Materials
If not stated differently, all chemicals were purchased from Sigma-Aldrich (St. Louis, MO, USA). Dulbecco's Modified Eagle medium (DMEM), and phosphate-buffered saline (PBS) buffer were purchased from PAN Biotech (Aidenbach, Germany). FBS was purchased from Gibco Laboratories (Gaithersburg, MD, USA).Mouse recombinant IL-1β, OSM, mouse chemerin 156S, and human chemerin 157S were purchased from R&D Systems (Minneapolis, MN, USA). Chemerin-derived peptide p4 was chemically synthesized by ChinaPeptide (Shanghai, China) at ≥95% purity.
Animal studies
Male eight- to 12-week-old C57BL/6 mice were used for these investigations. The mice were maintained under specific pathogen-free conditions at the Faculty of Biochemistry, Biophysics, and Biotechnology of Jagiellonian University animal care facility. IL-1β and OSM were injected intraperitoneally at doses of 10 μg/kg BW and 160 μg/kg BW, respectively as previously described.25After 48 h, different tissues were isolated and subjected to RT-QPCR analysis. All experimental procedures were approved by the First Local Ethical Committee on Animal Testing at the Jagiellonian University in Krakow, Poland (permit no. 41/2014), in accordance with the ARRIVE guidelines and the Guidelines for Animal Care and Treatment of the European Community. The mice were sacrificed by an overdose of anesthesia (a mixture of ketamine and xylasine), followed by cervical dislocation.
Rapid amplification of cDNA ends (RACE)
Total RNA was extracted as described by Chomczynski and Sacchi39 and converted to complementary DNA using NxGen M-MulV reverse transcriptase (Lucigen Corporation, Middleton, WI, USA) with random primers (Promega Corporation, Madison, WI, USA) and oligo dT (Genomed, Warsaw, Poland).3' and 5’ RACE PCR were performed with the 3’ or 5’ RACE System kit (Invitrogen, USA) according to the manufacturer protocol. The following RARRES2 specific primers were used: 5’-GTGTGGACAGAGCTGAAGAAGTGCTCTTC (3’ RACE) and 5’-CTGGAGAAGGCAAACTGTCCAGGTAGGAAGTAG (5’ RACE). RACE PCR products of interest were separated by agarose gel electrophoresis, excised from the gel, isolated using Gel-Out Concentrator (A&A Biotechnology, Poland), and ligated into pTZ57/RT vector using InsTAclone PCR Cloning Kit (Thermo Scientific, USA) followed by heat shock transformation of plasmid into chemically competent Top10 E.coli. Selected bacterial colonies were subjected to colony PCR using standard M13 primers. Plasmid DNA was recovered from positive clones using GeneJET Plasmid Miniprep Kit (Thermo Scientific, USA), and sequenced (Genomed, Poland). Results were analysed using SnapGene Viewer (GSL Biotech LLC, USA).
RT-QPCR and quantification of RARRES2splice variants
Total RNA was extracted with the Total RNA Zol-Out Kit (A&A Biotechnology, Gdynia, Poland) and converted to complementary DNA using NxGen M-MulV reverse transcriptase (Lucigen Corporation, Middleton, WI, USA) with random primers (Promega Corporation, Madison, WI, USA). Real-time PCR was performed on the CFX96 thermocycler (Bio-Rad Laboratories, Hercules, CA, USA) using SYBR Green I containing universal PCR master mix (A&A Biotechnology, Gdynia, Poland) and the following mice specific primers: chemerin_all_variants (5’-CTTCTCCCGTTTGGTTTGATTG, 5’-TACAGGTGGCTCTGGAGGAGTTC), mChem162K (5’ – CCTCAGGAGTTGCAATGCATTAAGAT, 5’ - GTACAGGGAGTAAGGTGAAGTCCTGT), mChem153K (5’- CAATCAAACCAAACGGGAGAAGGC, 5’- CGCCAGCCTGTGCTATCTGAG), cyclophilin A (5’- AGCATACAGGTCCTGGCATCTTGT, 5’- CAAAGACCACATGCTTGCCATCCA), b-actin (5’-CCTTCTTGGGTATGGAATCCTG, 5’-TGGCATAGAGGTCTTTACGGA), GAPDH (5’-TGTGTCCGTCGTGGATCTGA, 5’-TTGCTGTTGAAGTCGCAGGAG). Expression stabilities of commonly used reference genes were analyzed as described previously.25 Relative gene expression normalized to the geometric mean of these housekeeping genes was calculated using the 2−ΔΔCT method.40 Relative Incidence of Variant (RIV) was obtained with the method described by Londoño et al. 24, PCR efficiencies of primer sets were calculated with CFX Maestro Software (Bio-Rad) using pcDNA3.1 plasmids encoding mChem162K and mChem153K as a template
Alternative splicing analyses from RNA-Seq datasets
Information about RARRES2 expression level in distinct tissues and cell lines as well as isoform quantification were acquired from VastDB.23 To assess isoform ratios in publicly available RNA-Seq datasets we calculated Percent Spliced In (PSI) scores with vast-tools.23 Notably, we analyzed NCBI:GEO datasets which investigate the molecular effects of high-fat diet: GSE76133, GSE75984 and GSE117249 as well as records related to transcriptional changes upon distinct infections: Staphylococcus aureus (GSE108718), Toxoplasma gondii (GSE119855) and influenza virus (GSE114232).Differential splicing analyses were carried out with vast-tool's module diff.
Plasmid construction
The pcDNA3.1(+) (ThermoFisherScientific, USA) and pNIC28-Bsa4(Addgene, LGC Standards, UK)plasmids, encoding mouse full-length chemerin variants mChem163K, mChem162K, mChem153K and chemerin variants mChem157S, mChem156S, mChem147S lacking 6 aa at C-terminus, were generated. Briefly, the expression plasmid insert was generated from mouse liver cDNA using Phusion High-Fidelity DNA Polymerase (ThermoFisherScientific, USA) and a primer set flanking RARRES2 CDS with an overhang sequence complementary to plasmid fragment containing Eco32I restriction site (5’- TGTGGTGGAATTCTGCAGATATGAAGTGCTTGCTGATC, 5’- CGGCCGCCACTGTGCTGGATTTATTTGGTTCTCAGGGC). In order to linearize the vector, the pcDNA3.1(+) plasmid was digested with Eco32I. Linearized vector and amplified insert were then assembled using NEBuilder HiFi DNA Assembly Master Mix (New England
BioLabs, USA) and transformed into competent Top10 E. coli. Bacterial colonies were PCR-tested using universal T7/BGH primers and positive plasmids were sequenced in order to check for unintentional mutations. The following plasmids were generated: pcDNA-mChem163K, pcDNA-mChem157S, pcDNA-mChem162K, and pcDNA-mChem156S. In order to generate pcDNA-mChem153K and pcDNA-mChem147S, pcDNA-mChem162K/pcDNA-mChem156Splasmids were used as a template for overlap-extension PCR 41using Phusion Polymerase and primer set flanking 5’ end of exon 5 with an inner fragment lacking specific sequence (5’- AAGCAAGGGCCTCAGATAGCACAGGCTGGCGAAGA, 5’- GCCAGCCTGTGCTATCTGAGGCCCTTGCTTCAGAA). The mixture was then digested with DpnI and transformed into Top10 E.coli, followed by identification of positive colonies and reamplifying and purification od plasmid DNA.
Then, pcDNA3vectors were used as a template to generate pNIC28-Bsa4 plasmids encoding different isoforms of chemerin (mChem163K, mChem162K, mChem153K, mChem157S, mChem156S, mChem147S). The following starters: 5’-GCACCATCATCATCATCATTCTTCTGGTGAGCCCGAACTCAGCGAGACC, 5’-CACAATTCAGAAAATATCATAATATCTCATTTCACTATTTGGTTCTCAGGGCCCTGGAGAAG were designed to be complementary to a specific site of the target expression vector pNIC28-Bsa4. The PCR products were cloned into pNIC28-Bsa4 expression vector at a site preceded by the sequence coding for hexahistidine tag, using the overlap-extension PCR method. All constructs lacked the native chemerin signal peptide. The identity of the created pNIC28-Bsa4 constructs was verified by sequencing (Genomed, Warsaw, Poland).
Expression of mouse chemerins in HEK293 cells and western blot
HEK293 cells were grown in DMEM medium supplemented with 10% FBS and gentamycin (50 µg/mL). Cells were seeded at a density of 1.5 × 104 cells in a 24-well culture plate and, 24 h later.Then, the cells were transfected with the pcDNA plasmids described above using ViaFect transfection reagent (Promega Corporation, Madison, WI, USA) in accordance with the producers instructions. Transiently transfected cells were RIPA-lysed after 48h and used for Western Blot analysis. Proteins were electrophoretically separated on a SDS-polyacrylamide gel and wet-transferred onto PVDF membrane (Bio-Rad), followed by blocking with 5% skim milk (Merck). His-tagged chemerin isoforms were detected using anti-Histag antibodies(ab15149, Abcam, Cambridge, MA). Chemiluminescent detection was carried out using WesternBright ECL (Advansta) and ChemiDoc MP imaging system (Bio-Rad).
Production and purification of mouse chemerin isoforms in E. coli
Chemerin isoforms were expressed using E. coli strain NiCo21(DE3) (New England Biolabs, MA, USA) transformed with plasmids described above. Bacteria were precultured in 37°C in LB medium until culture density reached OD600 value between 0,6-0,8. Protein expression was induced by addition of IPTG to a final concentration of 1mM and carried out overnight in 18°C. After centrifugation the bacterial pellet was dissolved in PBS with 1mM EDTA and cOmplete protease inhibitor cocktail (Roche), and sonicated. After sonication samples were centrifuged (40000g, 20min, 4°C) and pellets were resuspended in denaturing buffer (6M GuHCl, 50mM NaCl, 50mM TRIS, pH8). After centrifugation (12000g, 12min, 4°C) supernatants were 100-fold diluted in renaturation buffer (0,5M GuHCl, 0,4M Sucrose, 0,1M TRIS, 1mM GSH, 0,1mM GSSG, pH8). Any precipitate was removed by centrifugation, and the protein solutions were concentrated using Amicon Ultra Centrifugal Filters (Merck). Concentrated solutions were 10-fold diluted in dilution buffer (0,1M TRIS, 0,1M Sucrose, 1mM GSH, 0,1mM GSSG, pH 8). Any precipitate was removed from solution by centrifugation. Proteins were purified from solution by incubation with Ni-Sepharose 6 Fast Flow (GE Healthcare, Uppsala, Sweden), washed on column in wash buffer (0,1M TRIS, 1mM GSH, 0,1mM GSSG, pH 8), then eluted with 500 mM imidazole in wash buffer. mChem163K and mChem162K protein samples were dialyzed against buffer A (25mM TRIS, 25mM NaCl, pH 7,6). Any precipitates were removed by centrifugation. Protein samples were loaded on Q-Sepharose Fast Flow columns (GE Healthcare, Uppsala, Sweden). Elution fractions containing increasing concentrations of NaCl were collected and analysed by SDS-PAGE electrophoresis and coomassie blue staining. Fractions of low NaCl concentration were pooled, concentrated on Amicon Ultra Centrifugal Filters (Merck), and then dialyzed against PBS. Protein samples were routinely >90% pure as assessed by SDS-PAGE and Coomassie Blue staining. The concentration of chemerin was determined by measuring the absorbance at 280 nm using NanoDrop ND-1000 spectrophotometer (ThermoFisherScientific, USA), and bicinchoninic acid (BCA) assay (ThermoFisherScientific, USA). Chemerin activity profiling between batches was evaluated by in vitro transwell assay using CMKLR1 expressing L1.2 cells as described below. At least two different batches of chemerin isoforms were used for experiments.
Antimicrobial microdilution assay (MDA)
For antimicrobial experiments E.coli HB101 were grown in brain heart infusion (BHI) broth at 37°C. To determine the antimicrobial activity of the chemerin isoforms, bacteria in mid-logarithmic phase were harvested, washed three times with PBS and diluted to 4 x 105 CFU/ml with PBS. Then bacteria were incubated with either chemerin isoforms (3 μM) or PBS (control) for 2 h. The number of viable bacteria were enumerated by CFU counting.
Chemotaxis assay
Purified mouse chemerin isoforms were tested for the ability to stimulate migration of the murine pre-B lymphoma cell line L1.2 stably transfected with mouse CMKLR1 (L1.2-CMKRL1). L1.2-CMKRL1+ cell were provided by Dr. Brian Zabel and Dr. Eugene C. Butcher (Stanford University School of Medicine and Veterans Affairs Palo Alto Health Care System). A total of 100 μl cells (2 × 105 cells/well) was added tothe top well of 5-μm pore Corning Costar Transwell inserts (Corning, USA). Chemotaxis assay was performed in chemotaxis media (RPMI 1640 with 10% FBS) containing 1 nM of chemerin, added to the bottom well in a 600-μl volume. Migration was assayed for 2 h at 37°C. The inserts were then removed, and cells that had migrated through the filter to the lower chamber were collected and counted by flow cytometry (LSRII; BD Biosciences, USA). The results are presented as percentage of input migration.
Statistical analysis
Differential splicing quantification from RNA-Seq experiments was performed using vast-tools (-r 0.95, and -m 0.1). Other data were analyzed using STATISTICA 13 (StatSoft, Tulsa, OK, USA). The results were visualized with Prism (GraphPad Software, San Diego, CA, USA), and presented as mean ± standard deviation (SD). The Student’s t-test was used for comparison between two groups. For multiple comparisons, analysis of variance (ANOVA) with Tukey’s post-hoc test was used. Differences were considered statistically significant for p-values of less than 0.05.