Tissue samples
30 cases of tissue samples were collected from the breast cancer patients in the Affiliated People’s Hospital of Guangzhou Medical University, including 8 cases of tissue adjacent to carcinoma, 10 cases of non-lymph node metastasis carcinoma tissue, 12 cases of lymph node metastasis carcinoma tissue, and informed consent was obtained from all patients. The pathological diagnosis was made independently by two pathologists. None of the patients had undergone chemotherapy or radiotherapy. The study was approved by the Human Research Ethics Committee of the Affiliated People’s Hospital of Guangzhou Medical University.
Cell lines and cell culture
Human breast cancer cell lines (MCF-7, MDA-MB-231) were obtained from the American Type Culture Collection (ATCC, USA), and were cultured in DMEM F12 culture medium containing 20% foetal bovine serum(FBS, SIGMA-ALDRICH ) for MCF-7 and 10% for MDA-MB-231 supplemented with 100 U/ml penicillin sodium and 100 µg/ml streptomycin sulphate (Sigma-Aldrich). These cell lines were incubated in the humidified incubator with the atmosphere of 37 °C containing 5% CO2.
Quantitative RT-PCR
Cells were collected, and total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. Reverse transcription (RT) was conducted using Prime Script RT Master Mix (Takara, Dalian, China) to synthesize cDNA. Q-RTPCR was performed with SYBR Green PCR Master Mix (Takara, Dalian, China) on an ABI 7900HT (PE Applied Biosystems) qPCR machine. For relative quantification, target gene mRNA expression was normalized to β-actin expression. The 2 − ΔΔCt method was applied to analyse the data, and each experiment was performed in triplicate.The primers sequence used wereCEP192Forward (5′-TCCCTCGACTCACACTCTTCT‐3′),CEP192 Reverse (5′‐TTTGGTGAGGACACTCTGCC‐3′), GAPDH Forward (5′‐CATCATCCCTGCCTCTACTG‐3′), GAPDH Reverse (5′-GCCTGCTTCACCACCTTC ‐3′), β-actin Forward (5'- AGGCCAACCGCGAGAAGATG‐3′),Reverse(5′‐CACACGGAGTACTTGCGCTCAG-3' )
RNA interference
CEP192 siRNA sequences and the si-GFP sequence were designed by RIBOBIO (Guangzhou, China) and used to transfect cells using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. The target sequences of CEP192 siRNA used weresiCEP192(1) (5′-AAGGAAGACATTTTCATCTCT‐3′), siCEP192(2) (5′-CCAGGAGCCTATAGATGAA-3′).
Western blot
RIPA buffer (Beyotime, China) was used to extract the protein following the appropriate steps. BCA Protein Assay Kit (Beyotime, China) was used to measure the concentration of extracted protein.Cells were collected and lysed with RIPA buffer. Proteins were quantified using a bicinchoninic acid assay (Thermo Scientific), resolved by SDS-PAGE, and transferred onto PVDF membranes (Millipore, Billerica, USA). Antibody detection was conducted using an enhanced chemiluminescent substrate kit (Yeasen). Antibodies against CEP192 (Bioss, 1:1000, China), E-cadherin (Abcam, 1:500, Cambridgeshire, UK), KRT-8 (Abcam, 1:1000, Cambridgeshire, UK) were used to the related protein level. β-actin (1:1000, Abcam, UK) and GAPDH (1:2500, Abcam, UK) were used for normalization.
Cell invasion and migration assays
Boyden chamber invasion assay was used to detect the invasiveness of MDA-MB-231 cell. Transfected MDA-MB-231 cells were digested and resuspended in serum-free DMEM, and were placed at the top of the Matrigel-coated chambers (BD Biosciences, USA). The culture medium with 10% fetal bovine serum was used as the chemical attractant and added to the lower chamber. After 24 h, the fixed invasive cells were stained with crystal violet, counted and photographed. Boyden chamber migration experiment repeated the invasion procedure, but the Matrigel was not applied.
Immunohistochemistry (IHC)
IHC was performed using 4-µm-thick sections of representative formalin-fixed tissue blocks. Briefly, the slides were dewaxed in xylene, passed through graded alcohols, and placed into 0.01 mol/L phosphate-buffered saline (PBS; pH = 7.4). The slides were then pretreated with 1.0 mM citrate, pH 6.0 (Invitrogen), in a steam pressure cooker for epitope retrieval and were washed in PBS. Next, they were incubated with 3% hydrogen peroxide for 15 min to block endogenous peroxidase activity and were subsequently incubated with a monoclonal rabbit anti–human CCL18 antibody (Biodragon, 1:125, China), CEP192(BIOSS 1: 250, China) at 4 °C overnight. On the following day, the slides were washed with PBS and incubated with an anti-rabbit secondary antibody (Dako) for 60 min at room temperature. After being washed in PBS, the slides were stained with DAB+ (Dako) and then counterstained for 1 min with Harris hematoxylin (BASO), differentiated in 1% hydrochloric acid in alcohol, dehydrated, and mounted. All PT and LNM specimens were stained using the same protocol.