Associations of rare variants in the AKAP11 gene with bipolar disorder in Chinese population

doi:10.21203/rs.3.rs-3730655/v1

Purpose

This pioneering study aimed to explore the associations between the A-kinase anchoring protein 11 (AKAP11) gene and bipolar disorder (BD) in a Chinese population. We sought to replicate findings from European populations regarding ultra-rare protein-truncating variants (PTVs) within exon 8 of AKAP11 and identify any novel rare mutations linked to Chinese BD patients.

Methods

We conducted a case-control association study, including a cohort of 284 Chinese BD patients, with the control group comprising 10,588 individuals from the China Metabolic Analytics Project (ChinaMAP) database. Polymerase chain reaction (PCR) amplification and Sanger sequencing were performed to analyze exon 8 of the AKAP11 gene. Statistical analysis involved chi-square tests to assess differences in allele frequency between BD patients and the control group.

Results

In our 284 Chinese BD patients, within exon 8 of the AKAP11 gene we did not find any ultra-rare PTVs previously identified in European BD patients. However, five additional rare variants were discovered, including three missense variants and two synonymous variants. Among these variants, one synonymous variant, g.42300171T > C (i.e., rs771987690), had not been reported in the ChinaMAP database. Statistical analysis did not reveal significant differences in allele frequencies between BD patients and controls (P = 0.240), but there was a noticeable trend suggesting a potential association between the rare variants with the AKAP11 gene and risk of BD. Additionally, three of the five rare variants were not documented in the Bipolar Exomes Browser (BipEx) database, the frequencies of the other two were mildly lower in cases than controls, contrary to the trend observed in the Chinese population. The observed difference may be due to population genetic-environmental interaction.

Conclusions

Our preliminary data indicates a potential trend between the AKAP11 gene and BD patients in China, despite did not reach nominal significance, calling for further analysis in a larger sample set.

Bipolar disorder

AKAP11

Chinese population

PTVs

Rare variants

Bipolar disorder (BD) is a severe mental disorder characterized by the presence of manic or hypomanic episodes, as well as depressive episodes (typical features). Given its early onset, chronic course, and high suicide rate[1], BD has emerged as a prominent public health concern and a significant global burden of disease[2, 3]. As early as the mid-20th century, German physician Leonhard et al.[4] pointed out the substantial familial aggregation of BD, shedding light on its hereditary implications. Although the exact pathogenesis of BD remains elusive, approximately 70% of the risk for BD is of a heritable nature[5], thus highlighting the need to identify genetic variations associated with the disease.

In the quest to unravel the genetic underpinnings of BD, numerous scholars have undertaken an extensive exploration spanning several decades, including family[6], twin[7], adoption[8], and molecular genetic studies[9–13], which have led to the discovery of a number of genes associated with BD. Among these genes, a recent study[13] utilizing whole-exome sequencing (WES) highlighted the significance of A-kinase anchoring protein 11 (AKAP11). This study[13] discovered 16 ultra-rare protein-truncating variants (PTVs) within AKAP11 in a large cohort of 13,933 BD patients, in stark contrast to their absence in 14,422 control subjects. Considering the large differences of genetic background and population characteristics between Han Chinese and Europeans[14], we need to further verify the relationship between BD and AKAP11 gene in other populations.

The primary aim of this study was to replicate the findings by Palmer et al.[13] using polymerase chain reaction (PCR) amplification and Sanger sequencing, to determine whether rare PTVs in AKAP11 gene are associated with BD in a Chinese population through a case-control association approach. It is noteworthy that among the 16 rare PTVs in the AKAP11 gene observed in BD patients of European descent, 13 are located in exon 8. As such, our research will concentrate on evaluating exon 8 of the AKAP11 gene. Accordingly, our secondary aim is to ascertain whether there are any further rare mutations in exon 8 of the AKAP11 gene that could be associated with Chinese BD patients.

2.1. Subjects and procedures

All subjects, who were of the Chinese population, provided written informed consent prior to the implementation of any study-related procedures. Patients with BD were diagnosed through the use of an extensive clinical interview and the Structured Clinical Interview for DSM-IV Axis I Disorders–Patient Version. A total of 284 individuals who met the criteria were enrolled in this study. The control group data, obtained from the China Metabolic Analytics Project (ChinaMAP, http://www.mbiobank.com/), encompassed deep whole-genome sequencing information from 10,588 individuals of Chinese ancestry[15].

DNA samples were extracted from the peripheral blood leukocytes of all subjects using the high salt method. The study protocol obtained approval from the ethics committee of Qingdao Mental Health Center (approval number: NO. 2023024 ).

2.2. AKAP11 genomic structure and PCR amplification

The genome sequence of the human AKAP11 gene, identified by the Ensembl ID ENSG00000023516, is available from the Ensembl database. Located on chromosome 13 at position q14.11, the AKAP11 gene comprises a total of 13 exons. Leveraging the Primer-BLAST tool (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=BlastHome) within NCBI, we conducted primer design for the exon 8 region of the AKAP11 gene. Subsequently, we employed the In-Silico PCR tool (https://genome.ucsc.edu/cgi-bin/hgPcr) based on UCSC to predict the target sequences and their genomic positions that can be amplified by the candidate primers, thus facilitating the selection of the optimal PCR amplification primer sequences. Primer sequences and the lengths of PCR products are listed in Table 1. In the PCR reaction, template DNA (20 ng) was amplified in a reaction volume of 20 µL containing 1 µL of 10 µM each of the forward and reverse primers, ddH₂O and 10 µL of 2× Taq Plus Master Mix II (including all components necessary to perform DNA amplification). Touchdown PCR conditions consisted of an initial denaturation at 95°C for 5 minutes, followed by 20 cycles at 95°C for 30 seconds, 65°C for 30 seconds, 72℃ for 1 minute and 5 seconds, then another 20 cycles at 95°C for 30 seconds, 55°C for 30 seconds, 72°C for 1 minute and 5 seconds, and a final extension step was performed at 72°C for 5 minutes.

Table 1

The primer sequences and the lengths of PCR products for exon 8 of the *AKAP11* gene.
Amplicon	Forward(5’-to-3’)	Reverse(5’-to-3’)	Product (bp)
exon8-2	AAAGCAAAACTTGAGCTGCCTAA	CCTTCTCAGCTCATCAAATGCC	816
exon8-3	CAGTGTGGGTCGTTTGACTTTG	GGGAGACTTTTCTGGTGTCAACT	936
exon8-4	CATTTTCCCACTGTGATCAGGC	AGTGCTCCGACTTCACATCCA	825
exon8-5	GCTTGCCTACCGATCTGTTAAATC	GGCTTACTACTGGCGAGAGAAC	741

2.3. DNA sequencing and analysis

The PCR products of 3 µL were separated by electrophoresis utilizing 1.2% agarose gels, thereafter, they were visualized by means of the Tanon 5200 Multi fully automated chemiluminescence imaging system (e.g., Fig. 1). PCR products that were valid and matched the target fragment size were sent to Sangon Biotech (Shanghai) Co., Ltd. for DNA Sanger sequencing using an ABI 3730XL gene sequencer with the sequencing primers listed in Table 2. Utilizing the SeqMan module of the Lasergene software (version 7.1.0.44), the obtained sequencing peak map files were aligned with the human genome reference sequence (GRCh38), as provided in the Ensembl database, to identify any possible mutation loci.

Table 2

Sequencing primers for exon 8 of the *AKAP11* gene.
Amplicon	Sequence (5’-to-3’)
exon8-2	AAAGCAAAACTTGAGCTGCCTAA
exon8-3 exon8-3	CAGTGTGGGTCGTTTGACTTTG AACACAATCCAGGTAATCAGAATG
exon8-4	CATTTTCCCACTGTGATCAGGC
exon8-5	GGCTTACTACTGGCGAGAGAAC

2.4. Statistical analysis

The chi-square test was employed to examine the difference in allele frequencies of the five single nucleotide variations located in exon 8 of the AKAP11 gene between BD patients and the control group from the ChinaMAP database. The statistical analysis tool utilized was the 2 × 2 contingency table function available on the website http://www.vassarstats.net/odds2x2.html. P༜0.05 was considered statistically significant.

3.1. Failure to replicate European-implicated rare PTVs in AKAP11 exon 8 among Chinese BD patients

We initially determined the genotypes of exon 8 of the AKAP11 gene in 284 Chinese BD patients, and then compared them with the variant IDs of rare PTVs identified in European BD patients, as reported by Palmer et al.[13] on the Bipolar Exomes Browser (BipEx, https://bipex.broadinstitute.org/gene/ENSG00000023516). Our findings revealed that none of the rare PTVs identified in European populations within AKAP11 exon 8 were observed in our study involving the 284 Chinese BD patients. Similarly, in the control group of this study, which consisted of the ChinaMAP database comprising 10,588 Chinese individuals, none of the PTVs were identified.

3.2. Identification of five additional rare variants in exon 8 of the AKAP11 gene

After sequencing exon 8 of the AKAP11 gene in the BD patients, we identified a total of five rare variants (alternative allele frequency <0.05). Three of them were missense variants, and the remaining two were synonymous variants, all of which were single base substitutions documented in the single nucleotide polymorphism (SNP) database. Figure 2 depicts the locations of the five rare variants discovered in exon 8 of the AKAP11 gene. Starting from the left, the first rare variant was a synonymous variant characterized by a T-to-C change without altering the amino acid, termed g.42300171T>C (i.e., rs771987690). It's worth mentioning that no variants at this specific locus were identified in the ChinaMAP database, and the BipEx database similarly did not report any findings at this locus. The second rare variant, rs2236364, was a missense variant designated as g.42300908C>G. It involved a change from C to G at the nucleotide level, resulting in an amino acid alteration from serine to cysteine. This specific locus was also not reported in the BipEx database. The third g.42301585A>G (i.e., rs117141435) was a missense mutation in which base A was replaced with G, leading to the substitution of isoleucine with valine. Interestingly, this particular location was previously documented in the BipEx database; the allele frequency in the case group was 6.46×10^–4 (18/27866), while in the control group, it was 9.71×10^–4 (28/28844). The fourth mutation, named g.42301991G>T (i.e., rs150773395), was a missense mutation where T replaces G, resulting in the substitution of glycine with valine, and this mutation was not found in the BipEx database. The fifth rare variant was synonymous called g.42302154A>C (i.e., rs41288311). It was present in the BipEx database, and its frequency was marginally lower in the case group in comparison to the control group, with values of 0.1440 (4014/27866) and 0.1503 (4336/28844), respectively. Table 3 presents the allele frequencies of these five rare variants in both Chinese and European control populations, as well as in BD patients for comparison.

Table 3

Allele frequencies of rare variants in exon 8 of the AKAP11 gene in BD and control groups.

Variant Name	HGVS p	Ref	Alt		AAF (Chinese Population)		AAF (European Population)
Variant Name	HGVS p	Ref	Alt		BD	Control	BD	Control
g.42300171T>C (rs771987690)	p.Asp475=	T	C	0.001805		-	-	-
g.42300908C>G (rs2236364)	p.Ser721Cys	C	G	0.01630		0.02182	-	-
g.42301585A>G (rs117141435)	p.Ile947Val	A	G	0.04754		0.04250	0.0006460	0.0009707
g.42301991G>T (rs150773395)	p.Gly1082Val	G	T	0.03369		0.02059	-	-
g.42302154A>C (rs41288311)	p.Thr1136=	A	C	0.001773		0.001369	0.1440	0.1503

Abbreviations: Ref: reference allele; Alt: alternative allele; AAF: alternative allele frequency.

3.3. Association analysis of rare variants in BD and Control Groups

As demonstrated in Table 3, the allele frequencies of the five rare variants found in exon 8 of the AKAP11 gene showed no significant differences between the BD and control groups. We further used the chi-squared or fisher exact test to assess the relationship of the rare variants found between the BD and control groups. The results of the analyses are shown in Table 4 (OR= 1.181, 95%CIs=0.895-1.560, P=0.240). Although the Chi-square test did not confirm a statistically significant association of these five rare variants between the case and control groups, it is noteworthy that we observed a trend. This suggests that the distribution of these rare variants in our sample tended to differ between the case and control groups, although the difference did not reach the level of statistical significance.

Table 4

Association analysis of rare variants in BD and control groups.

Group	Total (count)	Ref (count)	Alt (count)	OR and .95 CI	Chi-square
					χ²	P
BD	568	511	57	1.1813 [0.8947-1.5597]	1.38	0.2401
Control	21176	19349	1827

Notes: OR: Odds Ratio; CI: Confidence Intervals; χ²: Chi-square statistics of Chi-square test; P < 0.05 indicated statistical significance.

Abbreviations: Ref: reference allele; Alt: alternative allele.

In this study, we sought to replicate the previously observed[13] association between rare PTVs within the AKAP11 gene and BD using a sample of Chinese individuals. To the best of our knowledge, this represents the first investigation specifically conducted within the Chinese population regarding the relationship between BD and the AKAP11 gene. However, it is worth noting that while our study comprised 284 Chinese BD patients, the European WES study[13] examined a much larger cohort of 13,933 BD patients, identifying 16 ultra-rare PTVs within AKAP11, which stood in stark contrast to their absence in 14,422 control subjects. Our study, though constrained by a smaller sample size and the inclusion of 10,588 controls from the ChinaMAP database, does provide valuable insights. The absence of these rare PTVs in our control sample, coupled with consistent findings in European controls, suggests that these variants may be exceptionally rare or non-existent in both European and Chinese healthy populations. However, due to the limitations of our sample size, we must acknowledge that it may restrict our ability to detect rare variants, thereby enabling us to conclude only that rare PTVs were not found in the BD group in this study, without excluding the possibility of their presence in Chinese BD patients.

Furthermore, our study focused on rare variants in exon 8 of the AKAP11 gene and identified five additional rare variants in this region, including three missense variants and two synonymous variants, all of which are single-nucleotide variants documented in the SNP database. Statistical analysis of the allele frequencies between BD patients and the control group did not reveal significant differences (P= 0.2401). Although no statistically significant association was confirmed, there was a noticeable trend (OR=1.181) suggesting that the distribution of these rare variants differed to some extent between the BD and control groups. In addition, out of the five rare variants, three were not reported in the BipEx database, while two were documented but had slightly lower frequencies in cases compared to controls (P>0.05), which contradicted the observed trend in the Chinese population. This underscored the genetic diversity of the AKAP11 gene among different populations. However, we did not conduct a thorough analysis of the functional implications of these five rare variants, which is one of the limitations of our study. Additionally, our study was designed to primarily focus on detecting rare PTVs, rather than conducting a comprehensive sequencing of the exon 8 sequence. Therefore, there is a possibility of undiscovered rare variants as well. In other words, our study was limited to a partial segment of the exon 8 of AKAP11 gene, leaving room for further exploration of the entire gene's genetic landscape.

Our study builds upon existing research, but discrepant from those reported positive findings. The BrainEXP dataset[16] revealed a significant downregulation of AKAP11 mRNA expression in the frontal cortex of BD patients compared to controls. AKAP11, a gene highly expressed in the brain, encodes for the AKAP-11 protein, also known as AKAP220. As a member of the scaffolding protein family, AKAP-11 binds to the regulatory subunit of protein kinase A (PKA), facilitating precise targeting of PKA to specific substrates for phosphorylation and dephosphorylation. Notably, through its interaction with glycogen synthase kinase 3 beta (GSK3B), AKAP-11 mediates PKA-dependent inhibition of GSK3B. This interaction is particularly significant because GSK3B is hypothesized to be the target of lithium, which is the primary treatment for BD[17]. Rare variants in the AKAP11 gene may disrupt the interaction between AKAP-11 and GSK3B, potentially affecting signaling pathways involved in mood regulation. Therefore, further functional studies are needed.

Taken together, expanding the sample size of the study is an imperative avenue for future research. By doing so, we can enhance the statistical power of the study, delve deeper into the genetic association of the AKAP11 gene, and attain a more comprehensive understanding of the relationship between this gene and the genetic underpinnings of BD in the Chinese population. In addition, further expansion to the entire exon 8, or even the entire AKAP11 gene, would aid in the discovery of additional, potentially more meaningful rare mutations. Subsequent studies could also provide insights into the functional implications of the identified variants. For instance, exploring how these variants affect the interaction of the AKAP-11 protein with GSK3B and related signaling pathways, to name a few.

In summary, we failed to replicate the ultra-rare PTVs in the AKAP11 gene in Chinese BD patients as our limited sample size in this study. However, we identified other five rare variants within exon 8 of AKAP11, and although no statistically significant associations were established between BD patients and control individuals, there was a trend towards a significant association between the AKAP11 gene and BD. Moreover, these five rare variants exhibited significant differences between the Chinese and European populations. In conclusion, our study represents a significant step towards understanding the relationship between rare variants in the AKAP11 gene and BD within the Chinese population.

AKAP11, A-kinase anchoring protein 11; BD, bipolar disorder; PTVs, protein-truncating variants; ChinaMAP, the China Metabolic Analytics Project; PCR, Polymerase chain reaction; BipEx, the Bipolar Exomes Browser; WES, whole-exome sequencing; SNP, the single nucleotide polymorphism; OR, Odds Ratio; CI, Confidence Intervals; Ref, reference allele; Alt, alternative allele; AAF, alternative allele frequency; PKA, protein kinase A; GSK3B, glycogen synthase kinase 3 beta.

Ethics approval and consent to participate

The study protocol obtained approval from the ethics committee of Qingdao Mental Health Center (approval number: NO. 2023024). All subjects, who were of the Chinese population, provided written informed consent prior to the implementation of any study-related procedures.

Consent for publication

Not applicable.

Availability of data and materials

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Competing interests

All the authors declare that they have no conflicts of interest.

All the authors certify that the submission is an original work and it is not under review at any other journal.

Funding

This study was supported by a grant from the Medical and Health Scientific Research Guidance Programme of Qingdao Municipality (2022-WJZD168).

Authors' contributions

Y.Z. and P.S. designed the study and interpreted the results. Y.Z. conducted the primary experiments and analyses, with the help of H.Y. and T.W.; Y.Z. and P.S. drafted the manuscript, and all authors contributed to the final version of the paper.

Acknowledgements

Not applicable.

Plans L, Barrot C, Nieto E, Rios J, Schulze TG, Papiol S, Mitjans M, Vieta E, Benabarre A. Association between completed suicide and bipolar disorder: A systematic review of the literature. J Affect Disord. 2019;242:111–22.
Ferrari AJ, Stockings E, Khoo JP, Erskine HE, Degenhardt L, Vos T, Whiteford HA. The prevalence and burden of bipolar disorder: findings from the Global Burden of Disease Study 2013. Bipolar Disord. 2016;18(5):440–50.
Vos T, Abajobir AA, Abate KH, Abbafati C, Abbas KM, Abd-Allah F, Abdulkader RS, Abdulle AM, Abebo TA, Abera SF, et al. Global, regional, and national incidence, prevalence, and years lived with disability for 328 diseases and injuries for 195 countries, 1990–2016: a systematic analysis for the Global Burden of Disease Study 2016. The Lancet. 2017;390(10100):1211–59.
Leonhard K, Korff I, Schulz H. [Temperament in families with monopolar and bipolar phasic psychoses]. Psychiatria et neurologia. 1962;143:416–34.
McIntyre RS, Berk M, Brietzke E, Goldstein BI, Lopez-Jaramillo C, Kessing LV, Malhi GS, Nierenberg AA, Rosenblat JD, Majeed A, et al. Bipolar disorders. Lancet (London England). 2020;396(10265):1841–56.
Song J, Bergen SE, Kuja-Halkola R, Larsson H, Landen M, Lichtenstein P. Bipolar disorder and its relation to major psychiatric disorders: a family-based study in the Swedish population. Bipolar Disord. 2015;17(2):184–93.
Kieseppä T, Partonen T, Haukka J, Kaprio J, Lönnqvist J. High concordance of bipolar I disorder in a nationwide sample of twins. Am J Psychiatry. 2004;161(10):1814–21.
Mendlewicz J, Rainer JD. Adoption study supporting genetic transmission in manic–depressive illness. Nature. 1977;268(5618):327–9.
Stahl EA, Breen G, Forstner AJ, McQuillin A, Ripke S, Trubetskoy V, Mattheisen M, Wang Y, Coleman JRI, Gaspar HA, et al. Genome-wide association study identifies 30 loci associated with bipolar disorder. Nat Genet. 2019;51(5):793–803.
Li HJ, Zhang C, Hui L, Zhou DS, Li Y, Zhang CY, Wang C, Wang L, Li W, Yang Y, et al. Novel Risk Loci Associated With Genetic Risk for Bipolar Disorder Among Han Chinese Individuals: A Genome-Wide Association Study and Meta-analysis. JAMA Psychiatry. 2021;78(3):320–30.
Mullins N, Forstner AJ, O'Connell KS, Coombes B, Coleman JRI, Qiao Z, Als TD, Bigdeli TB, Borte S, Bryois J, et al. Genome-wide association study of more than 40,000 bipolar disorder cases provides new insights into the underlying biology. Nat Genet. 2021;53(6):817–29.
Li M, Li T, Xiao X, Chen J, Hu Z, Fang Y. Phenotypes, mechanisms and therapeutics: insights from bipolar disorder GWAS findings. Mol Psychiatry. 2022;27(7):2927–39.
Palmer DS, Howrigan DP, Chapman SB, Adolfsson R, Bass N, Blackwood D, Boks MPM, Chen CY, Churchhouse C, Corvin AP, et al. Exome sequencing in bipolar disorder identifies AKAP11 as a risk gene shared with schizophrenia. Nat Genet. 2022;54(5):541–7.
Sirugo G, Williams SM, Tishkoff SA. The Missing Diversity in Human Genetic Studies. Cell. 2019;177(4):1080.
Cao Y, Li L, Xu M, Feng Z, Sun X, Lu J, Xu Y, Du P, Wang T, Hu R, et al. The ChinaMAP analytics of deep whole genome sequences in 10,588 individuals. Cell Res. 2020;30(9):717–31.
Jiao C, Yan P, Xia C, Shen Z, Tan Z, Tan Y, Wang K, Jiang Y, Huang L, Dai R, et al. BrainEXP: a database featuring with spatiotemporal expression variations and co-expression organizations in human brains. Bioinformatics. 2019;35(1):172–4.
Tanji C, Yamamoto H, Yorioka N, Kohno N, Kikuchi K, Kikuchi A. A-kinase anchoring protein AKAP220 binds to glycogen synthase kinase-3beta (GSK-3beta) and mediates protein kinase A-dependent inhibition of GSK-3beta. J Biol Chem. 2002;277(40):36955–61.

No competing interests reported.

Electrophoreticgels.docx

Associations of rare variants in the AKAP11 gene with bipolar disorder in Chinese population

Status:

Version 1

Abstract

Purpose

Methods

Results

Conclusions

Figures

1. Introduction

2. Methods

2.1. Subjects and procedures

2.2. AKAP11 genomic structure and PCR amplification

2.3. DNA sequencing and analysis

2.4. Statistical analysis

3. Results

4. Discussion

5. Conclusions

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1