2.1. Gene expression analysis
For analysis of SET and CIP2A expression in gastric cancer samples, data from The Cancer Genome Atlas (TCGA) and the Genotype-Tissue Expression (GTEx) were used and analyzed by the GEPIA database [21]. TCGA RNA-seq data of gastric cancer samples (n = 408) was used for correlation analysis and the correlation coefficient was determined by Spearman method.
2.2. Cell culture and reagents
The eight human gastric cancer cell lines: AGS, BGC-823, HGC-27, MGC-803, MKN-28, MKN-45, N87 and SGC-7901 were acquired from ATCC or the Institute of Biochemistry and Cell Biology, Chinese Academy of Science (Shanghai, China). These cancer cells were routinely cultured in RPMI-1640 medium or DMEM, supplemented with 10% (v/v) of fetal bovine serum (FBS, Gibco, Grand Island, NY, USA) and 1% (v/v) streptomycin-penicillin (Sigma-Aldrich, Shanghai, China). All cells were maintained at 37°C in a 5% CO2 incubator. FTY-720 (SET inhibitor, S5002), DT-061 (PP2A activator, S8774), and 2-Deoxy-D-glucose (2-DG, S4701) was obtained from Selleck (Shanghai, China).
2.3. Cell transfection
Two specific siRNAs against PPP2R5A were used to knockdown PPP2R5A in gastric cancer cells. MycT58A was cloned into pcDNA3.1 for ectopic expression. For siRNA experiment, the siRNAs of PPP2R5A were obtained from Genepharma Biotechnology (Shanghai, China); the antisense sequences were: PPP2R5A-#1: TTAGTTGAAACATACTCAACCA; PPP2R5A-#2: TTTAATTATATTATACTGATGA. Scramble non-target siRNAs were used as negative controls. Cell transfection was performed with 15 µmol siRNAs by Lipofectamine RNAiMAX reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Western blotting was used to determine knockdown efficiency.
2.4. Detection of PP2A activity
The PP2A activity in response to FTY-720, DT061, and PPP2R5A knockdown was detected by PP2A Immunoprecipitation Phosphatase Assay Kit (Millipore, USA) in according to the manufacturer’s protocol. Briefly, gastric cancer cells with indicated treatment were lysated by NP-40 lysis buffer supplemented with protease inhibitor cocktail. Then, cell lysates was mixed with PP2A antibody and protein A slurry. After washing with TBS and assay buffer for three times, phosphopeptide was added and allowed to incubation for 10 min at room temperature. Finally, Malachite green solution was added, followed by absorbance detection at 650 nm.
2.5. Real-time quantitative PCR
Total RNA was extracted from gastric cancer cell lines with RNAiso Plus reagent (Takara, Japan) according to the manufacturers’ instruction and then reverse transcribed with a PrimeScript RT-PCR kit (Takara, Japan). cDNA was amplified by PCR with 10 µl reaction system using SYBR-Green PCR Master Mix in a Fast Real-time PCR 7500 System (Applied Biosystems, USA). All real-time qPCR reactions were completed in triplicate. The primer sequences used in this study were shown as follows: HK2 forward, 5′-TTGACCAGGAGATTGACATGGG-3′, HK2 reverse, 5′-CAACCGCATCAGGACCTCA-3′; PFKL forward, 5′-GCTGGGCGGCACTATCATT-3′, PFKL reverse, 5′-TCAGGTGCGAGTAGGTCCG-3′; LDHA forward, 5′-ATGGCAACTCTAAAGGATCAGC-3′, LDHA reverse, 5′-CCAACCCCAACAACTGTAATCT-3′. GAPDH forward, 5′-CTGGGCTACACTGAGCACC-3′, GAPDH reverse, 5′- AAGTGGTCGTTGAGGGCAATG-3′. GAPDH was served as an internal control.
2.6. Western blotting
Gastric cancer cells with indicated treatment were rinsed with cold PBS before treated with RIPA lysis buffer (50 mM Tris, 0.15 M NaCl, 1 mM EGTA, 1% NP40, 0.25% SDS, pH 7.4) containing protease and phosphatase inhibitors. Cell pellets were incubated for 30 min on ice to homogenize fully and then total proteins in the supernatant of cell lysates were collected by centrifuging at 4°C at 12,000 rpm for 10 min. Total protein concentrations were measured by the BCA protein assay kit (Pierce, USA) before experiment. Then, standard western blotting assays (SDS-PAGE) were used to analyze protein expression. The antibodies used for western blotting analysis in this study included: anti-PPP2R5A (Abcam, ab89621, 1:2,000 dilution), anti-c-Myc antibodies (Cell Signaling Technology, #5605, 1:1,000 dilution), anti-p-c-Myc (S62) antibodies (Cell Signaling Technology, #13748,1:1,000 dilution), anti-β-actin antibody (Sigma, A2228, 1:5,000 dilution). After incubation with corresponding species-specific secondary HRP-conjugated antibodies, the target protein bands were visualized by an ECL imaging system.
2.7. Glucose uptake and lactate production
Glucose and lactate levels in the culture medium were detected using Glucose Assay kit (Biovision, Milpitas, CA, USA) and Lactate Assay kit (Biovision, Milpitas, CA, USA), respectively. In brief, gastric cancer cells were seeded at 5 x 105 cells in 6-cm cell culture dishes and allowed to grow for 24 h with indicated treatment. After 24 h, the culture medium collected and centrifuged at 2,000 rpm for 5 min to obtain the supernatant without cell debris. Finally, glucose and lactate assays were performed according to the manufacturer’s instructions, and colorimetric density was assessed using a Multifunctional microplate reader.
2.8. Plate colony formation assay
Gastric cancer cells with were resuspended and plated in 6-well plates at a density of 500 cells per well and allowed to grow for 10–14 days with indicated treatment. Then the cells were fixed with 4% paraformaldehyde for 15 min at room temperature and stained with 0.5% crystal violet for 15 min. The experiment was performed in triplicate.
2.9. Measurement of c-Myc transcriptional activity
The c-Myc transcription factor assay Kit (Abcam, ab207200) was used to quantify c-Myc activation in nuclear extracts from gastric cancer cells. In brief, HGC-27 and MGC-803 cells were subjected to treatment with 5 µM FTY-720 or 10 µM DT-061 for 24h, followed by detection of c-Myc transcriptional activity in according to the manufacturer’s instructions.
2.10. Statistical analysis
All data were represented as mean ± standard deviation (SD). GraphPad 6.0 (GraphPad Software Inc., San Diego, CA) was used for statistical analysis. The correlation of gene expression was evaluated by Spearman’s correlation. P-values were calculated by two-tailed unpaired Student’s t-test or one-way ANOVA. A value of P < 0.05 was considered to be statistically significant.