Animal groups
All the experiment and procedures were approved by the guidelines of the Institutional Animal Care and Use committee of Air Force Medical University. Male mice C57BL/6 mice (aged 8–12 weeks, weighing 22–25 g) were harvested from the Animal center of Air Force Medical University. Mice were kept under environment of 22°C, relative humidity of 65%, and given free access to food and water in a standardized light-dark cycle. All procedures are designed to reduce the suffering of mice and the number of mice used.
Experiment design
In the first step, firstly, to obtain optimal drug concentration, animals were randomly divided into tMCAO/R + DMSO group, tMCAO/R + 20 µg/kg DCPIB group, tMCAO/R + 40 µg/kg DCPIB group, tMCAO/R + 60 µg/kg DCPIB group and tMCAO/R + 80 µg/kg DCPIB group (n = 15/ each group) by assessing seven-day mortality. Secondly, to improved behavioral performance of mice after the tMCAO/R, animals were randomly divided into the following three groups: sham group, tMCAO + DMSO group and tMCAO + DCPIB group at the concentration of DCPIB 40g/kg (n = 10/ each group).
In the second step, to evaluate pathological injury by TTC assay, HE staining, brain water content measurement, IGg immunofluorescence staining, animals were randomly divided into the following three groups: sham group, tMCAO + DMSO group and tMCAO + DCPIB group at the concentration of DCPIB 40g/kg (n = 10/ each group).
The third step, to clarify effect of DCPIB on microglial polarization, animals were randomly divided into the following three groups: sham group, tMCAO + DMSO group and tMCAO + DCPIB group (n = 3/ each group). We detected M1/M2 microglial in the penumbra by immunofluorescent double staining (CD206/CD86 and Iba-1) and M1/M2-related cytokines by qPCR and ELISA. In addition, in vitro, primary microglia were divided to four groups: control group, control + DCPIB group, LPS plus IFN-γ group and LPS plus IFN-γ + DCPIB or control group, control + DCPIB group, IL-4 group and IL-4 + DCPIB (n = 3/each group). We detected M1/ M2-related cytokines by qPCR and ELISA. At the same time, we also detected the protective effect of DCPIB on primary neuron from microglia-mediated inflammatory response in vitro and in vivo. Firstly, the conditioned medium (CM) from different groups supernatant including primary microglia as control group, primary microglia + DCPIB as control + DCPIB group, M1 microglia induced by LPS plus IFN-γ, and DCPIB-treated M1 microglia induced by LPS plus IFN-γ were used to culture primary neurons for 24h (n = 5/each group). We detected neuronal damage by MAP2 immunofluorescence staining, cell viability, and LDH release of neurons in four groups. Secondly, to evaluate the neurons injury and apoptosis in ischemic penumbra, animals were randomly divided into the following three groups: sham group, tMCAO + DMSO group and tMCAO + DCPIB group (n = 5/ each group). We detected neuronal damage by MAP2 and TUNEL immunofluorescence.
Next, to investigated signal pathways and molecular mechanisms of DCPIB on microglial polarization, primary microglia were divided into three groups: Con; LPS + IFN-γ group; LPS + IFN-γ + DCPIB group; (n = 5/ each group). We analyzed the effects of DCPIB on the phosphorylation of MAPKs by Western blot.
The last step, to clarify effect of DCPIB on oxidative stress after tMCAO/R and in vitro. Firstly, animals were randomly divided into the following three groups: sham group, tMCAO + DMSO group and tMCAO + DCPIB group (n = 5/ each group). Secondly, Primary neurons were randomly divided into the following three groups: control, control + DCPIB, OGD/R, OGD/R + DCPIB (n = 5/ each group). We measured the level of ROS, MDA, SOD, and GSH by ROS, MDA, SOD and GSH assay kits, respectively.
Drug administration
Five minutes after reperfusion, DCPIB (Tocris) in 3% dimethyl sulfoxide (DMSO), or DMSO alone, was administered manually over 20 seconds by intracerebroventricular injection (1.0mm posterior and 0.4 mm lateral to the bregma) (depth, 2.3 mm from the bone surface).
Transient Middle Cerebral Artery Occlusion and reperfusion model preparation
The tMCAO/R mouse model was developed using the intraluminal filament technique. Briefly, the mice were anesthetized with isoflurane in 30% oxygen and 70% nitrous oxide, and placed on a heating blanket to maintain body temperature at 37 ± 0.5°C. The common carotid artery (CCA), external carotid artery (ECA), and internal carotid artery (ICA) were carefully dissected and exposed via a midline incision. The CCA was temporarily closed and line embolism (the diameter/length of Silicone thread end 0.20-0.21mm/ 3∼4mm, the diameter/length of thread body 0.1mm/3cm (Render Life Technology Company, Shenzhen, China) was delivered to the ICA through the ECA until it reached the middle cerebral artery. Reperfusion was produced by withdrawal of line embolism to ICA 90 min after the occlusion. The sham-operated mice, arteries were visualized but not ligated. After the surgery, the mice were allowed to completely recover from anesthesia on a heating blanket to maintain body temperature at 37°C and subsequently returned to the home cages.
Assessment of neurological function
The modified neurological severity score (mNSS), rotarod test, corner-turning test were strictly carried out to assess neurological impairment, motor ability and sensorimotor asymmetry at 1, 3 and 7 days after surgery. mNSS criteria were used to evaluate neurological function as follows: 0, no deficit; 1–6, mild deficit; 7–12, moderate deficit; 13–18, severe deficit. mNSS was used to verify the ischemic state at 1 day after tMCAO/R. mNSS < 6 or > 13 at 24 h after tMCAO were excluded. All animals underwent 3 consecutive days training for 3 min at a constant speed of 4 rpm to get used to rotarod before MCAO/R surgery experiments. The non-ischemic mouse turned left or right with equal frequency, but the mouse suffered from MCAO/R preferentially turned toward the impaired (right side in our experiment). When the mice did not suffer from cerebral ischemia, they turned to the right or left at the same frequency. However, the mice turned toward the impaired side after cerebral ischemia. The formula of right biased turning percentage was following: right-biased turning percentage = right biased turning/total turning ×100%. The assessment procedure was performed by the same investigator who was blinded to the group identity of each mouse.
TTC assay
At 1, 3 and 7 days following MCAO/R, the animals were sacrificed by cervical dislocation without any chemical agents and the brains were sliced into 1mm sections. The sections were then incubated in 2% 2,3,5- triphenyltetrazolium chloride (TTC) (Solarbio, G3005) dissolved in saline phosphate buffered saline (PBS) at 37°C for 30 min in the dark. After TTC staining, the brain slices were scanned and measured. The infarct regions were quantified by Image J software (Bethesda, Maryland, USA). The formula of calculate infarct percentage was following: infarct percentage = infarct volume/volume of the contralateral hemisphere × 100%.
Brain Water Content measurement
Cerebral edema was assessed 1, 3 and 7 days after reperfusion by dry/wet weight measurement. Briefly, brain tissues were collected without perfusion, and the wet weights were measured on an analytical balance. Dry weights were assessed after heating the specimens for 24 h at 105°C. The formula of calculate the brain water content was following: (wet weight-dry weight)/wet weight × 100%.
Immunofluorescence Staining and Cell Counting
We obtained brain slices 1, 3 and 7 days after surgery for immunofluorescence analysis. The slices were incubated overnight at 4°C with following primary antibodies including: anti-rabbit-CD86 (Servicebio, GB13585, 1:2000), anti-rabbit-CD206 (Abcam, AB64693, 1:2500), anti-rabbit-MAP2 (Servicebio, GB11128-2, 1:500), TUNEL kit (Servicebio, G1501), anti-rabbit-Iba1 (Servicebio, GB113502, 1:10000) according to manufacturer’s instructions. Subsequently the slices were incubated with corresponding secondary antibodies for 1 h at room temperature (RT) and DAPI (Servicebio, G1012) was used to counterstain the nuclei.
In vitro experiments, primary cortical neurons were fixed in 4% paraformaldehyde for 15 min, and blocked with 5% BSA containing 0.1% Triton X-100 for 1 h. After washing three times, the cells were incubated overnight at 4°C with MAP2 (Servicebio, GB11128-2, 1:500). Thereafter, the cells were incubated with secondary antibody for 1 h at room temperature and DAPI (Servicebio, G1012) was used to counterstain the nuclei, subsequently analyzed by a confocal microscope (LSM880, CarlZeiss).
All images were processed with Image J software (Bethesda, Maryland, USA) to calculate the number of recognized cells by an investigator blinded to the experimental groups. The means were calculated from three randomly selected microscopic fields in the striatal penumbra adjacent to the ischemic core, respectively. Three consecutive sections were analyzed for every brain tissue. The data are expressed as mean numbers of CD86/CD206 positive cell cells per square millimeter or the percentage TUNEL positive cells.
HE and Nissl staining
Histological features of the infarct areas at 7 days following tMCAO/R were assessed by HE staining and Nissl staining according to the manufacturer’s instructions. For HE staining, the brains were perfused with PBS, and fixed in 4% paraformaldehyde buffer for 24 h at 4°C, followed by trimming into appropriate shape and thickness. The sections were made, dehydrated in gradient xylene and ethanol, and observed under the microscope after Hematoxylin and eosin (H&E) staining (Servicebio, G1005). For Nissl staining, the brain sections were first deparaffinized and then rehydrated successively. Finally, slices were stained in Nissl staining solution (Servicebio, G1036) for 5 min at 37°C. The images were acquired with an electron microscope (Leica DMi8, Germany) and ImageJ was used to analyze the results.
Quantitative real-time PCR (qRT-PCR)
Total RNA was extracted from sham brain, penumbral tissue or culture cells using Trizol reagent (TIANGEN, DP421) according to the manufacturer’s instructions. One microgram of each total RNA was reverse transcribed into cDNA using the RT-PCR Prime Script reagent Kit (Takara) following the manufacturer’s protocol. Real-time qPCR was carried out using SYBR Green Master Mix (Yeasen) in a Step One Plus instrument (Applied Biosystems). The mRNA expressions of CD86, iNOS, TNF-α, IL-6, CD206, Arg-1, TGF-β, IL-10 and GAPDH were quantified. Relative mRNA expression was quantified by the 2−ΔΔCt method, with GAPDH mRNA serving as the endogenous control. The primers were purchased from Sangon Biotech; The primers used in this study as following: TNF-α forward: GACGTGGAACTGGCAGAAGAG, TNF-α reverse: TTGGTGGTTTGTGAGTGTG
AG. CD86 forward: TTGTGTGTGT TCTGGAAACGGAG, CD86 reverse: AACTTAGAGGCTGTGTTGCTGG G. iNOS forward: GTTCTCAGCCCAACAATACAAA, iNOS reverse: GTGGACGGGTCGATGTCAC. IL-6 forward: GTCCGGAGAGGAG ACTTCAC, IL-6 reverse: CTGCA AGTGCATCATCGTTGT.Arg-1 forward: GAACACGGCAGTGGCTTTAAC, Arg-1 reverse: TGCTTAGCTCTGTCTGCTTTGC.CD206 forward: AGGTGGCCTCTT GAGGTATGTG, CD206 reverse: GTCAACCCAAGGGCTC TTCTAA.IL-10 forward: GGTTGCCAAGCCTTATCGGA, reverse: ACCTGCTCCACTGCCTTGCT. TGF-β forward: GGAGCCACAAACCCCGCCTC, TGF-β reverse: GCCAGCAGGTCCGAGGGGA.
Enzyme-linked immunosorbent assay (ELISA)
The levels of IL-6, TNF-α, IL-10 and TGF-β from sham brain, penumbral tissue or primary microglia were quantitated by a corresponding ELISA kit including IL-6 (Cusabio Biotech, CSB-E04639m), TNF-α (Cusabio Biotech, CSB-E04741m), IL-10(Cusabio Biotech, CSB-E04741m), and TGF-β (Cusabio Biotech, CSB-E04741m) following the manufacturer’s protocol.
Western blot (WB)
Brain tissue of ischemic penumbra from different groups were lysed in RIPA lysis buffer containing protease blockers for 30 min on ice and crude extracts were sonicated to shear DNA. Protein samples were separated by 10% SDS-PAGE and electrotransferred to a polyvinylidene fluoride (PVDF) membrane with the electrophoretic transfer system (Bio-Rad Laboratories, Hercules, CA, USA). The PVDF membranes were blocked with 5% skimmed milk for 1 h at RT, and incubated with the primary antibodies including anti-rabbit-ERK1/2 (CST, 4695S, 1:1000), anti-rabbit-p-ERK1/2 (CST, 4370S, 1:1000), anti-rabbit-JNK (CST, 9252S, 1:1000), anti-rabbit-p-JNK (CST, 4668S, 1:1000), anti-rabbit-p38 (CST, 8690S, 1:1000), anti-rabbit-p-p38(CST, 9216S, 1:1000) overnight at 4 ◦C. The membranes were washed three times with Tris-buffered saline plus Tween, and incubated with corresponding secondary antibodies for 1 h at RT. Finally, the membrane was visualized with chemiluminescence and analyzed with ChemiDoc XRS+(BIO-RAD). All blot Images were analyzed and relatively quantified with ImageJ analysis software.
Cell culture and treatment
Primary microglia-enriched cultures were prepared from the whole brains of 1-day-old pups as described previously17. After a confluent monolayer of glial cells was obtained (12–14 days after initial seeding), microglia were shaken off, collected, and seeded. To induce polarized microglia and inflammatory secretion, As described previously7, primary microglia cells were pretreated by LPS (100 ng/mL, Solarbio, L8880-10mg) plus IFN-γ(20 ng/mL, PeproTech, AF-200-04) or by IL-4 (20 ng/mL, PeproTech, AF-300-02) for 48 h to become M1 type or M2 type. DCPIB (10µM in 3% DMSO, Rocris, 82749-70-0), was treated after primary microglia were stimulated18,19.
The primary neurons were dissected from 13–15 days embryonic mouse, and cultured for 7 days to culture with CM from primary microglia, primary microglia + DCPIB, M1 microglia or DCPIB-treated M1 microglia as described previously20 and then immunofluorescence staining for MAP2 was conducted. Concomitantly, the neurons viability was evaluated by cell count kit (DIYIBIO, DY40201) and LDH release of neurons were detected by LDH kit (Nanjing Jiancheng Bioengineering Institute, A020-1) following the manufacturer’s instructions.
Oxygen and Glucose Deprivation and Reperfusion (OGD/R)
Briefly, before OGD/R injury was induced, primary neurons were rinsed twice with PBS and maintained in glucose-free DMEM. The cells were then placed into a hypoxic incubator (MIC-101, Billups-Rothenberg Inc) under 1% O2, 5% CO2, and 94% N2 at 37° C to mimic OGD injury carried out for 2h. The culture medium was then replaced with glucose-containing DMEM, and the cells recovered under normoxic conditions (37° C, 5% CO2) for reperfusion 6h. DCPIB (10µM in 3% DMSO, Rocris, 82749-70-0), was treated after primary neuron OGD 2h.
Measurement of ROS, SOD, GSH and MDA levels
The degree of reactive oxygen and lipid peroxidation in the brain tissue of mice and primary neuron was determined by detecting the ROS and MDA levels. The antioxidant capacity of brain tissue and cell was evaluated by analyzing the SOD activity and GSH content. The fluorescence value of ROS production was measured by chemiluminescence method, using ROS detection kit (LCSSH-1402Y, Lunchangshuobiotech, Xiamen, China). The content of MDA GSH and MDA were measured by SOD, GSH and MDA assay kits, respectively, following the manufacturer's directions (ED-21637, LCSJZF20344, LCSJZF20344, Lunchangshuobiotech, Xiamen, China).
Statistical analysis
All statistical analyses of the data and graphs making were processed with GraphPad Prism 9.0 software. All data are expressed as the mean ± standard deviation (SD). Log-rank (Mantel-Cox) test was used to compare the survival rate of the tMCAO/R model. An unpaired t-test was used to compare differences in the means of two sample groups, and one-way ANOVA was used to compare the means of multiple samples. Statistical significance was considered at P < 0.05 level.