Cell culture
A549, NCI-H460, HCC827, PC-9, NCI-H358 and NCI-H1299 cells were obtained from Cell Bank, Chinese Academy of Sciences. HBE cells were generously provided by Professor Tianyu Han at Nanchang University, Nanchang, China. HEK-293T cells were maintained within our laboratory. All cell lines were cultured in high-glucose DMEM (Cat#C11995500BT, Gibco, Massachusetts, USA) supplemented with 10% fetal bovine serum (FBS) (Cat#04-001-1ACS, Biological Industries, Kibbutz Beit-Haemek, Israel) and maintained at 37°C under a 5% CO2 atmosphere.
Vector construction
The full-length DNA sequence of BRD4 was amplified from pcDNA5-Flag-BRD4-WT (Cat#90331 Addgene, Massachusetts, USA) and subsequently cloned into the pSSH plasmid44, resulting in the generation of the HA-tagged BRD4 expression vector, termed HA-BRD4. FBXO28 was amplified from cDNAs reverse-transcribed from HEK-293T mRNA and then cloned into either the pSSH plasmid or the Myc-pcDNA3.1 plasmid, producing HA-FBXO28 or Myc-FBXO28, respectively. Truncated versions of BRD4 and FBXO28 were generated using the Q5® Site-Directed Mutagenesis Kit (Cat#E0554, New England Biolab, Massachusetts, USA).
siRNAs and transfection
We designed specific small interfering RNAs (siRNAs) targeting human BRD4 and FBXO28 based on previously validated oligonucleotides2 and had them synthesized by GenePharma (Shanghai, China). For siRNA transfection, Lipofectamine RNAiMAX (Cat#13778150, Invitrogen, California, USA) was used following the manufacturer's instructions. SiRNA transfections were conducted using either individual siRNA oligonucleotides or a pooled combination. Plasmid transfections were carried out using PEI as the transfection reagent (Cat#23966, Polysciences, Pennsylvania, USA). The siRNAs used in the study are listed as follows:
siFBXO28-1: AGCUCCGCCUGGUUUGUAATT,
siFBXO28-2: UCAACGAGCUCAUGAAGUAUU,
siFBXO28-3: GUGGAGAGGUACCAUAAUCTT
siBRD4-1: AAACCGAGAUCAUGAUAGUTT
siBRD4-2: CUACACGACUACUGUGACATT
Cell proliferation assays
Cells were initially seeded in a 24-well plate and allowed to incubate for 24 hours. After this period, the culture medium was replaced with 300 µL of fresh medium and incubated for an additional 2 hours. Subsequently, 30 µL of CCK-8 solution (Cat#K1018, Apexbio, Texas, USA) was added to each well, and the cells were cultured for 1 hour. From each 24-well plate, 110 µL of the medium was transferred to a 96-well plate, and the absorbance at 450 nm was measured using a multi-mode microplate reader (Synergy HTX, BioTek Instruments, Vermont, USA). Each assay was performed in triplicate.
Colony formation assay
Cancer cells were seeded in 6-well plates at a density of 1000 cells per well, and the culture medium was changed every 3–4 days. After 14 days of culture, the cells were washed twice with 1×PBS. Cells were fixed with 1 mL of methanol for 30 minutes and then washed with ddH2O. Subsequently, the cells were stained with 1 mL of crystal violet solution for 30 minutes. Following staining, the cells were rinsed with 1×PBS and then photographed under a microscope. The cancer cells were plated into 6-well plates with 1000 cells per well and the medium was changed every 3–4 days. After 14 days of culture, the cells were washed with 1×PBS twice, fixed with 1 mL methanol for 30 minutes, washed with ddH2O and stained with 1 mL of crystal violet solution for 30 minutes. Then the cells were rinsed with 1×PBS and then photographed under microscope.
Transwell assays
Migratory ability was evaluated using transwell assay. Briefly, 200 µL of cells re-suspended in FBS-free medium with a density of 5×105 cells/mL were added into the insert chamber (Cat#353097, Falcon, New York, USA) putting into the well of 24-well plate with 500 µL complete medium. After the incubation of 16–24 hours, the cells in the upper membrane of the insert chamber were removed with cotton swab. Then the cells filtered to the bottom membrane were fixed with methanol, stained with crystal violet and photographed under microscope. The invasion assay was performed the same as migration assay instead that the insert was added with matrigel with a dilution of 1:8 (Cat#356234, BD Biosciences, California, USA) for 4 hours before the cells were plated.
Apoptosis and cell cycle assay
Apoptosis was detected using Annexin V-FITC/PI Apoptosis Detection Kit (Cat#KGA107, KeyGENEBioTECH, Nanjing, China) according to the manufacturer’s protocol. Briefly, cells were trypsinized and re-suspended in binding buffer. Then the cells re-suspension were added separately with Annexin V-FITC and PI solution and incubated in the dark for 30 min. The apoptosis rate was evaluated using flow cytometer (FACSCalibur, BD Biosciences, California, USA). The cell cycle assay was detected using PI staining and subsequently analysized using flow cytometer (FACSCalibur, BD, Biosciences, California, USA).
Quantitative real-time PCR (qRT-PCR)
Total RNA was extracted from cells using TRIzol Reagent (Cat#15596-026, Invitrogen, California, USA), followed by reverse transcription using a cDNA reverse transcription kit (Cat#RR047, Takara, Otsu, Japan). Subsequently, qRT-PCR was conducted using SYBR green PCR master mix (Cat#RR820, Takara, Otsu, Japan). GAPDH was used as an internal control for normalization. Finally, the relative expression of target genes was determined using the 2−ΔΔCT. The primers used for qRT-PCR in this study were listed in table S3.
Western blot
Cells were lysed in RIPA lysis buffer (50 mM Tris–HCl, 150 mM NaCl, 5 mM EDTA, 0.5% Nonidet P-40) supplemented with 1% Protease Inhibitor Cocktail Set I (Cat#539131, Calbiochem, Darmstadt, Germany) and 1% phosphatase Inhibitor Cocktail (Cat#HY-K0022, MedChemExpress, New Jersey, USA). Total protein lysates were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto a polyvinylidene difluoride (PVDF) membrane (Cat#IPVH00010, Millipore, Massachusetts, USA). Then the membranes were incubated with primary antibodies at 4°C and horseradish peroxidase (HRP)-conjugated secondary antibodies at room temperature for one hour. After wash with 1×PBST intensively, the signals were detected by chemiluminescence using a Tanon Chemiluminescent Imaging System (Cat#5200, Tanon, Shanghai, China). The antibodies used in this study were listed in Table S4.
Immunofluorescence (IF)
Cells seeded in Glass Bottom Culture Dishes (Cat#801001, Nest, Wuxi, China) for 24 hours were washed with 1×PBS for 3 times, fixed with 500 µL 4% paraformaldehyde at room temperature for 30 minutes. After washing with 1×PBS, the cells were permeabilize for 10 min with 0.1% Triton X-100 (Cat#ST795, Beyotime, Shanghai, China). Subsequently, the cells were blocked with normal goat serum (Cat#ZLI-9056, ZSGB-BIO, Beijing, China), incubated with primary antibody and stained with FITC conjugated secondary antibody. After washed with 1×PBS for 3 times, the cells were added with DAPI to stain the nuclear (Cat#AR1176, BOSTER, Wuhan, China). Then the cells were sealed with Antifade Mounting Medium (Cat#P0126, Beyotime, Shanghai, China) andobserved under a Confocal Laser Microscope (Cat#FV1200, Olympus, Tokyo, Japan) to collect images.
Chromatin immunoprecipitation(ChIP)
ChIP was performed as previously described45. Briefly, cells were crosslinked in 1% formaldehyde solution for 10 min at 37℃. Next, 125 mM glycine (Cat#G8200, Solarbio, Beijing, China) was added for 5 min at room temperature, followed by washing the cells with ice-cold PBS 2 times and soaking in PBS containing 1% protease inhibitors. Then, the cells were collected by Cell Scrapers (Cat#csc011025, Jet Bio-Fil, Guangzhou, China). Cells were pelleted with centrifugation at 1,500 rpm for 10 minutes at 4℃. The cell pellets were resuspended in 100 µL SDS Lysis Buffer containing 1% protease inhibitors and then subjected to sonication (25% amplitude, 7 min total, 5/9-s ON/OFF). After sonication, the debris was removed by centrifuging at 10,000 g for 10 minutes at 4℃. The supernatant was transferred to a new tube and diluted by 10-fold with ChIP dilution buffer. Then, the supernatant was pre-cleared and incubated overnight at 4℃ with rotation with primary antibody and then Protein A/G Magnetic Beads (Cat#88803, Thermo Scientific, MA, USA). Immunocomplexes were washed with low-salt, high-salt, LiCl, and TE buffer. Complexes were incubated with elution buffer (0.1 M NaHCO3 and 1% SDS) at room temperature for 15 minutes with rotation. After centrifugation at 2000 rpm for 2 minutes at room temperature, the supernatant was transferred to new fresh tube. The elution step was repeated, and then uncrosslinking complexes (20 µL 5 M NaCl, 20 µL pH8.0 Tris-HCL, 10 µL 0.5 M EDTA, 2 µL 10 mg/mL Proteinase K) were added to 500 µL of supernatant to reverse the crosslinks at 65℃ for 3 hours. Finally, DNA was purified using Phenol-Chloroform-Isoamyl-Alcohol (Cat#P1012, Solarbio, Beijing, China) and resuspended in nuclease-free water, followed by analysis using qRT-PCR. The primers used were listed in table S3.
RNA-seq
RNA sequence was performed by Annoroad Gene Technology Company (Beijing, China). Breafly, total RNA was extracted from A549 and H460 cells using TRIzol Reagent (Cat#15596-026, Invitrogen, California, USA). The RNA purity was measured spectrophotometrically using the NanoPhotometer (IMPLEN, California, USA). The RNA concentration and integrity were evaluated with an Agilent 2100 Bioanalyzer (Agilent Technologies, California, USA) and Qubit®3.0 Flurometer (Life Technologies, California, USA). Sequencing libraries were generated using NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (Cat#E7530L, NEB, Massachusetts, USA) following the manufacturer’s recommendations and index codes were added to attribute sequences to each sample. After cluster generation, the libraries were sequenced on an Illumina platform and 150 bp paired-end reads were generated. The reference genomes and the annotation file were downloaded from ENSEMBL database (http://www.ensembl.org/index.html). Bowtie2 v2.2.3 was used for building the genome index, and Clean Data was then aligned to the reference genome using HISAT2 v2.1.0. Differential expression analysis was implemented using DEGseq v1.18.0.
Immunohistochemistry
NSCLC tissue microarray (Cat#HLugA180Su11, Shanghai Outdo Biotech co.,LTD, Shanghai, China) were deparaffinized, rehydrated and subjected to antigen retrieval. Following incubation with anti-FBXO28 antibodies (Cat#A67982, Epigentek, New York, USA) at 4°C overnight, the slices were successively incubated with secondary antibody and streptavidin–horseradish peroxidase complex. Diaminobenzidine (Cat#DA1010, Solarbio, Beijing, China) was used as a chromogen, and the nuclei were counterstained with hematoxylin.
Tumor xenografts
Male nude mice aged 4 to 6 weeks were obtained from Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences (Shanghai, China) and prepared for tumor implantation. A total of 5×106 A549 cells stably silencing FBXO28 or negative control were resuspended in 200 µL of PBS and injected subcutaneously into the flanks of the nude mice (n = 6 in each group). The volume of the tumor was measured every two days, and on day 23, the primary tumor was carefully removed and imaged.