final manuscript.

Acknowledgements

We thank Dr Sen-itiroh Hakomori (The Biomembrane Institute, Seattle, WA, USA) for giving human normal bladder mucosal epithelial cell line HCV29 and highly malignant invasive bladder cancer cell line YTS-1.

Declaration of Interest Statement

All authors disclosed no relevant relationships.

Corresponding author

Correspondence to Yurong Lu.

Ethics declarations

Conflict of interest

The authors have no potential conflicts of interest to disclose.

Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F (2021) Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin 71(3):209–49. https://doi.org/10.3322/caac.21660
Clark PE, Agarwal N, Biagioli MC, Eisenberger MA, Greenberg RE, Herr HW, et al (2013) Bladder cancer. J Natl Compr Canc Netw 11(4):446–75. https://doi.org/10.6004/jnccn.2013.0059
Xin Z, Jiang S, Jiang P, Yan X, Fan C, Di S, et al (2015) Melatonin as a treatment for gastrointestinal cancer: a review. J Pineal Res 58(4):375–87. https://doi.org/10.1111/jpi.12227
Gil-Martin E, Egea J, Reiter RJ, Romero A (2019) The emergence of melatonin in oncology: Focus on colorectal cancer. Med Res Rev 39(6):2239–85. https://doi.org/10.1002/med.21582
Kong X, Gao R, Wang Z, Wang X, Fang Y, Gao J, et al (2020) Melatonin: A Potential Therapeutic Option for Breast Cancer. Trends Endocrinol Metab 31(11):859–71. https://doi.org/10.1016/j.tem.2020.08.001
Tian QX, Zhang ZH, Ye QL, Xu S, Hong Q, Xing WY, et al (2021) Melatonin Inhibits Migration and Invasion in LPS-Stimulated and -Unstimulated Prostate Cancer Cells Through Blocking Multiple EMT-Relative Pathways. J Inflamm Res 14:2253–65. https://doi.org/10.2147/JIR.S305450
Chen K, Zhu P, Chen W, Luo K, Shi XJ, Zhai W (2021) Melatonin inhibits proliferation, migration, and invasion by inducing ROS-mediated apoptosis via suppression of the PI3K/Akt/mTOR signaling pathway in gallbladder cancer cells. Aging (Albany NY) 13(18):22502–15. https://doi.org/10.18632/aging.203561
Lamouille S, Xu J, Derynck R (2014) Molecular mechanisms of epithelial-mesenchymal transition. Nat Rev Mol Cell Biol 15(3):178–96. https://doi.org/10.1038/nrm3758
Pastushenko I, Brisebarre A, Sifrim A, Fioramonti M, Revenco T, Boumahdi S, et al (2018) Identification of the tumour transition states occurring during EMT. Nature 556(7702):463–8. https://doi.org/10.1038/s41586-018-0040-3
Yang M, Li S, Huang L, Zhao R, Dai E, Jiang X, et al (2022) CTNND1 variants cause familial exudative vitreoretinopathy through the Wnt/cadherin axis. JCI Insight 7(14). https://doi.org/10.1172/jci.insight.158428
Liu Y, Wang Y, Zhang Y, Miao Y, Zhao Y, Zhang PX, et al (2009) Abnormal expression of p120-catenin, E-cadherin, and small GTPases is significantly associated with malignant phenotype of human lung cancer. Lung Cancer 63(3):375–82. https://doi.org/10.1016/j.lungcan.2008.12.012
Xing AY, Wang YW, Su ZX, Shi DB, Wang B, Gao P (2015) Catenin-delta1, negatively regulated by miR-145, promotes tumour aggressiveness in gastric cancer. J Pathol 236(1):53–64. https://doi.org/10.1002/path.4495
Tang B, Tang F, Wang Z, Qi G, Liang X, Li B, et al (2016) Overexpression of CTNND1 in hepatocellular carcinoma promotes carcinous characters through activation of Wnt/beta-catenin signaling. J Exp Clin Cancer Res 35(1):82. https://doi.org/10.1186/s13046-016-0344-9
Bellovin DI, Bates RC, Muzikansky A, Rimm DL, Mercurio AM (2005) Altered localization of p120 catenin during epithelial to mesenchymal transition of colon carcinoma is prognostic for aggressive disease. Cancer Res 65(23):10938–45. https://doi.org/10.1158/0008-5472.CAN-05-1947
Lin Q, Fang X, Liang G, Luo Q, Cen Y, Shi Y, et al (2021) Silencing CTNND1 Mediates Triple-Negative Breast Cancer Bone Metastasis via Upregulating CXCR4/CXCL12 Axis and Neutrophils Infiltration in Bone. Cancers 13(22):5703. https://doi.org/10.3390/cancers13225703
Kalluri R, LeBleu VS (2020) The biology, function, and biomedical applications of exosomes. Science 367(6478). https://doi.org/10.1038/s41586-021-04234-3
Garcia-Martin R, Wang G, Brandao BB, Zanotto TM, Shah S, Kumar Patel S, et al (2022) MicroRNA sequence codes for small extracellular vesicle release and cellular retention. Nature 601(7893):446–51. https://doi.org/10.1038/s41586-021-04234-3
Raposo G, Stoorvogel W (2013) Extracellular vesicles: exosomes, microvesicles, and friends. J Cell Biol 200(4):373–83. https://doi.org/10.1083/jcb.201211138
Mashouri L, Yousefi H, Aref AR, Ahadi AM, Molaei F, Alahari SK (2019) Exosomes: composition, biogenesis, and mechanisms in cancer metastasis and drug resistance. Mol Cancer 18(1):75. https://doi.org/10.1186/s12943-019-0991-5
Riches A, Campbell E, Borger E, Powis S (2014) Regulation of exosome release from mammary epithelial and breast cancer cells - a new regulatory pathway. Eur J Cancer 50(5):1025–34. https://doi.org/10.1016/j.ejca.2013.12.019
Kahlert C, Kalluri R (2013) Exosomes in tumor microenvironment influence cancer progression and metastasis. J Mol Med (Berl) 91(4):431–7. https://doi.org/10.1007/s00109-013-1020-6
Steinbichler TB, Dudas J, Riechelmann H, Skvortsova (2017) The role of exosomes in cancer metastasis. Semin Cancer Biol 44:170 – 81. https://doi.org/10.1016/j.semcancer.2017.02.006
Zhao S, Mi Y, Guan B, Zheng B, Wei P, Gu Y, et al (2020) Tumor-derived exosomal miR-934 induces macrophage M2 polarization to promote liver metastasis of colorectal cancer. J Hematol Oncol 13(1):156. https://doi.org/10.1186/s13045-020-00991-2
Raposo G, Nijman HW, Stoorvogel W, Liejendekker R, Harding CV, Melief CJ, et al (1996) B lymphocytes secrete antigen-presenting vesicles. J Exp Med 183(3):1161–72. https://doi.org/10.1084/jem.183.3.1161
Lu Z, Zuo B, Jing R, Gao X, Rao Q, Liu Z, et al (2017) Dendritic cell-derived exosomes elicit tumor regression in autochthonous hepatocellular carcinoma mouse models. J Hepatol 67(4):739–48. https://doi.org/10.1016/j.jhep.2017.05.019
Tan Z, Cao L, Wu Y, Wang B, Song Z, Yang J, et al (2020) Bisecting GlcNAc modification diminishes the pro-metastatic functions of small extracellular vesicles from breast cancer cells. J Extracell Vesicles 10(1): e12005. https://doi.org/10.1002/jev2.12005https://doi.org/10.1002/jev2.12005
Wu J, Tan Z, Li H, Lin M, Jiang Y, Liang L, et al (2021) Melatonin reduces proliferation and promotes apoptosis of bladder cancer cells by suppressing O-GlcNAcylation of cyclin-dependent-like kinase 5. J Pineal Res 71(3): e12765. https://doi.org/10.1111/jpi.12765
Opie LH, Lecour S (2016) Melatonin has multiorgan effects. Eur Heart J Cardiovasc Pharmacother 2(4):258–65. https://doi.org/10.1093/ehjcvp/pvv037
Zeng Y, Abdallah A, Lu JP, Wang T, Chen YH, Terrian DM, et al (2009) delta-Catenin promotes prostate cancer cell growth and progression by altering cell cycle and survival gene profiles. Mol Cancer 8:19. https://doi.org/10.1186/1476-4598-8-19
Zhang H, Dai SD, Liu SL, Zhang FY, Dai CL (2015) Overexpression of delta-catenin is associated with a malignant phenotype and poor prognosis in colorectal cancer. Mol Med Rep 12(3):4259–65. https://doi.org/10.3892/mmr.2015.3918
Mayerle J, Friess H, Buchler MW, Schnekenburger J, Weiss FU, Zimmer KP, et al (2003) Up-regulation, nuclear import, and tumor growth stimulation of the adhesion protein p120 in pancreatic cancer. Gastroenterology 124(4):949–60. https://doi.org/10.1053/gast.2003.50142
Armacki M, Polaschek S, Waldenmaier M, Morawe M, Ruhland C, Schmid R, et al (2020) Protein Kinase D1, Reduced in Human Pancreatic Tumors, Increases Secretion of Small Extracellular Vesicles From Cancer Cells That Promote Metastasis to Lung in Mice. Gastroenterology 159(3):1019-35 e22. https://doi.org/10.1053/j.gastro.2020.05.052
Garcia-Silva S, Benito-Martin A, Nogues L, Hernandez-Barranco A, Mazariegos MS, Santos V, et al (2021) Melanoma-derived small extracellular vesicles induce lymphangiogenesis and metastasis through an NGFR-dependent mechanism. Nat Cancer 2(12):1387–405. https://doi.org/10.1038/s43018-021-00272-y
Yoon JH, Ashktorab H, Smoot DT, Nam SW, Hur H, Park WS (2020) Uptake and tumor-suppressive pathways of exosome-associated GKN1 protein in gastric epithelial cells. Gastric Cancer 23(5):848–62. https://doi.org/10.1007/s10120-020-01068-2

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Melatonin inhibits small extracellular vesicle delivery and CTNND1 reduces the migration ability of bladder cancer cells

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials and Methods

2.1. Cell lines and cell culture

2.2. sEV isolation

2.3. Transmission electron microscopy (TEM)

2.4. Nanoparticle tracking analysis

2.5. Cellular sEV uptake

2.6. Total protein extraction

2.7. Western blotting

2.8. CTNND1 knockdown

2.9. CTNND1 overexpression

2.10. Cell apoptosis

2.11. Cell cycle detection

2.12. Cell proliferation assay

2.13. Transwell assay

2.14. Wound-healing assay

2.15. Statistical analyses

3. Results

3.1. Effect of conditioned medium on BLCA cells

3.2. Effect of sEV treatment on bladder cells

3.3. CTNND1 regulates EMT in BLCA cells

3.4. Silencing CTNND1 reduces cell growth and migration

3.5. Overexpressing CTNND1 promotes cell growth and migration

4. Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1