Animals
A total of 48 one-day-old healthy broilers were caged for 21 days and warmed with electrical heaters. Feed and water, in addition to experimental diets mentioned below, were offered ad libitum. Experiments relating to use of broilers and all procedures concerning animals were approved by the Animal Care and Use Committee, Sichuan Agricultural University. The diet used was a basal diet containing corn and soybean designed by the National Research Council [16].
All experiments with animals were carried out in accordance with guidelines recommended by the Animal Care and Use Committee, Sichuan Agricultural University
Chemicals
Superoxide dismutase (SOD), catalase (CAT), glutathione (GSH), and glutathione peroxidase (GSH-Px) were purchased from Nanjing Jiancheng Bioengineering Institute of China (Nanjing, China). PE Annexin V Apoptosis Detection Kit (BD Biosciences, USA). Anti-proliferating cell nuclear antigen (PCNA) (1:100) antibody (Boster, Wuhan, China)
TF preparation
Preparation of TFs followed the method proposed by Wang et al. [17], with some modifications. Briefly speaking, frozen cattle spleens underwent mechanical crashing, centrifugation, filtration and ultrafiltration in succession, to then prepare non-specific TFs, followed by quality examination. All laboratory experiments conformed to China Biologicals Regulations. Concentration of polypeptides was detected as 2 mg/ml through conducting biuret reactions [19].
Experimental design
Four groups were formed by the 48 one-day-old healthy broilers (N = 12). Table 1 lists the treatment schedule and the treatment time is showed in Fig. 1. After 7 days of acclimatization, all the broilers were inoculated the ND vaccine. Group I is the control group, which didn’t treat with TF. Some 0.2 ml TFs were added in groups II, III and IV by oral, intramuscular injection and subcutaneous injection, respectively. Samples were collected at days 14 and 21 during experiments.
Table 1
Treatment for the different groups
Design | Incubation | TF administration method | Dose per chicken |
Group I | Vaccine | | |
Group II | Vaccine + TF | Oral administration | 0.2 ml |
Group III | Vaccine + TF | Intramuscular injection | 0.2 ml |
Group IV | Vaccine + TF | Subcutaneous injection | 0.2 ml |
Table 2
Primer sequences of genes selected for analysis by qRT-PCR
Target gene | Accession number | Primer | Primer sequence (5′-3′) | Product size | Tm (°C) |
IL-2 | AF000631 | Forward | TCTGGGACCACTGTATGCTCT | 138 bp | 60 |
| | Reverse | ACACCAGTGGGAAACAGTATCA | | |
IL-6 | AJ309540 | Forward | AATCCCTCCTCGCCAATCTG | 106 bp | 60 |
| | Reverse | GCCCTCACGGTCTTCTCCATA | | |
IL-8 | HM179639 | Forward | CTGGCCCTCCTCCTGGTT | 105 bp | 60 |
| | Reverse | GCAGCTCATTCCCCATCTTTAC | | |
IL-10 | AJ621614 | Forward | CGGGAGCTGAGGTGAA | 192 bp | 55 |
| | Reverse | GTGAAGAAGCGGTGACAGC | | |
INF-γ | Y07922 | Forward | AGCTGACGGTGGACCTATTATT | 157 bp | 58 |
| | Reverse | GGCTTTGCGCTGGATTC | | |
TNF-a | NM204267 | Forward | CCCCTACCCTGTCCCACAA | 100 bp | 58 |
| | Reverse | TGAGTACTGCGGAGGGTTCAT | | |
β-actin | L08165 | Forward | TGCTGTGTTCCCATCTATCG | 178 bp | 62 |
| | Reverse | TTGGTGACAATACCGTGTTCA | | |
Serum antioxidant parameters detection
At 14 and 21 days, the e blood samples were taken from retro-ocular artery. The serum was obtained by blood centrifugation (3,500 × g, 15 min). The serum SOD, CAT, GSH-Px activity and GSH contents were detected by biochemical methods according to the instructions of the reagent kits.
Serum antibody assay
At days 14 and 21 during experiments, serum samples were collected from six broilers from each group. The ND antibody titer was determined using a hemagglutination inhibition test.
Apoptosis evaluation based on flow cytometry
At days 14 and 21 during the experiment, we selected six broilers from each group to determine apoptosis in the spleen, thymus, and bursa of Fabricius through use of flow cytometry. The method description can refer to Guo et al. [18]. A cell suspension was formed by grinding samples of the spleen, thymus, and bursa of Fabricius and then filtered using nylon screens (350 mesh). After being washing twice with cold phosphate buffer solution (PBS; pH 7.2–7.4), the cells were then allowed to suspend in PBS to reach a final concentration of 1 × 106 cells/mL. After being transferred to 5 mL culture tubes, cell suspension (100 µL) was stained by 7-aminoactinomycin (7-AAD) and PE Annexin V. The mixture experienced gentle vibration and incubation for 15 min in dark place. Thereafter, each tube was added with 1 × binding buffer (400 µL). Finally, the BD FACS Calibur flow cytometer was used to analyze rates of hepatic apoptosis.
Evaluation of proliferation by PCNA immunohistochemistry
In each group, six broilers were sacrificed humanely to perform gross examination at days 14 and 21 during the experiment. After being taken and fixed in 10% neutral buffered formalin, the spleen, thymus, and bursa of Fabricius were treated and trimmed, followed by paraffin embedding.
Description of the method can refer to Guo et al. [18]. Briefly, slices underwent xylene dewaxing, rehydration by a graded series of ethanol, washing with distilled water and PBS, and blocking for endogenous peroxidases through 15 min of incubation using 3% H2O2 in methanol. Antigen retrieval procedure was then undertaken on the slices via microwave processing in the sodium citrate buffer (0.01 M, pH 6.0). Before being incubated again at 37 °C in 10% normal goat serum for 30 min, the slices were washed again with PBS. Incubation of the slices lasted overnight at 4 °C with the anti-PCNA (1:100) antibody (Boster, Wuhan, China). The slices washed with PBS were allowed to expose to 1% biotinylated secondary antibody goat anti-mouse IgG (Boster, Wuhan, China) at 37 °C for 1 h, followed by incubation with strept avidin-biotin complex (SABC) (Boster, Wuhan, China) at 37 °C for 30 min. For visualizing immunoreaction, diaminobenzidine hydrochloride (DAB) (Boster, Wuhan, China) was used to immerse the slices. Immediately after a brown color staining was visualized, the slices were observed under a microscope and stopped through immersion in distilled water. The slices were then subjected to light counterstaining by hematoxylin, dehydration by ethanol, xylene clearing and then mounted.
A computer-supported imaging system interfaced with an OlympusAX70 light microscope was used to count the PCNA protein expression. Quantification of integrate optical density (IOD) of each protein was conducted through use of the Image-pro Plus 5.1 (USA) as mentioned above. Five slices were observed in each group, with each slice observed with five visions and results averaged.
Quantitative real-time PCR
At days 14 and 21 during the experiment, six broilers were taken from each group to detect cytokines mRNA expression levels in the spleen, thymus, and bursa of Fabricius by using flow cytometry. Samples of the spleen, thymus, and bursa of Fabricius underwent homogenization and then were stored in liquid nitrogen for RNA extraction. The RNAiso Plus (9109; Takara, China) was used for extracting total RNA of the liver. A Prim-Script™ RT reagent Kit (RR047A; Takara, China) was utilized to synthesize the cDNA following the manufacturer’s instructions. The qRT-PCR analysis was conducted with cDNA as the template. Primer sequences were attained from Genbank and NCBI. Primer 5 was used to design the primers, and primer synthesis was realized at Sangon Biotech (Shanghai, China). The SYBR® Premix Ex Taq™ Ⅱ system (DRR820A, Takara, Japan) was used for qRT-PCR on a Thermal Cycler (C1000, BIO RAD, USA). The 2 − ΔΔCT method was used for analyzing relative expression of target genes [19].