Cell lines and cell culture
Murine thymic epithelial cell line 1(MTEC1) cell was obtained from Peking University Health Science Center (Beijing, China). Human embryonic kidney 293T (HEK-293T) cell was obtained from the American Type Culture Collection (Manassas, USA). Both MTEC1 and HEK-293T cells were cultured in complete Dulbecco's Modified Eagle Medium (DMEM) (Gibco, Grand Island, USA) containing 10% fetal bovine serum (FBS) (Gibco) in a humidified atmosphere containing 5% CO2 at 37°C.
Hormone treatment
Hormone treatment in MTEC1 cells was performed according to a previously described method[32]. Briefly, MTEC1 cells were seeded in a 6-well plate and cultured in a DMEM growth medium containing 10% FBS. Once the confluence of MTEC1 cells reached 70%~80%, the cells were starved for 24 h by replacing the growth medium with DMEM containing only 2%(v/v) FBS. Subsequently, the cells were then treated with different concentrations(1 nmol/L, 10 nmol/L, 25 nmol/L, 50 nmol/L) of 17β-Estradiol (E2, Sigma, St Louis, MO) in DMEM with 2% (v/v) FBS for a different time(6 h, 12 h, 24 h, 48 h). Cells that were treated with only ethanol in the same growth medium served as a control group. All the experiments were done in triplicate.
High-throughput sequencing
Cells from the treatment and control group were collected at 24 h and used for small RNA sequencing experiments. Total Ribonucleic acid (RNA) was extracted from each pool, corresponding to the six sample groups, treatment group, and control samples. These six samples were labeled E2-1, E2-2, E2-3, C-1, C-2, and C-3. For the six transcriptome library constructions, the RNA preparation, library construction, and single-end sequencing (36 bp) were performed on an Illumina Hiseq2500 at the LC-BIO (Hangzhou, China) following the vendor`s recommended protocol. Differential miRNA expression based on normalized deep-sequencing counts was analyzed using the Fisher exact test and Student t-test based on the design of the experiment. The significance threshold was set to be 0.01 and 0.05 in each test.
RNA oligonucleotides and cell transfection
The miR-16-5p mimic, mimic NC, miR-16-5p inhibitor, inhibitor NC, RNA-Igfbp3(siIgfbp3) or RNA-NC(siRNA-NC) were designed and synthesized by RiboBio Co., Ltd (Guangzhou, China). Sequences of miR-16-5p mimic(catalog number: miR10000527-1-5), inhibitor (catalog number: miR20000527-1-5), siIgfbp3-001 (catalog number: siG2012210538377126), siIgfbp3-002 (catalog number: siG2012210538378218) and siIgfbp3-003(catalog number: siG2012210538379310) are shown in Table 1. But mimic-NC (catalog number: miR1N0000001-1-5), inhibitor-NC (catalog number: miR2N0000001-1-5), and siIgfbp3 NCs (catalog number: siN0000001-1-5) were confidentiality designed by RiboBio. To study gene function in the cellular environment, transfection studies were done one day before transfection, MTEC1 or HEK-293T cells were plated in the appropriate culture dish. When the plated cells reached approximately 60%~70% confluence, the oligonucleotides [50 nmol/Lmimic or mimic-NC, and 100 nmol/L inhibitors or inhibitor-NC], RNA-Igfbp3(siIgfbp3), or siRNA-NC were transfected into cultured cells using Lipofectamine 3000 reagent (Invitrogen, Carlsbad, USA) according to the manufacturer’s instruction.
Table 1
Sequence of miRNA oligonucleotides used in the study
Name | Sequence (5′-3′) | Type |
miR-16-5p mimic | UAGCAGCACGUAAAUAUUGGCG | Double-stranded RNA |
miR-16-5p inhibitor | CGCCAAUAUUUACGUGCUGCUA | Double-stranded RNA |
siIgfbp3-001 | GCTACAAAGTTGACTATGA | Double stranded RNA |
siIgfbp3-002 | GCTACAAAGTTGACTATGA | Double stranded RNA |
siIgfbp3-003 | GCTACAAAGTTGACTATGA | Double stranded RNA |
Quantitative polymerase chain reaction (qPCR)
Total RNAs were extracted from MTEC1 cells using TRIZOL (Takara, Kusatsu, Japan). Complementary Deoxyribonucleic acid (cDNA) was synthesized using the ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan) following the manufacturer’s instructions. qPCR was performed with SYBR Green real-time PCR Master Mix (Toyobo). For measuring the expression of miRNAs in MTEC1 cells, the bulge-loop miRNA qRT-PCR Primer Sets (including one reverse transcription primer and a pair of quantitative PCR primers) specific for miR-16-5p and miR-22-3p were confidentiality designed by RiboBio (Guangzhou, China). As shown in Table 2, the relative gene primers for messenger RNA (mRNA) were designed by the Primer Premier 5.0 software according to the published genome sequences. β-actin and U6 were used to normalize the relative abundance of mRNA and miRNA, respectively. Bio-Rad CFX96 Real-Time PCR system (Bio-Rad, Hercules, USA) was used to perform qPCR analysis. The relative expression level of each gene was calculated from three different experiments and was determined using the 2−ΔΔCT method. All experiments were repeated at least three times.
Table 2
Primer sequences are used for a reverse transcription-quantitative polymerase chain reaction.
Gene | Accession No. | Primer sequence (5′-3′) | Size (bp) |
Igf1 | NM_ 017313812.3 | F: TTGTGGATGAGTGTTGCTT | 165 |
| | R: GCTTCGTTTTCTTGTTTGTC | |
Igfbp3 | NM_ 011243665.3 | F: AGTGACCGATTCCAAGTTC | 185 |
| | R: GTGTGTCCTCCATTTCTCTG | |
Ctgf | NM_ 010217.2 | F: TCATCAAGACCTGTGCCT | 118 |
| | R: TTCGTGTCCCTTACTTCCT | |
Dusp3 | NM_ 028207.3 | F: GTGAGGCAGAATCGTGAG | 100 |
| | R: CCTAGAGTTTCACCTTGCC |
CCND1 | 001379248.1 | F: AGGCGGATGAGAACAAGCAGAC | 175 |
| | R: CGGTAGCAGGAGAGGAAGTTG | |
CCNE1 | NM_ 007633.2 | F: GCGTCTAAGCCCTCTGACCATTG | 191 |
| | R: CAGAAGCAGCGAGGACACCATAAG | |
Rarg | NM_ 006520650.1 | F: GATGGCTTCTCTCTCGGTGG | 153 |
| | R: TCACAGGAGCTGACCCCATA | |
Kmt2a | NM_036154819.1 | F: GGCCCTGTTGAATTCTCGGA | 110 |
| | R: GGGAGCTTCGGGAAGGTATG | |
Rapgef2 | NM_ 030252869.2 | F: TGCGAGAGAGCCAAATCTCC | 97 |
| | R: GGCTCAATGTTGCGGAAGAG | |
Trim35 | NM_ 029979.3 | F: GAGTGTGAGGAGGGTGAG | 147 |
| | R: GCAGATACGCAGAGGTTC | |
β-actin | NM_007393 | F: CATCCGTAAAGACCTCTATGCCAACC | 171 |
| | R: ATGGAGCCACCGATCCACA | |
Western blot analysis
To obtain total proteins, cultured MTEC1 cells were lysed in Radio immunoprecipitation assay (RIPA) buffer [50 mMTris-HCl, pH 8.0, 250 mM NaCl, 1% NP40, 0.5% (w/v) sodium deoxycholate, and 0.1% sodium dodecylsulfate] (Beyotime, Nanjing, China) supplemented with protease and phosphatase inhibitor mixture(Sigma-Aldrich) and vortexed briefly. After centrifugation at 15,000 g for 15 min at 4°C, the protein sample was collected and the concentration was determined using the BCA kit (Beyotime). Sample buffer was used to dilute the lysates, once the proteins (20 µg) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and then transferred to polyvinylidene fluoride membranes (PVDF) (Millipore, Billerica, USA). After blocking with skimmed milk, the blots were incubated overnight at 4°C with mouse monoclonal antibodies, including anti-CCND1, anti-Igfbp3, and anti-GAPDH monoclonal antibodies. All these antibodies used were obtained from Santa Cruz Biotech (Santa Cruz, USA). The membranes were then washed and incubated with horseradish peroxidase-conjugated goat anti-mouse secondary antibodies (Santa Cruz) at 37°C for 90 min and then developed with BeyoECL Plus kit (Beyotime).
Cell viability assay
MTEC1 cells were seeded in a 96-well plate at a density of 2 ~ 5×103 cells per well and transfected with miR-16-5p mimic, miR-16-5p inhibitor, or miR-NC. Cell viability was analyzed at the indicated time points (24 h, 48 h, and 72 h) using the cell-counting kit-8 (CCK-8) regents (Beyotime) according to the manufacturer's instructions.
Cell cycle assay
MTEC1 cells were cultured in DMEM with 10% FBS at 48 h after transfection and then fixed with 70% ethanol overnight at − 20°C for 24 h. The cell cycle assay was determined using the Cell Cycle Analysis Kit (Beyotime) with a flow cytometer (BD Biosciences, San Jose, USA) and data was analyzed with Flow J (version 10) software.
Cell apoptosis assay
At 48 h after transfection, the cell apoptosis rate was quantified by gating propidium iodide and Annexin V-positive cells on a fluorescence-activated cell-sorting flow cytometer (BD Biosciences) according to the instructions of the Apoptosis and Necrosis Assay Kit (Kaiji, Nanjing, China).
5-ethynyl-20-deoxyuridine (EdU) assays
MTEC1 cells seeded in 24-well plates were cultured to 50% density and then transfected. 48 h after transfection with mimics, inhibitors, or siRNAs. The cells were then fixed in 4% polyformaldehyde (PFA) at room temperature for 1 h. Subsequently, the cells were incubated with 0.5% Triton X-100 for 15 min. Finally, cells were stained by Cell-Light™EdU Cell Proliferation Detection Assay (RiboBio, Guangzhou, China) according to the operating instructions. The ratio of proliferative cells was calculated by the ratio of EdU-positive cells to Hoechst-positive cells[33]. The assay was performed in three biological replicates.
Determination of Target Gene
Bioinformatics prediction software [miRBase (http://www.mirbase.org/), TargetScan (http://www.targetscan.org/), and PicTar (http://pictar.mdc-berlin.de/)] were used to select candidate targets of miR-16-5p. Combined with the data on mRNA expression analyses from our previously published microarray data[32]. The potential targets that involved in cell proliferation, including CCND1, CCNE1, Insulin growth factor-I (Igf1) (5.00E-05), Insulin-like growth factor-binding protein 3 (Igfbp3) (5.00E-05), Retinoic acid receptor gamma (Rarg) (2.90E-03), Lysine (K)-specific methyltransferase 2A (Kmt2a) (3.95E-02), Tripartite motif-containing 35(Trim35) (6.50E-04), Rap guanine nucleotide exchange factor (GEF) (Rapgef2) (8.00E-04), Ctgf(5.00E-05), and dual-specificity phosphatase 3 (Dusp3) (5.00E-05) were chosen as valid targets of miR-16-5p due to their expression levels was significantly downregulated as compared with the expression miR-16-5p in the 50 nmol/L E2 treated MTEC1 cells.
Plasmids construction
For the pmirGLO dual-luciferase miRNA target reporter vector, the 3′-untranslated regions (3′-UTRs) of CCND1 and Igfbp3 contained putative target sites of miR-16-5p were amplified by PCR from genomic DNA. The PCR products were then cloned between Sac Ⅰ and Sal Ⅰ sites of the luciferase reporter vector pmiRGLO (Promega, Madison, USA). The primer sequences of the CCND1 3′-UTR (NCBI reference sequence: NM_007631.2) (positions 1731 ~ 1737 bp and 1808 ~ 1814 bp) were as follows: forward, 5′-CGAGCTCGCCTTTCTATTAGGACTT-3′, and reverse, 5′-GCGTCGACAGCATGACAGGACGAT-3′, and the primer sequences of the Igfbp3 3′-UTR (NCBI reference sequence: XM_011243665.3) (positions 360 ~ 366 bp) were as follows: forward, 5′-CGAGCTCAAAAGACTGCCAACAAC-3′ and reverse 5′-GCGTCGACCACAGTTCCCAAGTAGAT-3′. The mutant (MUT) CCND1 and Igfbp3 3′-UTR plasmids were generated using the QuickChange® Mutagenesis kit (Stratagene) according to the manufacturer’s specifications. Both seed sequences for CCND1 were mutated from ‘GCUGCUA’ to ‘AUUUCGC’, and the seed sequences for Igfbp3 were mutated from ‘UGCUGCU’ to ‘ACGUCGU’ respectively.
Dual-luciferase reporter assay
The pmiRGLO-CCND1-3′UTR (WT/MUT) and pmiRGLO-Igfbp3-3′UTR (WT/MUT) plasmid (400 ng) with miR-16-5p mimic or mimic-NC were co-transfected into HEK-293T cells using Lipofectamine 3000 (Invitrogen) as per the manufacturer’s recommendation. The dual-luciferase activity was analyzed at 48 h after transfection using the Dual-luciferase Reporter Assay System (Promega, Madison, USA) as per the manufacturer's instructions. Luciferase activity was calculated as the ratio of Firefly to Renilla and each experiment was performed in triplicate.
Statistical analysis
All experiments were performed in triplicate and repeated at least three times. All data were represented as the mean ± SD. The statistical analysis was performed by using Student's t-test to determine the significant differences using commercial software (SPSS 17; SPSS, Chicago, USA). A value of p < 0.05 was deemed statistically significant.