2.1 Bacterial strains, plasmids, cell and culture conditions
APEC XM strain was presented by Professor Lu Chengping (Nanjing Agricultural University, College of Veterinary Medicine, China) (Ma et al. 2014), and cloning E. coli strain DH-5α was stocked in our laboratory. APEC XM ΔnirC is a nirC in-frame gene mutant of APEC XM and complementary strain APEC XM ΔnirC/pnirC is an APEC XM ΔnirC carrying pBR322-nirC plasmid. All bacterial strains were grown in Luria-Bertani (LB) broth at 30 ℃ or 37 ℃ according to the request of the experiments. Plasmids pKD3, pKD46, pCP20 used for the λ Red-based recombination are stocked in our laboratory. pBR322 plasmids are used as the expression vector and purchased from Takara (Shiga, Japan).
Mouse brain microvascular endothelial cell bEnd.3 was also presented by Professor Lu Chengping(Hejair et al. 2017), and cultured in Dulbecco’s modified Eagle’s medium (DMEM) with low sugar (HyClone, Logan, USA), supplemented with 12% fetal bovine serum (FBS) (Gibco BRL, AUS). Cells were maintained at 37 ℃ in the incubator with 5% CO2.
2.2 Construction of nirC gene mutant and complemented strain of APEC XM
APEC XM ΔnirC was constructed via λ Red-based recombination system (Datsenko and Wanner 2000) and the primers used are shown in Table 1. P1/P2 and P3/P4 were used to construct APEC XM ΔnirC with pKD3, pKD46, and pCP20, P5/P6 was used to construct the vector pBR322-nirC. The ΔnirC and complemented strain ΔnirC/pnirC of APEC XM were confirmed by polymerase chain reaction (PCR) and DNA sequencing.
Table 1
The sequence of primers for constructing mutant and complemented strain for nirC
primer | sequence (5’→3’) | length of PCR product/bp |
P1 | GTCTTGGGATCATCCTGATTTT | 662 |
P2 | CTTTCGGCGTAGCATACCA |
P3 | TAATTTGCTCGACCCGTCCGTACGTCCTCTGGTGATG GGCGCGACCTTTGTGTGTAGGCTGGAGCTGCT TCG | 1113 |
P4 | CTGATAAAGTATTACCCAGCGTCACCCACAGCAGGT TATGACCAATACCCCATATGAATATCCTCCTTAG |
P5 | CGCGGATCCATGTTTACAGACACTATTACTAAGTGTG | 816 |
P6 | ACGCGTCGACTTAACCGGCAGCCGTTTC |
2.3 Bacterial growth test
To understanding the growth rate of APEC XM wild type (WT), APEC XM ΔnirC, and APEC XM ΔnirC/pnirC, bacterial strains were cultured at 30 ℃ and 37 ℃ in 50 mL LB broth with shaking speed of 200 rpm, respectively. The cell density was estimated by measuring the optical density at 600 nm (OD600) every 1 h until the value of OD600 was stabilized.
2.4 Motility test
The semisolid medium was prepared according to the literature method (Pesavento et al. 2008). The bacterial strains were transferred to fresh LB broth and cultured at 30℃ and 37 ℃ for 200 rpm to OD600 = 1.0, respectively. 0.2 µL bacterium solution (1×108 CFU) was added to semisolid medium and cultured at 30℃ and 37 ℃ for 24 h, the diameter of swimming zone was measured.
2.5 Crystal violet method for quantification of biofilm formation
The biofilm induction solution was prepared(Hossain and Tsuyumu 2006), bacterial strains were cultured at 30℃ and 37 ℃ without shaking for 24 h, respectively, then gently wash off the bacterial solution twice with distilled water and dye 20 min with 1% crystal violet solution. Add 95% ethanol solution to dissolve the crystal violet, and detect the absorbance at 600 nm.
2.6 Bacterial adhesion assay
The methyl thiazolyl tetrazolium (MTT) method was used in the bacterial adhesion assay with a little alteration (de Paiva et al. 2015). The bEnd.3 cells were digested and transferred to a 96-well plate at 100 µL per well. After cells covered the bottom, bacterial solution of WT, ΔnirC, and ΔnirC/pnirC with PBS washing twice was added to the well, respectively, according to the proportion of multiplicity of infection (MOI) = 100:1. Bacteria and cells were co-incubated at 37 ℃ for 1 h and set up a control group without bacterial treatment. Washing off each well twice by PBS and 50 µL of 5 mg/mL MTT (Solarbio, Beijing, China) dissolved by PBS was added to each well and incubated at 37 ℃ in the incubator for 12 h, so that MTT was fully reduced to Formazan by bacteria. The supernatant was gently absorbed the next day, and 50 µL of 2 mg/mL lysozyme dissolved by PBS was added to each well and incubated at 37 ℃ for 10 minutes. Then adding 250 µL dimethyl sulfoxide (DMSO) to each well and detect the absorbance of 490 nm.
2.7 Assays of the red, dry, and rough (rdar) colony morphology using Congo red plate
Bacteria can show different colony phenotypes through the differential expression of Curli and cellulose when growing in Congo red agar plate without salt, and in order to increase the contrast, Coomassie brilliant blue needs to be added. Configuration of congo red (Solarbio, Beijing, China)-coomassie brilliant blue (Solarbio, Beijing, China) salt-free medium (containing 1 g peptone, 0.5 g yeast extract, 4 mg congo red, and 2 mg coomassie brilliant blue G-250, per 100 mL water) (Jain and Chen 2006). After the bacterial strains grew to OD600 = 1, 2.5 µL bacteria solution was added to congo red-coomassie brilliant blue salt-free medium, and the colony morphology was observed after being cultured at 30 ℃ and 37 ℃ for 3 days.
2.8 High-performance liquid chromatography (HPLC)-based detection and quantitation of cellular c-di-GMP
2.8.1 Cellular c-di-GMP extraction
The bacterial strains were cultured at 30 ℃ and 37 ℃, and obtain a bacterial culture volume equivalent to 1 mL of OD600 = 2.5. The bacteria solution was centrifuged at 4 ℃ and 16000 g for 2 min, and the supernatant was discarded, and then wash the cell pellet with 1 mL ice-cold PBS twice. After discarding the supernatant, add 100 µL ice-cold PBS to resuspend and culture at 100 ℃ for 5 min and 186 µL cold anhydrous ethanol was added to the boiling material, whirl for 15 s, then centrifuge at 4 ℃ and 16000 g for 2 min, take the supernatant to a new microcentrifuge tube and store it temporarily at -20 ℃. The precipitate was processed twice, and the supernatant obtained three times was combined and dried in a vacuum concentrator in 45 ℃ for 4 h. The white particles contained c-di-GMP, were stored at -80 ℃. The total protein of the precipitate concentration was measured after ultrasonic fragmentation, and the protein concentration was used for normalization (Petrova and Sauer 2017).
2.8.2 c-di-GMP detection by HPLC
The precipitate containing c-di-GMP (Sigma-Aldrich, St Louis, USA) is dissolved in 1 mL of ultra-pure water and filtered through the 0.45 µm hydrophobic PTFE filter, and the c-di-GMP standard substance is configured with a concentration gradient of 2.5, 5, 10, 20, 40 pmol/mL, which also needs to be filtered. Samples were detected by high performance liquid chromatography (Waters, MA, USA), specific parameters including Reverse-phase C18 column (4.6×250 mm, 5 µm, Elite Ltd, Dalian, China), HPLC solvent (90%: 10 mM ammonium acetate solution, and 10%: 10 mM ammonium acetate methanol solution), column temperature (60 ℃), flow velocity (1 mL/min). Normalize c-di-GMP levels to total cellular protein levels (i.e. pmol/mg) by using the fitted standard curve.
2.9 RNA extraction and real-time quantitative polymerase chain reaction (RT-qPCR)
Bacterial strains were cultured at 30 ℃ and 37 ℃, respectively, until the OD600 = 2.0, i.e. 2×109 CFUs of bacteria. Total RNA was extracted by the TRIzol method as described before (Duan et al. 2013). Concentration and purity of RNA was detected through NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, MA, USA) and agarose gel electrophoresis, respectively. And the cDNA was synthesized via the PrimeScriptRT reagent Kit (Takara, Shiga, Japan) for reverse transcription-PCR. The amplification sequence of primers for RT-qPCR is shown in Table 2. Then the qRT-PCR test is performed according to the SYBRPremix Ex Taq™ Perfect Real Time (Takara, Shiga, Japan) on an Applied Biosystems 7500 Real Time System. The data obtained by qRT-PCR were analyzed by 2−ΔΔCT method(Livak and Schmittgen 2000), and then transformed into log2 to show fold-change differences among each bacterial strains.
Table 2
The sequence of primers for RT-qPCR
gene | forward primer | reverse primer |
gapA | GTTGTCGCTGAAGCAACTGG | ACCGGTAGAAGACGGGATGA |
nirC | TGGTATCGCCTTAACGCTGG | TGTACGCAATGCCATCCAGA |
rpoS | GCTCGAACAGCCATTTGACG | ACGTGGTTTCCGCTTCTCAA |
csrA | GACCCTCATGATTGGGGATGA | GCCTGGATACGCTGGTAGATC |
narP | TCCAGCGATGTCTTTGCACT | CGGACGTTGAGTTTACGCAG |
pgaC | GTGCCGTAACCGGTAATCCT | GAATACTTCTGCACCGCCCT |
bcsA | AGTGTGCGCATCTTCGGTTA | TATGCCAAAGGCGAGTTCGT |
csgA | ACATTTACCAGTACGGTGGCG | ATGAGCGGTCGCGTTGTTA |
fimA | ACCCACGACGGTAAATGGTG | CTGCACTAAATGTCGCACCG |
dcgT | GGGCCGATAGTTGCTCACAT | CGCGATGTGCAATGTCCTTT |
2.10 Statistical analysis
GraphPad Prism (San Diego, CA, USA) version 8 (a simple t-test analysis or one-way analysis for multiple comparisons) were used for estimating statistical significance. And it’s defined as P < 0.05 (represented by *), P < 0.01 (represented by **), P < 0.001(represented by ***), and P < 0.0001 (represented by ****).