Cell lines
The doxycycline inducible hTERT-immortalized human pancreatic cells (HPNE)/K-rasG12D were cultured in 35% DMEM, 35% F-12K medium, and 20% M3 Base medium and supplemented with 10% tetracycline-free fetal bovine serum (FBS). The doxycycline inducible T-Rex/K-rasG12V cells were cultured in DMEM supplemented with 10% tetracycline-free FBS. Human pancreatic cancer cell lines AsPC-1, BxPC-3 and PANC-1 were purchased from the American Type Culture Collection (ATCC, Rockville, MD), and were cultured in RPMI 1640 medium or DMEM medium with 10% FBS. All cell lines were monthly verified to be mycoplasma free by using mycoplasma PCR detection kit. None of the cell lines used in this study was on the list of commonly misidentified cell lines maintained by ICLAC and NCBI Biosample.
Animal tumor models
The animal study protocols are schematically illustrated in the related figures. To compare the in vivo growth of pancreatic cancer cells with or without SQLE knockdown, 2×106 BxPC-3 or PANC-1 cells with shControl or with shSQLE were injected subcutaneously into the flanks of nude mice (BALB/c Nude, 6-week-old, 7 mice per group). Tumor volume was calculated using the formula V = (length × width2) / 2. Moribund animals were promptly sacrificed to minimize animal distress and suffering. 2×106 AsPC-1cells were injected subcutaneously into the flanks of nude mice (BALB/c Nude, 6-week-old, 6 mice per group) to investigate the in vivo effect of terbinafine treatment on pancreatic animal model (80 mg/kg/three days, 15 days, intraperitoneal injection). 1×106 AsPC-1 cells were injected subcutaneously into the flanks of nude mice (BALB/c Nude, 6-week-old, 11 mice per group) to evaluate the effect of squalene (150 mg/kg/day, 43 days, intraperitoneal injection) on the pancreatic animal model. 2×106 AsPC-1cells were injected subcutaneously into the flanks of nude mice (BALB/c Nude, 6-week-old, 6 mice per group) to investigate the in vivo effect of squalene nanoparticle treatment on pancreatic animal model (32.5 mg/kg/2 days, 45 days, intravenous injection). All animal experiments were conducted in accordance with the institutional guidelines and approved by the Animal Care and Use Committee of Sun Yat-sen University Cancer Center. The investigators were not blinded to the group allocations during the experiments.
shRNA-mediated SQLE knockdown
The indicated cells (BxPC-3, AsPC-1 and PANC-1) were transfected with the shRNA plasmid psi-LVRU6GP targeting SQLE for 24 h. The target sequences for the validated shRNA of SQLE were CCCTCTTCTCGGATATTCTCT (shSQLE#A) and GGAGTTCAGTACAAGGATAAA (shSQLE#B). The transfected cells were established by selection with 2 µg/mL puromycin for two weeks. Stable transfected cell lines were then obtained and characterized by immunoblotting for SQLE protein levels.
SQLE overexpression in pancreatic cancer cells
HPNE cells were transfected with the SQLE overexpression plasmid pLVX-Puro-SQLE (Public Protein/Plasmid Library, China) for 24 h. The transfected cells were established by selection with 2 µg/mL puromycin for two weeks. Stable transfected cell lines were then obtained and characterized by immunoblotting for SQLE protein levels.
siRNA transfection
According to the manufacturer’s protocol, cells were transfected with 20 nM specific siRNAs targeting the genes of interest or with 20 nM control siRNA, using Lipofectamine RNAiMax (ThermoFisher, 13778150). Assays for expression of the target molecules were performed 48 h after the transfection. The sequences of siRNAs were listed as follows: human ERK2: GUACAGGGCUCCAGAAAUUT and ACACAAGAGGAUUGAAGUATT; human ERK1: CCUUAAGAUUUGUGAUUUCTT and GGGAGGUGGAGAUGGUGAATT; human DBP: CGAAGACAUCGCUUCUCAGAA; human ELF3: CCGAAAGCUGAGCAAAGAGUA and GCCAUGAGGUACUACUACAAA; human TFAP2E: CCUAGACCAGUCCGUGAUCAATT and CUUGACACACUUUAGCCUCAUTT; human Sp1: UGGUGGUGAUGGAAUACAUTT and GAGUCACCCAAUGAGAACATT.
RNA extraction and quantitative real-time PCR (qRT-PCR)
RNA extraction from cells was performed using RNA-Quick Purification Kit (EZbioscience, B0004D) and cDNA was produced with the Color Reverse Transcription Kit (with gDNA Remover) (A0010CGQ). Real-time PCR was performed using the 2× Color SYBR Green qPCR Master Mix (ROX2 plus) kit (EZbioscience, A0001-R2), and analyzed using the Bio-Rad detection system according to the protocol recommended by the manufacturer (Bio-Rad, Hercules, CA, USA). Primer information was provided in Supplementary Table 1.
MTS assays
For MTS assays, cells were seeded in a 96-well plate at 8×103 cells per well and treated with terbinafine or squalene at the indicated concentrations, while cells with SQLE overexpression or knockdown by shRNA were seeded at 3×103 cells per well. A total of 20 µL of the assay buffer containing 2 mg/ml MTS (G1111, Promega, Madison, USA) and 0.046 mg/ml PMS (P9625, Sigma) was added to each well and the plates were incubated for additional 3 h at 37°C. The absorbance of each well was measured at 490 nm by using a Multiskan plate reader (Biotek, Winooski, VT, USA).
Cloning formation assay
1000 cells were seeded into 6-well plates. Colonies were counted after 14 days of incubation under the optical microscope (Olympus CKX31-A12PHP, Japan).
Immunoblotting
The following antibodies were used: anti-SQLE (Proteintech,12544-1-AP,1:1000), anti-KRAS (Proteintech,12063-1-AP,1:1000), anti-GAPDH (Cell signaling,14C10,1:1000), anti-PGC1α+\(\beta\)(Abcam, ab188102,1:1000), total OXPHOS Rodent WB Antibody Cocktail (Abcam, ab110413,1:1000). Protein bands were detected by chemiluminescence using an ECL detection kit (Tanon,180–5001).
Measurement of Oxygen Consumption Rate (OCR) and Extracellular Acidification Rate (ECAR)
Experiments were conducted on a Seahorse XFe96 Extracellular Flux Analyzer (Agilent, Santa Clara, CA, USA) to determine OCR and ECAR. Briefly, 2×104 cells/well were seeded in culture medium and the sensor cartridge was hydrated in Seahorse XF Calibrant buffer and incubated in a CO2-free incubator at 37°C for 24 h. Then, culture medium was removed and replaced by assay medium. The microplates were then loaded into the XFe96 Analyzer. For the mitochondrial respiration test, the medium (pH 7.4) contained 1 mM pyruvate, 2 mM glutamine, and 10 mM glucose. Injection of compounds during the assay included: the mitochondrial ATP synthase inhibitor oligomycin (final concentration 1.5 µM), carbonyl cyanide p-trifluoromethoxyphenylhydrazone (FCCP; final concentration 1.0 µM), and a mixture of rotenone and antimycin A (final concentration 0.5 µM), for determining values for ATP production, maximal respiration and spare capacity. All data were under normalization.
Immunohistochemistry (IHC) analysis
The patient tissue microarray (HPanA150CS03) was bought from Outdo Biotech (Shanghai, China). A slice with 80 tumor specimens and 70 adjacent normal tissues was deparaffinized by xylene and ethanol. Endogenous peroxidase activity was blocked with 3% H2O2 for 15 min at room temperature. For antigen retrieval, the slide was heated in citrate buffer for 20 min. The slide was then incubated with anti-SQLE (Protentech,12544-1-AP,1:100 dilution) antibody overnight, followed by incubation with proper secondary antibody for 1 h at 37°C. DAB (3,3’-diaminobenzidine) was then applied as a substrate to reveal the antigen. Hematoxylin was used for counterstaining. All other reagents were from ZSGB-Bio (Beijing, China). Sections from each group were examined microscopically.
Liquid Chromatography coupled to Mass Spectrometry (LC-MS) analysis
PANC-1 or AsPC-1 cells (1×107) were washed 3 times with PBS. The cell pellets were collected and resuspended with 1 mL Hexane: H2O (3:1 v/v). After extraction by vortex shaking for 5 min and centrifuging for 15 min at 15,000 g at 4°C, the lipid containing layer was carefully collected and blow-dried with nitrogen at room temperature, followed by instrumental analysis using LC-MS (Agilent 1290 II) and data analysis by QQQ Quantitative software. The dry samples could be stored at 80°C before instrumental analysis.
Luciferase reporter assay
Luciferase reporter plasmid of PGC-1α promoter region (-2000 bp) was transfected into AsPC-1 cells with squalene treatment (200 µM 6 h), and PANC-1 cells with squalene treatment (200 µM 6 h). Luciferase activity was then measured using the Dual-Luciferase® Reporter Assay System (Promega, E1910). Luciferase reporter plasmid of TFAP2E promoter region (-2000bp) was transfected into PANC-1 or AsPC-1 cells with 200 µM squalene treatment for 24 h. Luciferase activity was then determined by Dual-Glo Luciferase Assay (E1910, Promega) and normalized to Renilla luciferase activity.
ChIP-qPCR
TFAP2E overexpression plasmid (pcDNA3.1(+)-Flag-TFAP2E) was transfected into PANC-1 cells, followed by ChIP assay. The cells pretreated with or without squalene (200 µM) were crosslinked by sufficient quantity of 1% formaldehyde. ChIP assays (Pierce Magnetic ChIP Kit, ThermoFisher, 26157) were performed according to the manufacturers' protocols. DNA fragments were pulled down by Flag antibody or by control IgG. PCR analysis was performed using specific primers encompassing the TFAP2E binding sites in the PGC-1α promoter region to detect the binding signal.
DNA pull-down assay
Three biotin-labeled double-stranded oligonucleotide probes for Sp1 and TFAP2E promoter sequence binding sites were synthesized, and sequences were listed as follows (5’to3’): TCCATGCCTCACCCCTCCCCTGAAAATGGGGA, TGCTTGTCAGGAGGGGAGGGTTGGGTT, GTGCCCGTCCGTCCTGCCTCCATGGACCCGC.
Briefly, 500 µg of nuclear protein extract with or without addition of squalene (200 µM) (Topscience,T4749) was mixed and incubated with 5 µg of the probe and 100 µL of streptavidin beads (Invitrogen, 65001) in a tube for 30 min. Then the tube was put in a magnet for 2–3 min, and supernatant was removed. The Dynabeads™ MyOne™ Streptavidin C1 beads were then resuspended in 20 µL of loading buffer, and boiled at 100°C for 10 min. The collected samples containing the bound proteins were separated by SDS-PAGE for further Western blot analysis.
Preparation for squalene nanoparticles
The prescribed amounts of squalene, Pluronic F127 were precisely weighed, then mixed with methylene chloride and dissolved by ultrasound, and the mixture was placed in a 250 mL round-bottom flask. The organic solvent was removed by reduced pressure and rotary evaporation at a certain temperature to form a transparent and uniform drug film, followed by completely removing the organic solvent through vacuum drying, adding an appropriate amount of normal saline, hydrating at a certain temperature for 30 min, and filtering by 0.22 µm acetate filter membrane to remove oversize particles.
Statistical analyses
Statistical analyses were performed with GraphPad Prism software (San Diego, CA, USA). Data were calculated as the mean ± S.D. from at least three independent experiments. A p value of less than 0.05 was considered statistically significant. Student’s t-test was used to evaluate the statistical significance of the difference between two groups of samples with normal distributions. When there were more than two independent groups, analysis of variance (ANOVA) models was used to compare the means of samples with normal distribution. The overall survival of cancer patients with different levels of SQLE expression in PDAC was compared using Kaplan–Meier plots, and the statistical significance was analyzed by the log-rank (Mantel–Cox) test.