Viral Vector Constructs: AAV 2, self-complementary AAV2 (scAAV2) and Trp-Mutant scAAV2 (scAAV2Trp-Mut) were selected for the study based on previous studies that show tropism toward the trabecular outflow pathway 58. Ready to use AAV2, scAAV2 and ScAAV2Trp-Mut expressing GFP under the control of the CMV promoter were purchased from the Viral Vector Core at the University of Florida, Gainesville, FL. LV expressing GFP under the control of the CMV promoter (LV_GFP) was purchased from Vector Builder, Inc (Product ID: LVMP-VB160109-10005).
Guide RNA (gRNA) targeting MYOC (GGCCTGCCTGGTGTGGGATG) published in the previous study, had the highest efficiency and selectivity in targeting human MYOC 51. In our current study, this same gRNA was cloned with spCas9 in the shuttle vector for generating LV constructs. LV particles expressing Cas9 + gMYOC, LV expressing GFP and LV expressing Cas9 + scrambled gRNA were manufactured by Vector Builder, Inc. The LV_Cas9 + scrambled gRNA expresses spCas9 with non-specific gRNA sequence that does not target any genomic DNA. A different gRNA (GACCAGCTGGAAACCCAAACCA) was designed for cloning into ssAAV2 vectors using saCas9 (AAV2_crMYOC; Product ID: AAV2 MP (VB 200728-1179 bqW)) as the packaging capacity of AAV is comparatively small. The efficiency of this gRNA to selectively target human MYOC was found to be equivalently high. We have utilized AAV2 expressing an empty cassette as a control (AAV2_Null; Viral Gene Core, University of Iowa).
Mouse Husbandry: All mice were housed and bred in a research facility at the University of North Texas Health Science Center (UNTHSC, Fort Worth, TX, USA). Animals were fed standard chow ad libitum and housed in cages with dry bedding. The animals were maintained in a 12 h light:12 h dark cycle (lights on at 0630hrs) under a controlled environment of 21–26oC with 40–70% humidity. C57BL/6J (male) mice were obtained from the Jackson Laboratories (Bar Harbor, ME, USA). We have utilized Tg-MYOCY437H mice that express mutant MYOC and develop ocular hypertension by the age of 3-months as described previously 46, 59, 60. Tg-MYOCY437H mice on a pure C57BL/6J strain were utilized for this study. These mice were genotyped by PCR using primers specific to human MYOC as described previously 46, 59, 60. Animal studies were executed in agreement with the guidelines and regulations of the UNTHSC Institutional Animal Care and Use Committee (IACUC) and the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. This study is reported in accordance with ARRIVE guidelines (https://arriveguidelines.org). Experimental protocols were approved by UNTHSC IACUC and Biosafety office under the approved protocol. At the end of experiment, mice will be sacrified by CO2 inhalation followed by cervical dislocation.
TM cell culture and in vitro transduction: TM3 cells were transfected with pDsRed2-MYOC plasmids to generate stable cells expressing WT or mutant (Y437H or G364V) MYOC using Lipofectamine 3000TM transfection kit (Invitrogen, Life Technologies, Grand Island, NY, USA). These plasmids express MYOC tagged with DsRed at the C-terminus. The confluent transfected cells were then treated with G418 antibiotic (0.6 mg/mL; Gibco, Life Technologies, Grand Island, NY, USA) for 7-10 days and individual colonies were selected and expanded. The cells stably expressing DsRed-tagged MYOC (with or without mutations) were characterized as described previously 61, and maintained in DMEM media (Sigma-Aldrich Corp, St. Louis, MO, USA)) supplemented with G418 antibiotics, 10% FBS (Gibco), and streptomycin (Gibco). For viral transduction, TM3 cells were plated at 30-40% confluency. The following day, cells were incubated with AAV (5000 MOI/mL) or LV (10 MOI/mL) in antibiotic free and low serum (6%) media. 30 hours post viral treatment, cells were switched back to regular maintenance medium. Once confluent (at day 3 or 4 post-transduction), cells were later processed for DNA isolation, Western blotting, and immunostaining. Human primary TM cells (n = 2 strains) were grown to confluency in 12-well plates and treated with AAV2/2, AAV2/4, AAV2/5 and AAV2/8 at multiplicities of infection (MOI) of 2.5×101 to 2.5×103 viral genomes (VG)/cell. GFP expression was examined by fluorescent microscopy after 72 hours of transduction.
Intraocular Injections: Viral deliveries were performed via intravitreal (IVT) and intracameral (IC) routes. Mouse eyes were anesthetized before injections by topical administration of proparacaine HCl drops (0.5%) (Akorn Inc., Lake Forest, IL, USA). Both IVT and IC bolus injections were performed on mice anesthetized intranasally with isoflurane (2.5%; with 0.8 L/min oxygen). However, in case of slow-IC infusion protocol, mice were anesthetized using xylazine/ketamine (10/100 mg/kg; Vetus; Butler Animal Health Supply, Westbury, NY/Fort Dodge Animal Health, Fort Dodge, IA, USA) cocktail administered intraperitoneally. As required, additional one-quarter to one-half of the initial dose was provided for continuous maintenance of the surgical anesthetic state. LV particles (2.5 x 106 TU/eyes and 2.5 mL/eye) or various AAV2 (2 x 1010 GC/eye) were injected via IVT or IC route. Hamilton’s (Reno, NV, USA) glass micro-syringe (10 mL capacity) attached with a 33 gauge 1-inch-long needle was used for IVT injections as described previously 62. For IC route, mouse eyes were treated topically with 1% cyclopentolate (Mydriacyl®, Alcon Laboratories, Fort Worth, TX) to dilate the pupils. Using the same micro-syringe system, the 33-gauge needle was inserted through the cornea 1–2 mm from the limbus, positioned parallel to the iris, and pushed towards the chamber angle opposite to the cannulation point. Care was taken to not touch the iris, corneal endothelium, or the anterior lens capsule. The viral solution was slowly released into the anterior chamber over a period of 30s, after which the needle was kept inside for a further 1 min, before being rapidly withdrawn. For slow infusion, the glass micropipette system was loaded onto a micro-dialysis infusion pump (SP101I Syringe Pump; WPI) that delivered the viral solution at a flow rate of 0.083 mL/min over the course of 30 mins (total volume delivered, 2.5 mL). A drop of filtered saline was also applied through this procedure to prevent corneal drying.
IOP measurements: A TonoLab impact tonometer (Colonial Medical Supply, Londonderry, NH, USA) was used for IOP measurements on mice as previously described 63. Baseline IOPs for C57BL/6J and Tg-MYOCY437H mice were measured during dark conditions (between 6:00-8:00 AM). The mice were anesthetized via intranasal isoflurane (2.5%; 0.8 L/min oxygen) delivery and readings were noted within 3 min of isoflurane influence to avoid any of its side effects on IOP 64. Post-injections, IOPs were monitored weekly (daylight and dark) in a masked manner. The average value of six individual IOP readings were represented.
Slit lamp imaging: A slit lamp (SL-D7, Topcon Corporation, Tokyo, Japan) was used to determine inflammation and ocular abnormalities in the anterior segment, including corneal edema, and photo-documented with a digital camera (DC-4; Topcon) as described earlier 46.
Histology and immunofluorescence staining: Following viral transduction, mice were euthanized at specified timepoints, and eyes were carefully enucleated and placed in 4% paraformaldehyde (PFA, Electron Microscopy Sciences, Hatfield, PA, USA) overnight at 4oC. The next day, eyes were washed with 1x PBS (Sigma-Aldrich) and cryopreserved using increasing concentration of sucrose (10% and 20%), followed by OCT compound embedding and sectioning. For hematoxylin and eosin (H&E) staining, the eyes were dehydrated in ethanol, and embedded in paraffin wax for sectioning. The paraffin-embedded mouse eyes were sectioned (sagittal) at 5 mm thickness, followed by deparaffinization in xylene, rehydration with gradual 5 min washes in each 100, 95, 70, and 50% ethanol solution and ending with a 10 min wash in 1x PBS. These sections were later stained with H&E. The general morphology of the anterior segment was assessed including the TM structure at iridocorneal angle and corneal thickness by light microscopy. Images were captured using a Keyence microscope (Itasca, IL, USA).
The OCT-embedded sections from mouse eyes were incubated with 10% goat serum (EMD Millipore Corp) in 0.2% Triton X-100 (diluted in PBS; Fisher BioReagents, Fair Lawn, NJ, USA) for 2 hours. For in vitro studies, TM cells were plated in 8-well chamber slides (Lab-Tek Nunc Brand Products, Rochester, NY, USA) and fixed with 4% PFA for 20 mins, followed by PBS washes. Fixed cells or sections were then incubated with 10% goat serum in 0.1% Triton X-100 for 2 hours. The slides were incubated with primary antibody (MYOC, catalog # 60357: Proteintech Group Inc, Rosemont, IL, USA; or GRP78, Catalog# ab21685: Abcam, Cambridge, MA, USA). The slides were washed 4 times with 1x PBS before incubating with Alexa Fluor secondary antibody (1:500; Invitrogen, Life Technologies, Grand Island, NY, USA) at room temperature for 2 hours. The slides were washed again and mounted with DAPI antifade mounting medium (Vectashield, Vector Laboratories Inc., Burlingame, CA, USA) as described previously 51, 59, 62, 65. For evaluating GFP expression in mice, the OCT sections were washed once with PBS and mounted with DAPI medium. Fluorescent images were captured, processed, and quantified using a Leica SP8 confocal microscope and LAS-X software (Leica Microsystems Inc., Buffalo Grove, IL, USA). Tissue sections and TM cells incubated without primary antibodies served as a negative control and were used to normalize the fluorescent intensities by background elimination. Sections of non-injected eyes served as a background control for GFP fluorescence. For quantifying staining specific to the mouse TM, a region of interest was drawn around the TM area and represented as the unit of fluorescence intensity per mm2. MYOC fluorescent intensity in TM3 cells stably expressing mutant MYOC was quantified by imaging thirteen to fifteen different non-overlapping areas of each treated wells. The fluorescent intensity was normalized using number of cells per image as determined by DAPI staining.
Western Blot: TM3 cells were lysed in 1x RIPA buffer containing protease inhibitors. Cellular lysates were loaded on denaturing 4%–12% gradient polyacrylamide readymade gels (NuPAGE Bis-Tris gels, Life Technologies). The proteins were separated using Invitrogen’s Mini Gel electrophoresis tank at constant voltage (150 V) and transferred onto a methanol-activated PVDF membrane (Immobilon-P, 0.45 mm pore size; Merk Millipore Ltd., St. Louis, MO, USA) as described previously 62. The blots were blocked with 5% nonfat dry milk prepared in 1x PBS with Tween-20 (PBST), followed by overnight incubation at 4oC with respective primary antibodies (1:1000 dilutions). The primary antibodies used were KDEL (catalog# MBP1-97469, Novus Biologicals, Littleton, CO, USA); MYOC (catalog# ab41552, Abcam); ATF4 (catalog# 10835-1-AP, Proteintech); CHOP (catalog# 15204-1-AP, Proteintech; 6003-1395, Novus). GAPDH (catalog# 60004-1-Ig, Proteintech) was used as a loading control. After overnight primary antibody incubation, the blots were washed with 1x PBST and incubated with respective horseradish-peroxidase (HRP)-conjugated secondary antibodies (1:2500 dilution) and developed with enhanced chemiluminescence (ECL) detection reagent (SuperSignal West Femto Maximum Sensitivity Substrate; Life Technologies). Protein bands were visualized using an LI-COR Biosciences Odyssey-Fc image system (Lincoln, NE, USA) and quantified using ImageStudio software (LI-COR Biosciences) as previously explained 65, 66.
Genomic endonuclease assay: Genomic DNA was isolated using NucleoSpin® Tissue (catalog# 740952, Macherey-Nagel, Allentown, PA, USA) from cells treated with LV_crMYOC, AAV2_crMYOC, LV_Null and AAV2_Null. Untreated cells were used as experimental control. MYOC, which is a target of selected gRNA was amplified by PCR. PCR product was denatured and reannealed using the Alt-RTM Genome Editing Detection Kit protocol (catalog# 1075932, Integrated DNA Technologies, Coralville, Iowa, USA). This generated mismatched heteroduplex DNA products containing strands with CRISPR/Cas9-induced indel reannealed to wild-type strands or different indel. The heteroduplexes were subsequently detected using T7 endonucleases (T7E1), that cleaved the mismatched DNA. The resulting cleaved products were analyzed by gel electrophoresis.
CRISPR-Cas9 off-target effects by whole genome sequencing (WGS): TM3 cells were transduced with lentivirus expressing Cas9 only (gScr), or Cas9 with gRNA against myocilin (gMYOC). 48 hours after infection, genomic DNA was extracted from gScr, gMYOC, and parental TM3 (NT) cells. Samples were sequenced on a Novaseq 6000 system at 30x coverage. The FASTQ files for all three samples (gMYOC, gScr, NT) were aligned to the human reference genome (GRCh37) with BWA-mem and sorted with SAMtools 67. The resulting BAM files were processed to remove duplicate reads with Picard Tools ( http://broadinstitute.github.io/picard/ ). Local realignment and base quality recalibration were performed with Genome Analysis Tollkit (GATK) 68. The most-likely off-target sites were determined using Cas-OFFinder 69 based upon the human reference genome (GRCh37), allowing the alignment of the gRNA to the genome to have up to 3 mismatches, DNA bulge size less than or equal to 1, and an RNA bulge size less than or equal to 1. The resulting 1214 unique sites were prioritized using the crisprScore package in Bioconductor, with the CFD algorithm 70. The top 100 sites were selected based upon their crisprScore. Each site was inspected visually using the Integrated Genome Viewer 71 with the analysis-ready BAM files for all three samples loaded. Sites were judged to be off target if indels were observed within 20 nt of the target in the gMYOC sample and not in any of the other samples.
Statistics: Statistical analyses were performed using Prism 9.0 software (GraphPad, San Diego, CA, USA). A P value of <0.05 was considered significant. Data was represented as mean ± SEM. An unpaired Student’s t test (two-tailed) was used for comparing data with two-groups. The IOP results that comprise more than two groups were analyzed by repeated-measures two-way ANOVA followed by a Bonferroni post-hoc correction.