1 Ethics statement
All protocols of the animal experiments were in accordance with the guidelines approved by the laboratory animal welfare and ethics committee of Army Medical University and the ethical regulation of the university.
2 Strains, plasmids and media
The strains, plasmids and primers used in the present study are listed in Table 1. Lysogeny Broth (LB) is used for routine culture of bacteria. To monitor the growth of Salmonella strains in iron deficiency environment, 2, 2-bipyridine was added to the Ty2 minimal medium (TMM) with a final concentration of 180 µM [28]. When needed, antibiotics were added at concentrations of 100 µg/ml of ampicillin or 50 µg/ml of kanamycin.
Table 1
Strains, plasmids and primers used in this study
Strains, plasmids and primers | Description and sequences | Sources |
S. Typhi | | |
Ty2 | Wild-type | Laboratory collection |
ΔyncD | yncD-deletion mutant of Ty2 | (16) |
Complementary strain | yncD-deletion mutant carrying PBR322-yncD plasmid | (16) |
ΔcirAΔiroNΔfepA | cirA-iroN-fepA-deletion mutant of Ty2 | This study |
Escherichia coli | | |
DH5α | Cloning strain | Laboratory collection |
BL21 | Expression strain | Laboratory collection |
Plasmids | | |
pET28a-yncD | Expression vector of YncD | This study |
Primers | | |
STcirAk1 | 5`-aaaagtgcacgccggtctttgctttttgac-3′ | For amplification of up-stream sequence of cirA |
STcirAk2 | 5`-gttataaatttggagtgtgaaggttattgcgtgtccatttctccatgaggtaa-3′ |
STcirAk3 | 5`-cacgcaataaccttcacactccaaatttataaccagagactggcgacagccgcgtttt-3′ | For amplification of down-stream sequence of cirA |
STcirAk4 | 5`-aaaaagatctttaccattaaagatcgtccc-3′ |
STiroNk1 | 5`-aaaagtgcacgtcgggttatcctgtcttat-3′ | For amplification of down-stream sequence of iroN |
STiroNk2 | 5`-gttataaatttggagtgtgaaggttattgcgtgtgggttatgcccgccgct-3′ |
STiroNk3 | 5`-cacgcaataaccttcacactccaaatttataactccctaaataatgtctaaag-3′ | For amplification of down-stream sequence of iroN |
STiroNk4 | 5`-ccccagatctaagtggatagagttaaaagg-3′ |
STfepAk1 | 5`-aaaagtgcactccatacgcggcgggagtta-3′ | For amplification of down-stream sequence of fepA |
STfepAk2 | 5`-gttataaatttggagtgtgaaggttattgcgtgtgtatatcctgcttttcttt-3′ |
STfepAk3 | 5`-cacgcaataaccttcacactccaaatttataactggcaaccttccctccctcatt-3′ | For amplification of down-stream sequence of fepA |
STfepAk4 | 5`-aaaaagatcttatcggggtattgcgctaag-3′ |
YncDK1 | 5′- gtcgcggatccgaattc gccagcgcgcccaatgaacaaa − 3′ | For cloning of the yncD gene |
YncDK2 | 5′- cagtggtggtggtggtggtg ttcaaattgccatgccagatt − 3′ |
2 Construction of the trigenic mutant Δ cirA Δ iroN Δ fepA
IroN, FepA and CirA mediate the transportation of Salmonella catecholate siderophores and play an important role in the iron-uptake of Salmonella cells. Therefore, a trigenic mutant of ΔcirAΔiroNΔfepA was constructed as a control strain to assess the function of YncD. Homologous recombination assay was used to construct the mutant from the parent S. Typhi Ty2 as previously described [8, 29]. Deletions of cirA, iroN and fepA were performed one by one.
3 Growth curve
To monitor bacterial growth, fresh overnight cultures of the test strains were inoculated into LB liquid, grown at 37°C with shaking for 6 h. Bacteria were harvested, washed thrice and resuspended in sterile ultrapure water. The optical density of suspensions was determined using spectrophotometer. Approximately 5.0×106 CFU of bacterial cells were inoculated in 100 ml of various media, grown at 37°C with shaking for at least 72 h. Samples were taken at an interval of 1 h or 4 h to monitor OD600.
4 Intracellular multiplication
Intracellular multiplication experiments were carried out as described previously [29, 30]. THP-1 cells were passaged in RPMI-1640 medium containing 10% of fetal bovine serum. Approximately 5 × 105 cells were added in each well of 12-well plates, and were activated with the addition of 100 nM of phorbol myristate acetate. Bacteria were inoculated into the 12-well plates at a concentration of 5 × 106 CFU/well. The plates were kept at 37°C for 2.5 h. After washing thrice with PBS, 100 µg/ml of gentamycin was added to eliminate extracellular bacteria. After washing with PBS, fresh medium was added into each well, and continued culture. Following incubation for various times, cells were gently washed thrice with PBS. One milliliter of ice-cold deionized water was added in each well to lyses cells. The lysates were serially diluted, spread on LB agar and incubated at 37°C overnight to enumerate intracellular bacteria.
5 Construction of recombinant YncD expression vector
The yncD gene was amplified from the genomic DNA of S. Typhi using Polymerase Chain Reaction (PCR) with primers YncDK1 and YncDK2. The amplified yncD gene was cloned into the expression plasmid of pET28a using ClonExpress™ Multis Kit (Vazyme Biotech Co., Ltd, Nanjing). The positive clones with kanamycin resistance were identified by PCR, and then sent to BGI for sequencing analysis. The recombinant vector was named pET28a-yncD.
6 Expression and purification of rYncD
Expression of rYncD in BL21/pET28a-yncD was induced in the presence of 0.5 mM of IPTG. Bacteria were harvested and resuspended in 30 ml of Buffer A (50 mM Tris, 300 mM NaCl, 0.1% Triton X-100, 0.2 mM PMSF, pH 8.0). Bacterial suspension was subjected to ultrasonication (500 W, 60 repeats, last for 10 s, interval 10 s). The ultrasonic lysate was centrifugated at 12000 rpm for 15 min. Precipitate was dissolved in 10 ml of Buffer B (7 M Gua-HCl, 50 mM Tris, 300 mM NaCl, 0.1% Triton X-100, pH 8.0), and kept at 4°C overnight. Supernatant was collected after centrifugation at 12000 rpm for 15 min.
The recombinant protein was first purified with Ni-NTA affinity chromatography assay. Fractional elution samples were analyzed using SDS-PAGE. The fractions containing rYncD with high purity were collected, and dialyzed in Buffer C (50 mM Tris, 4 M urea, pH 8.0). The sample was further purified with anion exchange column Q Sefinose FF. The rYncD was washed with Washing Buffers (4 M Urea, 50 mM Tris, 50/100/200 mM NaCl, pH 8.0), and eluted with Elution Buffer (4 M Urea, 50 mM Tris, 500 mM NaCl, pH 8.0). The fractions were dialyzed in Buffer D (50 mM Tris, 300 mM NaCl, 0.1% SKL, 10% Glycerol, pH 8.0), and preserved at -20°C. The purified rYncD was examined using SDS-PAGE and Western blot with anti-His (Sangon Biotech (Shanghai) Co., Ltd.) as primary antibody. LPS contamination was assessed using Limulus amebocyte lysate test kit (Solarbio (Beijing) Co., Ltd.).
7 Immunization and challenge
Six-week-old BALB/c female mice (10 each group) were subcutaneously inoculated with 50 µg of rYncD, which was emulsified in complete Freund's adjuvant. The control group animals were inoculated with PBS. On days 15 and 28, the mice were re-immunized with rYncD or PBS. On day 42, the mice were challenged intraperitoneally with bacterial suspension of S. Typhi Ty2 strain containing 6% of porcine gastric mucin at doses of 1.0×103 CFU, 1.0×104 CFU, 1.0×105 CFU, respectively. Death was recorded for 72 h after challenge.
8 Bacterial burdens in the organs of the infected mice
BALB/c female mice were vaccinated as described above. On day 42, mice were challenged intraperitoneally with bacterial suspension of S. Typhi Ty2 strain at doses of 2.5 × 104 CFU, 2.5 × 105 CFU and 2.5 × 106 CFU in the absence of hog gastric mucin. Mice were euthanized by CO2 overdose on day 7 post-inoculation. The livers and spleens were aseptically removed, homogenized and spread on LB agar to enumerate living bacteria.
9 Determination of antibody levels
Blood samples were collected from tail vein of mice on days 14 and 42 after vaccination. Enzyme linked immunosorbent assay was used to determine specific anti-YncD IgG as well as subtypes IgG1 and IgG2a in the serum samples.
10 Serum bactericidal assay
Serum samples from the mice vaccinated with rYncD and the mice that received mock vaccination were mixed separately, and inactivated at 65°C for 1 h. Fresh culture of S. Typhi Ty2 was collected and resuspended in PBS to achieve a final concentration of 2 × 108 CFU/ml. Fifty microliters of bacterial suspensions were combined with equal volume of the heat-inactivated sera supplemented with 25% guinea pig complement. The resulting mixtures were incubated at 37°C for different durations (30 min, 60 min, and 90 min). To halt bacterial lysis, the mixtures were placed on ice. The samples were diluted serially in PBS, and plated on LB agar to quantify the survival bacteria. The percentage of lysis was determined using the following formula: (1 - CFU of the rYncD-vaccinated serum group/CFU of the mock-vaccinated serum group) × 100.
11 Passive immune protection rate
Passive immune protection rate was determined as described elsewhere [31]. Six-week-old BALB/c female mice (10 each group) received intravenous immunization with 100 µL of the sera obtained from either the rYncD-immunized mice or the mock-immunized mice (control group). After 24 hours of immunization, the test mice were intraperitoneally inoculated with either 1.0×103 CFU or 1.0×104 CFU of S. Typhi Ty2 suspended in 6% of porcine gastric mucin. The mice were monitored for 72 h after challenge, any deaths were recorded.
12 Opsonophagocytic assay
THP-1 cells were passaged and activated as described above. The cells were harvested, and resuspended in Hanks balanced salt solution (HBSS). A 50 µL aliquot of bacteria (approximately 109 CFU/ml) was combined with 20 µL of pooled immunized sera (or unimmunized sera as control) and incubated at 37°C for 30 min. Opsonized bacteria were washed, and resuspended in 1 ml of HBSS. A 50 µL aliquot of the bacterial suspension was combined with 500 µL of THP-1 cells and 450 µL of HBSS. The mixture was incubated at 37°Cfor 30 min. After incubation, the cells were washed and resuspended in HBSS supplemented with 250 µg/ml of gentamicin. A further 10-min-incubation was performed to eliminate nonphagocytosed bacteria. The cells were washed again and resuspended in HBSS. To lyse the cells, a 50 µL aliquot of the bacterial suspension was added to 950 µL of ice-cold deionized water. The lysates were then serially diluted and inoculated on LB agar to enumerate bacteria.
13 Statistical Analysis
Statistical analysis was performed using the following methods. Group means was compared using the Student’s unpaired t-test. Fisher’s exact test was used to determine survival rates. Complement-mediated serum killing rates were assessed with an Independent-sample t-test. A p-value of less than 0.05 was considered statistically significant.