Tissue samples
Thirty-seven pregnant women with FGR and thirty seven healthy pregnant women enrolled in this study were the same as the participants in our previous study [7]. Their detailed characteristics have been reported in our previous study. Placental tissues were collected in RNA later (Sangon Biotech, Shanghai, China) after delivery and frozen in liquid nitrogen. This study was approved by the Ethics Committee of the Shenzhen Maternity and Child Health Hospital. All patients provided the written informed consent.
RNA isolation and quantitative real-time PCR (RT-PCR) assay
Total RNA from tissue samples or cells was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and quantified using the NanoDrop ND-1000. Reverse transcription (RT) was performed to obtain cDNA using ImProm-IITM Reverse Transcription System (Promega, Madison, WI, USA). Random primers were used as the RT primer for detecting circRNA. The RT primer for detecting miRNAs was a special stem-loop primer based on the principle of the stem loop method. Quantitative RT-PCR analysis was performed using SYBR GREEN qPCR Super Mix (Promega,USA). GAPDH was used as an internal control for circRNAs and mRNA. U6 was used as an internal control for miRNA. All assays were performed in three independent experiments. The data were calculated using the 2−ΔΔCt method to represent the relative expression level of RNAs. The primers used in qRT–PCR are shown below. The forward and reverse primer sequences for hsa_circ_0081343 were AACGAGAACAAGTTTGCTGTG and AGTCGATGCCAGTCATTCTC respectively. The forward and reverse primer sequences for GAPDH were GGGAAACTGTGGCGTGAT and GAGTGGGTGTCGCTGTTGA respectively. The forward primers for miR-210-5p, miR-545-3p, and miR-597-3p were ACACTCCAGCTGGGAGCCCCTGCCCACCGCACAC, ACACTCCAGCTGGGTCAGCAAACATTTATTGTG, and ACACTCCAGCTGGGTGGTTCTCTTGTGGCTCA respectively. The universal reverse primer for all the miRNAs was CTCAACTGGTGTCGTGGA. The forward and reverse primer sequences for U6 (RNA, U6 small nuclear 1) CTCGCTTCGGCAGCACA and AACGCTTCACGAATTTGCGT respectively.
Cell culture and transfection
HTR-8/SVneo cells, purchased from the American Type Culture Collection (Manssas, VA, USA) and cultured in RPMI1640 (Gibco, Carlsbad, CA, USA) supplemented with 10 % fetal bovine serum (Gibco), 1 % penicillin/ streptomycin, and 1 % L-glutamine at 37 °C in a humidified incubator with 5 % CO2. The full length of hsa_circ_0081343 (position: chr7:98985662-98985884; spliced length: 223 nt) was cloned into the pLCD5H-ciR plasmid (Guangzhou Geneseed Biotech Co.,Ltd, China) by DNA synthesis in vitro to construct the hsa_circ_0081343 overexpression vector (ov-circ_0081343). Empty pLCD5H-ciR plasmid was used as a negative control (NC). Two small interfering RNAs (siRNA) targeting hsa_circ_0081343 and named siRNA-1 (sense sequence: GGAGAAUGACUGGCAUCGATT) and siRNA-2 (sense sequence: GACUGGCAUCGACUGGGCCTT) were designed to include splice junctions to avoid degrading linear mRNA which is later processec into circRNA. The sense sequence of the negative control siRNA (si-NC) was UUCUCCGAACGUGUCACGUTT. The negative control miRNA (miR-NC, UCACAACCUCCUAGAAAGAGUAGA), miR-210-5p mimics (AGCCCCUGCCCACCGCACACUG), miR-210-5p inhibitor (CAGUGUGCGGUGGGCAGGGGCU), and miR-NC inhibitor (UCUACUCUUUCUAGGAGGUUGUGA) were synthesized by GenePharma Co (Shanghai, China).
HTR-8 cells were seeded in six-well plates and transfected using Lipofectamine 2000 Reagent (Invitrogen) according to the manufacturer’s protocol. To investigate the effect of hsa_circ_0081343, HTR-8 cells were divided into four groups: si-NC group transfected with si-NC; si-circ_0081343 group transfected with siRNA-2; NC group transfected with empty pLCD5H-ciR plasmid; and ov-circ_0081343 group transfected with ov-circ_0081343. To investigate whether miR-210-5p overexpression alleviates the effect of hsa_circ_0081343 overexpression, HTR-8 was divided into three groups and transfected with the following scheme: ov-circ_0081343+ miR-NC, ov-circ_0081343+ miR-210-5p, and NC+ miR-NC.
Transwell assay and flow cytometry analysis
After 24 h of transfection, the Transwell assays were performed to examine the migration and invasion capabilities of the indicated groups using the same method as described in our previous study [7]. The migrated or invaded cells at the bottom of the filter membrane were photographed using a light microscope (Nikon, Tokyo, Japan) at 200X magnification. The cell number was counted in each photograph of five randomly selected fields and the average was used as the number of cells migrated or invaded per field. Each experiment was repeated three times.
After 24 h of transfection, cells were analyzed for apoptosis using flow cytometry. The cell staining was performed using an Annexin V-FITC/PI Apoptosis Detection Kit (KeyGEN Biotech, Nanjing, China) and apoptosis levels were analyzed by flow cytometry using the same method as described previously [7].
Western blot analysis
The concentrations of total proteins extracted using RIPA strong buffer (Beyotime, Shanghai, China) were quantified with Bio-Rad Protein Assay Kit (Bio-Rad Laboratories, Hercules, CA, USA). Western blot analysis was carried out using the same method as described in our previous study [7]. The primary antibodies of MMP2, MMP9, caspase 3, and caspase 9 were the same as those used in our previous study [7]. In addition, anti-DLX3 antibody (1:800, ab64953) was also used.
Dual luciferase activity assay
The fragments of wild type linear hsa_circ_0081343 and DLX3 3’ untranslated regions (UTR) were amplified and cloned into the dual-luciferase miRNA target expression vector GP-mirGLO (Promega, Madison, WI, USA) and named as wild type circ_0081343 and wild type 3’ UTR respectively. The binding sequence of miR-210-5p on wild type circ_0081343 and wild type 3’ UTR plasmids were mutated by site-directed mutagenesis using one-step overlap extension PCR, and named as mutant circ_0081343 and mutant 3’UTR respectively. HTR-8 cells were plated on 24-well plates and co-transfected with 100 ng of indicated recombinant plasmids, and 50 nM of miR-210-5p mimic or miR-NC. After 48 h of transfection, firefly and Renilla luciferase activities were measured using the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer’s instructions. Three independent experiments were performed.
Anti-AGO2 RNA immunoprecipitation (RIP) assay
RIP were carried out according to the instructions of Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore, Bedford, MA, USA). Briefly, approximately 1× 107 cells were harvested post transfection with miR-210-5p mimic or miR-NC. Cell pellets were lysed in polysome lysis buffer supplemented with protease inhibitor cocktail and RNase inhibitor. Partial cell lysate (20 μL), termed as input, was collected for use as a positive control. Subsequently, 100 µL cell lysates were incubated with magnetic bead IgG or Ago2 antibody complex at 4 °C overnight. Next day, the complex was washed according to the manufacturer’s instructions. RNA was extracted and purified. The level of hsa_circ_0081343 in purified RNA was detected by qRT-PCR.
Statistical analysis
Statistical analyses were performed using the SPSS 18.0 software and GraphPad Prism version 7.0. Data are expressed as mean ± standard deviation based on three independent experiments. Differences between two groups were analyzed using unpaired t-tests when the data were normally distributed or non-parametric t-tests when the data were not normally distributed. Differences between more than two groups were analyzed using one-way ANOVA. P values < 0.05 were considered statistically significant.