Neferine inhibits BMECs pyroptosis and maintains blood-brain barrier integrity in ischemic stroke by triggering a cascade reaction of PGC-1α

doi:10.21203/rs.3.rs-3865731/v1

Download PDF

Article

Neferine inhibits BMECs pyroptosis and maintains blood-brain barrier integrity in ischemic stroke by triggering a cascade reaction of PGC-1α

https://doi.org/10.21203/rs.3.rs-3865731/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 23 Jun, 2024

Read the published version in Scientific Reports →

You are reading this latest preprint version

Blood-brain barrier disruption is a critical pathological event in the progression of ischemic stroke (IS). Most studies regarding the therapeutic potential of neferine (Nef) on IS have focused on neuroprotective effect. However, whether Nef attenuates BBB disruption during IS is unclear. We here used mice underwent transient middle cerebral artery occlusion (tMCAO) in vivo and bEnd.3 cells exposed to oxygen-glucose deprivation/reoxygenation (OGD/R) injury in vitro to simulate cerebral ischemia. We showed that Nef reduced neurobehavioral dysfunction and protected brain microvascular endothelial cells and BBB integrity. Molecular docking, short interfering (Si) RNA and plasmid transfection results showed us that PGC-1α was the most binding affinity of biological activity protein for Nef. And verification experiments were showed that Nef upregulated PGC-1α expression to reduce mitochondrial oxidative stress and promote TJ proteins expression, further improves the integrity of BBB in mice. Intriguingly, our study showed that neferine is a natural PGC-1α activator and illustrated the mechanism of specific binding site. Furthermore, we have demonstrated Nef reduced mitochondria oxidative damage and ameliorates endothelial inflammation by inhibiting pyroptosis to improve BBB permeability through triggering a cascade reaction of PGC-1α via regulation of PGC-1α/NLRP3/GSDMD signaling pathway to maintain the integrity of BBB in ischemia/reperfusion injury.

Biological sciences/Cell biology/Organelles/Mitochondria

Health sciences/Pathogenesis/Inflammation/Inflammasome

Biological sciences/Drug discovery/Pharmacology

Ischemic stroke

Blood-Brain Barrier

transient middle cerebral artery occlusion

Oxygen and glucose-deprivation/reperfusion

Neferine

PGC-1α

Ischemic stroke is a significant contributor to mortality and disability among adults worldwide. Blood-brain barrier (BBB) plays a critical role in the progression of IS which regulates exchanges of substances between brain and blood. Following the occurrence of IS, it is often accompanied with BBB disruption, and subsequently worse neurological outcomes occurred. BBB integrity is crucial for maintaining the central nervous system homeostasis in IS. Brain microvascular endothelial cells (BMECs), as the mainly physiological structure composition, play a central role in maintaining BBB integrity. Therefore, restoring BMECs function to reestablish integrity of BBB is essential to decrease IS nervous system impairment.

Neferine (Nef) is a Bisbenzylisoquinoline Alkaloids which extracted from Plumula Nelumbinis. Nef exhibits diverse pharmacological activities, including neuroprotection, anti-platelet aggregation, vasodilation, blood pressure reduction, antioxidant^1–3. Previous research shows that Nef modulated neurone Nrf2 signalling to protect mitochondrial⁴, diminishing oxidative stress and apoptosis to exert its neuroprotective effect⁵. Research of Nef in IS were focused on neuroprotective effects, the mechanisms of Nef protective effects on BBB remains unclear. Nef has anti-inflammatory effects on LPS-induced endothelial cells injury to prevent atherosclerosis in the early stroke and heart disease⁶. Nef also protects endothelial cell in CKD by blocking the ROS/NLRP3/Capsase-1 signaling pathway⁷. Nef inhibits several inflammatory triggers disease which linked with the aberrant activation of the NOD-like receptor 3 (NLRP3) inflammasome^8,9. Previous studies have clarified that Nef could inhibits activated NLRP3 inflammasome, but the specific protein target in anti-inflammatory pathway still not identified. And the impact of Nef on vascular endothelium after stroke is also unclear. We speculate that Nef may maintain the integrity of BBB in IS by protecting BMECs, and the protection effects may be related to signal molecules upstream of NLRP3. To confirm the hypothesis, we employed the transient middle cerebral artery occlusion (tMCAO) in vivo and oxygen glucose deprivation/reperfusion (OGD/R) in vitro to clarify the protective effect of neferine on BBB following ischemic stroke.

Ethics Statement

This study utilized male C57BL/6J mice procured from Changsheng Biotechnology Technology Co., Ltd. (Liaoning, China). Standard environmental conditions were provided for the mice to minimize environmental variability. All animal protocols were implemented in strict accordance with ARRIVE guidelines (https://arriveguidelines.org) and approved by the Ethics Committee of Hubei University of Chinese Medicine (Approval No. HUCMS22702282).

Establishment of the transient middle cerebral artery occlusion (tMCAO) model

A total of 90 male C57BL/6J mice (aged 6–8 weeks and weighing 20–22 g) were used in short-term tMCAO experiments. Six groups were formed at random: control group, sham group, vehicle group, 30 mg/kg Nef group, 60 mg/kg Nef group, and 60 mg/kg NBP group.

Dl-3n-butylphthalide (NBP), a synthetic medication derived from Apium graveolens Linn seeds (celery), has been approved by the Food and Drug Administration (FDA) for phase II clinical trials in patients with acute ischemic stroke since 2016¹⁰. NBP has been found to possess diverse pharmacological actions, such as promoting cerebral microcirculation and improving mitochondrial function ^11–13. Due to its protective effect on BBB during IS ¹⁴, it was adopted as a positive drug. Each group consisted of 12 animals that underwent a successful operation for subsequent experiments. A total of 1% of mice failed to achieve successful reperfusion following the tMCAO procedure, and approximately 20% died within one day.

The tMCAO procedure was carried out in accordance with the methods described previously. ¹⁵. To mitigate the influence of hormonal disturbances in female mice post-tMCAO surgery, only male mice were studied. Briefly, mice were anesthetized by intraperitoneal injection of pentobarbital sodium at a dose of 70mg/kg, and a monofilament nylon suture with a round tip was inserted into the internal carotid artery via the right common carotid artery, avoid pterygopalatine artery and finally accessed the middle cerebral artery. It was placed for 45 min until the blood flow was restored by withdrawing the filament for reperfusion. The wounds were carefully sutured to prevent infection. The sham group underwent all surgical procedures, excluding the insertion of nylon sutures. Additionally, all mice were allowed free access to food and water.

Drug administration

Neferine (Nef, CAS number 2292-16-2, purity over 98%) was obtained from Biopurify (Chengdu, China). The vehicle solution used for dissolving Nef consisted of 10% DMSO and 90% corn oil. Dl-3n-butylphthalide (NBP, CAS number 6066-49-5, purity over 95%) was obtained from Macklin (Shanghai, China). NBP was diluted with corn oil. At 2 and 12 hours after surgery, separate groups of mice were treated with a volume of 0.2 mL via intragastric gavage of NEF (30, 60 mg/kg), NBP (60 mg/kg) or vehicle.

Measurement of assessment

At the end of 24 h reperfusion, neurological status of mice was assessed using the Zea Longa neurological scoring system, as mentioned earlier ¹⁶. For this study, mice with scores ranging from 1 to 3 were included as the tMCAO model mice.

Quantification of the infarct volume, cerebral edema volume, and cerebral water content

At 24 h post-reperfusion, mice were euthanized by cervical dislocation. All brains were collected and divided into five sections, then immersed immediately in a 0.5% solution of 2,3,5-triphenyltetrazolium chloride (TTC, G1017, Servisebio, Wuhan, China) at 37 ℃ for approximately 30 min. A red stain appeared on normal brain tissues, while infarcted parts displayed in white. To correct the brain swelling volume due to cerebral edema, the area of the ipsilateral uninfarcted brain slice was subtracted from the contralateral hemisphere brain slice area to determine as infarct volume. Once the brain tissues were removed, any surplus water in the vicinity of the tissue was soaked up, and the weight was documented as wet weight. Afterward, a 72-hour desiccation process in an oven set at 80°C was employed to ensure complete removal of moisture in brain tissues. The weight obtained following the drying phase was denoted as the dry weight. Subtract dry weight from wet weight to determine brain water content.

BBB permeability measurement

Mice were injected with 2% Evans Blue (E104208, Aladin, Shanghai, China) staining solution (4ml/kg) through the tail vein 1 hour before the end of reperfusion in accordance with the earlier descriptions to evaluate BBB permeability^17,18, and blue coloration of the conjunctiva, ears, and limbs was observed. After complete anesthesia of mice, open the chest to completely expose the heart, excise the right atrial appendage, and saline solution was infused into the mice via the left ventricle, take the brain from the head after the fluid flowing out from the right atrium becomes clear. Cut out the brain tissue from the right ischemic area, add an appropriate amount of formamide in a ratio of 100: 1 for the brain tissue (mg): formamide (ml), and prepare the brain homogenate by thorough grinding using a homogenizer. The homogenate was incubated at 45°C under light-protected conditions for 48 h. Afterward, the homogenate was centrifuged (1000 × g, 15 min) to obtain the supernatant. OD values at 632 nm were determined for each group utilizing a microplate reader (Tecan SunriseTM, Austria), and brain EB concentration of each group were measured by utilizing a standard curve as a reference.

Histopathological examination

The whole brain tissue was fixed for 24 hours in 4% paraformaldehyde at room temperature before undergoing paraffin embedding and subsequent sectioning into 5µm thick coronal slices, including the cortical infarct region. Utilizing the Hematoxylin/Eosin (H&E) staining to provide a clear visualization of the tissue morphology and cellular architecture of the cortical region in the brain, and examine the stained sections of each group using an optical microscope (Olympus, Tokyo, Japan).

Immunohistochemistry

Saline perfusion was carried out in the mice to eliminate blood from the vasculature, and then fix brain tissue with 4% paraformaldehyde. Following fixation, the tissues were dehydrated and sliced into 20 µm frozen sections. Sections were then blocked with 3% BSA (Vector Laboratories, Burlingame, CA, USA) for 30 min, and incubated with the following primary antibodies overnight at 4°C: NLRP3, PGC-1α, Occludin, and ZO-1. After that, the sections were incubated with appropriate HPR-labeled secondary antibodies for 50 min at room temperature followed by with a 3 min staining of Hematoxylin dye solution (Servicebio, Wuhan, China) at room temperature. Fluorescence images of the specimen were acquired using the Olympus fluorescence microscope FV3000 and Image J software was employed for the measurement of fluorescence intensity. The working dilution of specific antibodies can be found in Supplementary materials.

Cell cultures

Mouse brain endothelial cells (bEnd.3, No. CL-0598, Procell, Wuhan, China) were cultured in the complete endothelial cell medium (CM-0598, Procell, Wuhan, China) in a humidified incubator at 37°C with 5% CO2 and 95% air.

Oxygen-glucose deprivation/reoxygenation (OGD/R) establishment and drug treatment

Cells were subjected to OGD/R to simulate I/R injury. Upon reaching 80–90% confluence, bEnd.3 cells were placed in glucose-free DMEM (Procell, Wuhan, China) that had been degassed by ultrasonication. Then, cells were treated with Nef at concentrations of 0.1µM, 0.5µM or 1µM, and transferred to a chamber consisting of 5% CO2 and 95% N2 for 9 hours. Following the hypoxia exposure, replace the media with fresh growth medium and incubated another 12 h under normoxic conditions for reperfusion.

Cell viability assays

A colorimetric CCK-8(GK10001, GLPBIO, CA, USA) assay was utilized for cell viability measurement. After OGD/R treatment, cell viability data exserts a relative percentage change compared to the untreated control group. Furthermore, a commercial assay kit (LDH, C0016, Beyotime, Shanghai, China) was employed to measure LDH release, a marker of cellular toxicity. Briefly, 50µl of culture medium from each group was transferred to another 96-well plate, followed by LDH measurement using the manufacturer-provided test reagent. Additionally, the visualization of live and dead cells was conducted employing a Live/Dead assay kit (BB-4126, BestBio, Shanghai, China). Fluorescence images of the specimen were acquired using the Olympus fluorescence microscope FV3000 and Image J software was employed for the measurement of fluorescence intensity.

Tube Formation Assay

The analysis of tube formation was conducted using Matrigel basement membrane matrix with growth factor-reduced (082701, ABWbio, Shanghai, China). Briefly, a volume of 60 µL of Matrigel matrix was added to a 24-well plate. The pretreated bEnd.3 cells were then seeded and incubated for 6 hours. Microscope photos were then obtained from three randomly chosen optical fields at a magnification of ×100. Analysis of the tube branch length was conducted by an uninformed experimenter, utilizing the "Angiogenesis Analyzer" plugin in Image J software. Each experiment was conducted a minimum of three times.

Endothelial Barrier Permeability Measurement

To assess endothelial barrier permeability, transmembrane electrical resistance (TEER) values of endothelial cell monolayer were measured using transmembrane resistance measuring instruments (EVOM2, WPI, Florida, USA) at time points of OGD, reoxygenation initiation, and 12 hours of reperfusion. TEER values were calculated as followed:

TEER (Ω × cm²) = (total resistance − blank resistance) (Ω) × insert area (cm²)

The flux of Evans blue-labeled albumin (EBA: 1% BSA + 167.5 µg/ml Evans blue; 67 kDa) across the cell monolayer was measured according to previous report¹⁹. Following 12h reoxygenation, 50 µL of EBA was added to the transwell inserts. Over the next six hours, media from the lower chambers from each group were collected hourly to measure optical density at 630 nm.

Oxidative Stress Assay

Levels of superoxide dismutase (SOD, S0101S, Beyotime, Shanghai, China) and malondialdehyde (MDA, S0131S, Beyotime, Shanghai, China) were measured to assess intracellular oxidative stress using commercially available kits. The experiments were conducted in triplicate using 6-well plates for each condition.

Western blot analysis

Cellular protein extraction was accomplished using Cell lysis buffer for Western and IP (P0013, Beyotime, Shanghai, China) in accordance with the manufacturer’s instructions. SDS-PAGE was employed to separate the protein samples (30 µg per group), followed by transferred onto a PVDF membrane (0.45 µm pore size, Millipore, MA, USA). The membrane blocked for 30 min and incubated overnight at 4°C with primary antibodys against ZO-1 (1: 5000; 21773-1-AP, Proteintech Group, Wuhan, China), Occludin (1: 5000; 66378-1-Ig, Proteintech Group, Wuhan, China), PGC-1α (1: 5000; 66369-1-Ig, Proteintech Group, Wuhan, China), NLRP3 (1: 1000; #15101, CST, MA, USA), AIM2 (1: 1000; #63660, CST, MA, USA), ASC/TMS1 (1: 1000; #67824, CST, MA, USA), IL-1β (1: 1000; #31202, CST, MA, USA), Cleaved-Caspase-1 (1: 1000; #89332, CST, MA, USA), Caspase-1 (1: 1000; #24232, CST, MA, USA), GSDMD (1: 2000, bs-14287R, Bioss, Beijing, China), IL-18(1: 2000, bs-42148R, Bioss, Beijing, China) β-actin (1: 5000; bs-0061R, Bioss, Beijing, China). After that, the membrane were interacted with the respective secondary antibody for 1.5 h. β-actin was used as a loading reference. The protein bands were detected using ECL method (MA0186-1, Meilunbio, Dalian, China) and developed with gel densitometric scanning.

Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)

TRIzol reagent (BS258A, Biosharp, Anhui, China) was employed to obtain total RNA from bEnd.3 cells. Subsequently, DNA contamination was eliminated from the total RNA, and cDNA was synthesized using the ABScript II cDNA First Strand Synthesis Kit (RK20400, ABclone, Wuhan, China). In the end, cDNA was mixed with specific primers and qRT-PCR was performed using TOYOBO SYBR Green Realtime PCR Master Mix (QPK-201, TOYOBO, Japan) to validate the expression of specific mRNAs. The specific primers listed below were utilized for PCR amplification of the cDNA fragment. NLRP3 forward: 5′-GCATTGCTTCGTAGATAGAGG-3′, reverse: 5′-GA GAAGGACCCACAGTGTAA-3′; PGC-1α forward:5′-AGTTTTTGGTGAAATTGAGGAAT-3′, reverse: 5′- TCATACTTGCTCTTGGTGGAAGC';Occludin forward:5′- AGGACGGACCCTGACCACTA-3′, reverse: 5′- CCTGCAGACCTGCATCAAAA′༛ZO-1 forward: 5′- CACAAGGAGCCATTCCTGAAG-3′, reverse: 5′-ATCACTAGGGGGCTCAGCAG′; β-actin forward: 5′-CGTGCGTGACATCAAAGAGA-3′, reverse: 5′-CCCAAGAAGGAAGGCTGGA-3′. The 2 − ΔΔCt method was used to calculate the relative gene expression levels, and β-actin expression served as endogenous internal control.

Mitochondrial ROS (mtROS) measurement

The mtROS level was assessed with MitoSOX Red Mitochondrial Superoxide Indicator (C1071S, Beyotime biotechnology, Shanghai, China). Following OGD/R injury, the cells underwent centrifugation at 1000g for 5 minutes and were then washed with PBS. Mito-Tracker Red CMXRos and Hoechst 33342 were then added and incubated in dark for 30 min. Fluorescence images of the specimen were acquired using the Olympus fluorescence microscope FV3000 and Image J software was employed for the measurement of fluorescence intensity.

Mitochondrial membrane potential (MMP) measurement

Mitochondrial Membrane Potential Assay Kit (E-CK-A301, Elabscience, Wuhan, China) was employed to assess the MMP in bEnd.3 cell. Briefly, JC-1 dye solution was added to cells and incubated for 20 min after OGD/R injury, followed by 5 min incubation with Hoechst 33342. Olympus Fluorescence FV3000 microscope was employed to observe the fluorescence and Image J software was employed for the measurement of fluorescence intensity.

Molecular Docking

To initiate the molecular docking process, the PGC-1α protein structure (PDBID: 3B1M) was imported from the RSCB PDB database in PDB format, while the 3D structure of Neferine was obtained from PubChem. Using PyMOL software, water molecules were removed, and the ligand was isolated. After employing AutoDock Tools 1.5.6 to perform tasks such as hydrogen addition, charge calculation, and atomic type assignment. Subsequently, AutoDock Vina 1.1.2 was utilized for molecular docking simulations to investigate the binding characteristics between the Nef ligand and PGC-1α protein. The binding energy, which serves as an evaluation index for molecular docking, was calculated. The optimal conformations of Nef and PGC-1α were determined by analyzing the clusters within the docking results, which were selected based on their respective binding energies. Typically, a lower docking energy indicates a stronger interaction force between the components, and a threshold of -7 kcal/mol is often used. The epitope with the lowest affinity scores predicted by AutoDock Vina was subjected to LigPlot + and PyMol for further visualization of the interactions.

Short Interfering (Si) RNA and Plasmid Transfection

Cells cultivated in a 6-well plate with OPTI medium (31985062, Invitrogen, CA, USA) were transfected with either PGC-1α siRNA (3′- CCG CAA UUC UCC CUU GUA UTT-5′) or negative control siRNA (3′-ACG UGA CAC GUU CGG AGA A-5′) using Lipofectamine 3000 transfection reagent (L3000001, Invitrogen, CA, USA). The siRNAs were obtained from Sangon (Shanghai, China). Following 12 h incubation, all medium was substituted with growth medium, and cells were cultured for an additional 24 hours. Cells were then subjected to OGD/R injury and harvested for Western blot analysis.

Statistical analysis

GraphPad Prism 7 Software (La Jolla, CA, USA) was used for statistical analysis, and all results were expressed as means ± SD. One-way ANOVA with Bonferroni’s test was utilized to determine the differences between groups for data with a single dosage or time point. For comparisons between two groups, including OGD and drug treatment, PGC-1α siRNA and drug treatment, the t-test was used. Statistical significance was defined as a p-value of 0.05 or less.

Nef reduces injury of bEnd.3 cells underwent OGD/R

To verify the protective effect of Nef on BMECs, we exposed the bEnd.3 cells (BMECs of mouse) to OGD/R injury to mimic BMECs damage during cerebral I/R in vitro. Cells viability was evaluated using CCK-8 assay. As time progressed, cell viability declined (Fig. 1a). In contrast, Nef treatment increased cell viability (0.1, 0.5, and 1 µM) (Fig. 1b). Nef (0.1 µM) has been already markedly reduced the LDH leakage under OGD/R condition, and the effect of reduction is more obvious with increase of the dose (Fig. 1c). The staining images were used to revealed the PI-positive cells (dead cells) (Fig. 1e). Dead cells were evidently higher in OGD/R-exposed groups and Nef reduced the death of the OGD/R-treated bEnd.3 cells (Fig. 1d, e). These data demonstrated that Nef rescued OGD-induced cell death in bEnd.3 cells.

Nef alleviated brain ischemia-reperfusion induced brain injury and improves the integrity of BBB in mice

To investigate whether Nef exhibits BBB protective effects, tMCAO mouse as an in vivo model was established (Fig. 2a). Vehicle or Nef (30 mg/kg or 60 mg/kg) were administered to mice at 2 h and 12 h after restored the blood flow. TTC staining was employed to determine the brain infarction (Fig. 2b). The infarct volume, cerebral edema volume, and cerebral water content were increased in tMCAO mice, and Nef treatment exhibited a concentration-dependent decrease (Fig. 2 (c-e)). Neurological status of mice was assessed using the Zea Longa neurological scoring system, Nef decreased the higher scores in tMCAO mice (Fig. 2f).

According to the results of H&E, tMCAO induced brain infarction, the peripheral neuron was nuclear pyknosis accompanied by the deeper staining, the penumbra area was swollen, neuropil vacuolation, glial cell hyperplasia, and Nef administration alleviated all the adverse phenomena elicited by tMCAO (Fig. 3a), dose-dependently. We also observed cerebral vessel damage in tMCAO mice (Fig. 3b), vessel walls integrity were impaired and the edges of the vessel wall were unclear. The mice administer Nef could effectively reverse the vessel injury. Brain EB content was quantified to further assess the integrity of BBB, tMCAO mice exhibited a marked increase in EB leakage, which was effectively attenuated by administration of Nef (Fig. 3c).

Immunohistochemistry demonstrated a decline in ZO-1 and Occludin expression levels post tMCAO (Fig. 4 (a-c)).

The gene and protein expression of ZO-1 and Occludin in bEnd.3 cells exposed to OGD/R. Consistently, Nef treatment reversed the diminished gene and protein expression of ZO-1 and Occludin in bEnd.3 cells (Fig. 5(a-e)). The total pipe tube branch length of tube-like structures in bEnd.3 cells was measured to examine the tube formation ability. The morphology of the cells exhibited notable differences on tube-like structure and analysis data indicated the tubular structures decline in the total length after OGD/R. However, the tube branch length in cells which treated with Nef were dose-dependently increased (Fig. 5f, g). The protective effect of Nef on BBB was further assessed by TEER measurement (Fig. 5h) and EBA assay (Fig. 5i). Endothelial barrier permeability was evaluated after exposed to 4 h of OGD. Nef obviously ameliorated the reduction in TEER values at the period of reoxygenation onset and 12 h of reoxygenation compared with OGD group (Fig. 5j). A progressive increase in EBA extravasation is evident after OGD/R, and Nef treatment reversed this effect (Fig. 5k). These data confirm that Nef not only alleviated I/R induced brain injury but also protect cerebral vessel to improves BBB integrity after ischemic stroke.

Nef activated PGC-1α to reduce mitochondrial oxidative stress and promote TJ proteins expression

Molecular docking method was used to find the target protein interacting with Nef. To gain a comprehensive understanding with the docking residue sites of Nef and PGC-1α protein, Ligplots + and PyMOL softwares were utilized to generate visual representations of the corresponding protein residue in a 2D and 3D binding site (Fig. 6a, b). The conformation with the lowest energy was selected as the optimal conformation by the dock binding free energy. The docking simulation shows that Nef forms a hydrogen bonded with GLU-291, the best negative free energy of binding (− 9.1 kcal/mol) suggesting a possible interaction between Nef and PGC-1α (Table 1). In order to corroborate the findings of molecular docking, transient transfection of bEnd.3 cells with PGC-1α siRNA was conducted, followed by evaluation of the expression of PGC-1α, NLRP3, Occludin, and ZO-1 proteins (Fig. 6c). The results indicated that the inhibitory effect of Nef on NLRP3 expression and promotion of TJ proteins expression were counteracted by genetic PGC-1α knockdown (Fig. 6(d-g)).

Table 1

Dock binding free energies (△Gb) and bonds of the docked compounds against proteins.
Compound	PDB ID	△Gb (kcal/mol)	Bonds formed between functional groups of component and protein residues
Compound	PDB ID	△Gb (kcal/mol)	Functional groups	protein residues	bond
Neferine	3B1M	-9.1	O	Glu291(A)	H-bond

PGC-1α is widely acknowledged as a predominant regulator of mitochondrial biogenesis and function, we evaluated mitochondrial function in bEnd.3 cells. Following OGD/R stimulation, MMP levels decreased and treated with Nef effectively reversed (Fig. 7a, b). We further assess the impact of Nef on mtROS, SOD and MDA in bend.3 cells. Notably, Nef treatment dose-dependently inhibited mtROS (Fig. 8a, b), promoted SOD (Fig. 8c) and MDA levels (Fig. 8d). These findings provide additional evidence supporting the role of Nef in reducing mtROS, improving oxidative stress damage, and enhancing mitochondrial function.

Neferine inhibits hypoxic-induced BMECs pyroptosis via regulation of PGC-1α/NLRP3/GSDMD signaling pathway to maintain the integrity of BBB

Immunohistochemistry was employed to analyze the expression of PGC-1α and NLRP3 in tMCAO mice. The results show that PGC-1α expression decreased and NLRP3 expression increased in I/R mice cerebral infarction region (Fig. 9a) and Nef dramatically reversed PGC-1α and NLRP3 expression (Fig. 9b-c).

To further verified the specific signaling pathway of Nef maintain the integrity of BBB, we also detected pyroptosis related proteins expression in bEnd.3 cells after OGD/R. The proteins expression of ASC, AIM2, Caspase-1, cleaved caspase-1, NLRP3, IL-1β, IL-18 and GSDMD were increased in bEnd.3 cells exposed to OGD/R and were reversed after the treated with Nef in vitro (Figs. 10). Consistent with the in vivo results, PGC-1α expression decreased in bEnd.3 cells under OGD/R and the expression was obviously upregulated by Nef. And the inhibiting effect of Nef on NLRP3 expression were cancelled by genetic PGC-1α knockdown (Fig. 6c). Together, these results demonstrated that Nef maintain the integrity of BBB by regulating PGC1-α/NLRP3/GSDMD mediated pyroptotic pathway.

Previous researches have been shown that Nef had a powerful anti-inflammatory and neuroprotective effects^8,9,20, so we tried to figure out the protective evidence of Nef on blood-brain barrier in cerebral I/R instead of neuroprotection. Our study using multiple methods to indicates that Nef repairs disruptive BBB to alleviated brain injury in cerebral I/R. Further investigation provided the first evidence that Nef target activate PGC-1α, and it promotes Occludin and ZO-1 expression, reduces NLRP3 inflammasome activation and mitochondrial oxidative stress induced pyroptosis to alleviates I/R injury of bEnd.3 cells, as illustrated in Fig. 11. Study also revealed that tight junction (TJ) protein mitigates attenuation and NLRP3 increased in bEnd.3 cells when PGC-1α was silenced. Taken all together, our work lends strong evidence supporting the protective effect of Nef on brain BMECs injury and maintain blood-brain barrier integrity after cerebral I/R.

Nef exhibits a beneficial effect on BMECs growth manifested in improving cell viability and tubular structure length and reducing the LDH release. EBA leakage and TEER values in vitro, cerebral vessel damage and EB leakage in vivo were observed to evaluate the effect of Nef on integrity of the BBB. The results both provided strong evidences of its positive regulation of BBB permeability. TJ proteins represented by Occludin and ZO-1 which are the mainly constituent and essential components in maintaining the fundamental function of the BBB. Our research shows that Nef increased TJ proteins expression which down regulated by I/R injury. This is consistent with the protective effect of Nef in tMCAO mice cerebral injury, it is manifested with the cerebral infarct volume mitigated, brain edema minimized, and neurobehavioral function enhanced.

Molecular docking results show us that Nef can bind to GLU-291 of PGC-1α (PDB ID: 3B1M) through hydrogen bonding, and the data suggested us PGC-1α may serve as the target protein mediating the protective effects of Nef on brain vascular endothelium after I/R. PGC-1α is highly expressed in BMECs²¹. In IS, PGC-1α was down-regulated, further reduced the capacity for mitochondrial oxidative phosphorylation and increased ROS production^22,23. PGC-1α activation could promotes new angiogenesis, facilitating the delivery of oxygen and nutrients to ischemic tissues and preventing ROS overload²⁴. In our research, mtROS production in bEnd.3 cells was increased and MMP values was decreased after OGD/R, all effects can be reversed by Nef. We also observed Nef could improve SOD expression and reduce MDA levels. Therefore, we infer that Nef may activate PGC-1α to inhibit the excessive aggregation of mtROS and maintain mitochondrial function.

Endogenous ROS levels may affect protein synthesis by regulating protein oxidative modification levels, so the increase of ROS results in the decrease of protein synthesis efficiency²⁵. ROS promotes damage to Tight junction²⁶. The upregulated of TJ proteins expression induced by Nef treatment may related to abolish the ROS overload.

ROS trigger the assembly of inflammasomes, leading to enhanced production and secretion of pro-inflammatory cytokines like IL-1β, exacerbating inflammatory response^26,27. The activation of NLRP3 has been widely studied, it found to promote inflammatory cascade reactions, increase inflammatory factors release and aggravate vascular inflammation in IS^28,29. The results also showed us that Nef suppressed NLRP3 inflammasome activation through activating PGC-1α and alleviated IS induced cerebral vascular endothelial injury. Up to now, it’s well known that GSDMD-N as a downstream molecule in pyroptosis, genetic PGC-1α knockdown to confirmed Nef interaction target and inhibit pyroptosis to protect blood-brain barrier. It is confirmed that Nef inhibited the expression of NLRP3 inflammasome and GSDMD in IS by targeting and activating of PGC-1α to maintain the integrity of BBB.

Based on the in vivo and in vitro research findings, we have concluded that Nef exerts a BBB-protective effect by rescue the impaired cerebral microvascular endothelial cells. The protective effect seems to be mediated by activating PGC-1α to reduce the excessive aggregation of mtROS and then inhibit the activation of NLRP3 inflammasome. Notably, the beneficial effects of Nef on cerebral microvascular endothelial against brain ischemia injury was first elucidated in our study, and first revealed that promoting PGC-1α expression could inhibit BMECs pyroptosis via PGC-1α/NLRP3/GSDMD pathway. In addition, we are concerned that PGC-1α has multiple functionalities beyond its role in reducing oxidative stress. Therefore, Further investigations are warranted to elucidate the impact of Nef on mitochondrial. To address these limitations and provide a stronger theoretical foundation for the application of Nef, we plan to conduct additional experiments and investigations. These endeavors will contribute to a deeper understanding on the mechanism of Nef’s anti-IS effect and offer more convincing evidence and theoretical backing.

IS, Ischemic stroke; BBB, Blood-brain barrier; CCA, Common carotid artery; CNS, Central nervous system; EB, Evans blue; ECA, External carotid artery; FBS, Fetal Bovine Serum; FDA, Food and Drug Administration; ICA, Internal carotid artery; LDH, Lactate dehydrogenase; MDA, Malondialdehyde; MMP, Mitochondrial membrane potential; NLRP3, NOD-like receptors family, pyrin domaincontaining 3; OGD/R, Oxygen and glucose-deprivation/reperfusion; PPA, pterygopalatine artery; SOD, Superoxide dismutase.

Author contribution

Zi-jian Zheng performed experiments and wrote the paper; Li-zhi Zhu, Han Qiu, Wu-yinxiao Zheng contributed to establishment of tMCAO mice model; Peng-tao You, Shu-he Chen, Chun-ling Hu, Jun-rong Huang analyzed the data; Ya-jun Zhou designed ideas and edited the article.

Competing interests

The authors have declared that no competing interest exists.

Author Contribution

Acknowledgements

This work was supported by the Natural Science Foundation of Guangdong Province [grant numbers: 2021A1515010996]; NSFC (National Natural Science Foundation of China, No. 82204231). We sincerely thank to Center for Hubei TCM processing technology engineering and Hubei Key Laboratory of Resources and Chemistry of Chinese Medicine for providing experimental facilities and laboratory space.

Data availability statement

The datasets used and analyzed during the current study are available in the science data bank (https://doi.org/10.57760/sciencedb.14510).

Kang, J. et al. Radiation-induced overexpression of transthyretin inhibits retinol-mediated hippocampal neurogenesis. Sci Rep 8, 8394, doi:10.1038/s41598-018-26762-1 (2018).
Zhou, Y.-J. et al. Neferine exerts its antithrombotic effect by inhibiting platelet aggregation and promoting dissociation of platelet aggregates. Thromb Res 132, 202–210, doi:10.1016/j.thromres.2013.05.018 (2013).
Marthandam Asokan, S., Mariappan, R., Muthusamy, S. & Velmurugan, B. K. Pharmacological benefits of neferine - A comprehensive review. Life Sci 199, 60–70, doi:10.1016/j.lfs.2018.02.032 (2018).
Wu, C. et al. Mitochondrial protective effect of neferine through the modulation of nuclear factor erythroid 2-related factor 2 signalling in ischaemic stroke. Br J Pharmacol 176, 400–415, doi:10.1111/bph.14537 (2019).
Sengking, J. et al. Protective Effect of Neferine in Permanent Cerebral Ischemic Rats via Anti-Oxidative and Anti-Apoptotic Mechanisms. Neurotox Res 40, 1348–1359, doi:10.1007/s12640-022-00568-6 (2022).
Guolan, D. et al. Anti-inflammatory effects of neferine on LPS-induced human endothelium via MAPK, and NF-κβ pathways. Pharmazie 73, 541–544, doi:10.1691/ph.2018.8443 (2018).
Tang, Y.-S. et al. Neferine inhibits LPS-ATP-induced endothelial cell pyroptosis via regulation of ROS/NLRP3/Caspase-1 signaling pathway. Inflamm Res 68, 727–738, doi:10.1007/s00011-019-01256-6 (2019).
Wang, M.-Y. et al. Neferine ameliorates nonalcoholic steatohepatitis through regulating AMPK pathway. Phytomedicine 114, 154798, doi:10.1016/j.phymed.2023.154798 (2023).
Wu, X.-L. et al. Neferine alleviates memory and cognitive dysfunction in diabetic mice through modulation of the NLRP3 inflammasome pathway and alleviation of endoplasmic-reticulum stress. Int Immunopharmacol 84, 106559, doi:10.1016/j.intimp.2020.106559 (2020).
Wang, S. et al. Dl-3-n-Butylphthalide (NBP): A Promising Therapeutic Agent for Ischemic Stroke. CNS Neurol Disord Drug Targets 17, 338–347, doi:10.2174/1871527317666180612125843 (2018).
Liu, X. et al. Dl-3-n-butylphthalide inhibits neuroinflammation by stimulating foxp3 and Ki-67 in an ischemic stroke model. Aging (Albany NY) 13, 3763–3778, doi:10.18632/aging.202338 (2021).
Huang, L. et al. From stroke to neurodegenerative diseases: The multi-target neuroprotective effects of 3-n-butylphthalide and its derivatives. Pharmacol Res 135, 201–211, doi:10.1016/j.phrs.2018.08.007 (2018).
Wang, A. et al. Efficacy and Safety of Butylphthalide in Patients With Acute Ischemic Stroke: A Randomized Clinical Trial. JAMA Neurol 80, 851–859, doi:10.1001/jamaneurol.2023.1871 (2023).
Mamtilahun, M. et al. DL-3n-Butylphthalide Improves Blood-Brain Barrier Integrity in Rat After Middle Cerebral Artery Occlusion. Front Cell Neurosci 14, 610714, doi:10.3389/fncel.2020.610714 (2020).
Dai, M.-J. et al. Dl-3-n-butylphthalide promotes angiogenesis in ischemic stroke mice through upregulating autocrine and paracrine sonic hedgehog. Acta Pharmacol Sin, doi:10.1038/s41401-023-01137-z (2023).
Shen, W. et al. Treadmill exercise enhances synaptic plasticity in the ischemic penumbra of MCAO mice by inducing the expression of Camk2a via CYFIP1 upregulation. Life Sci 270, 119033, doi:10.1016/j.lfs.2021.119033 (2021).
Gong, S. et al. Endothelial Conditional Knockdown of NMMHC IIA (Nonmuscle Myosin Heavy Chain IIA) Attenuates Blood-Brain Barrier Damage During Ischemia-Reperfusion Injury. Stroke 52, 1053–1064, doi:10.1161/STROKEAHA.120.031410 (2021).
Chen, X.-Y. et al. Inhibition of the immunoproteasome LMP2 ameliorates ischemia/hypoxia-induced blood-brain barrier injury through the Wnt/β-catenin signalling pathway. Mil Med Res 8, 62, doi:10.1186/s40779-021-00356-x (2021).
Barna, L. et al. Simvastatin, edaravone and dexamethasone protect against kainate-induced brain endothelial cell damage. Fluids Barriers CNS 17, 5, doi:10.1186/s12987-019-0166-1 (2020).
Lin, T.-Y. et al. Neferine, an Alkaloid from Lotus Seed Embryos, Exerts Antiseizure and Neuroprotective Effects in a Kainic Acid-Induced Seizure Model in Rats. Int J Mol Sci 23, doi:10.3390/ijms23084130 (2022).
Wang, Y. et al. Medioresinol as a novel PGC-1α activator prevents pyroptosis of endothelial cells in ischemic stroke through PPARα-GOT1 axis. Pharmacol Res 169, 105640, doi:10.1016/j.phrs.2021.105640 (2021).
Chen, S.-D. et al. Activation of calcium/calmodulin-dependent protein kinase IV and peroxisome proliferator-activated receptor γ coactivator-1α signaling pathway protects against neuronal injury and promotes mitochondrial biogenesis in the hippocampal CA1 subfield after transient global ischemia. J Neurosci Res 88, 3144–3154, doi:10.1002/jnr.22469 (2010).
Xu, Y. et al. The PGC-1α Activator ZLN005 Ameliorates Ischemia-Induced Neuronal Injury In Vitro and In Vivo. Cell Mol Neurobiol 38, 929–939, doi:10.1007/s10571-017-0567-0 (2018).
Abu Shelbayeh, O., Arroum, T., Morris, S. & Busch, K. B. PGC-1α Is a Master Regulator of Mitochondrial Lifecycle and ROS Stress Response. Antioxidants (Basel) 12, doi:10.3390/antiox12051075 (2023).
Topf, U. et al. Quantitative proteomics identifies redox switches for global translation modulation by mitochondrially produced reactive oxygen species. Nat Commun 9, 324, doi:10.1038/s41467-017-02694-8 (2018).
Yokoo, K., Yamamoto, Y. & Suzuki, T. Ammonia impairs tight junction barriers by inducing mitochondrial dysfunction in Caco-2 cells. FASEB J 35, e21854, doi:10.1096/fj.202100758R (2021).
Fu, J. & Wu, H. Structural Mechanisms of NLRP3 Inflammasome Assembly and Activation. Annu Rev Immunol 41, 301–316, doi:10.1146/annurev-immunol-081022-021207 (2023).
Poh, L. et al. The role of inflammasomes in vascular cognitive impairment. Mol Neurodegener 17, 4, doi:10.1186/s13024-021-00506-8 (2022).
Wu, A.-G. et al. Targeting microglial autophagic degradation in NLRP3 inflammasome-mediated neurodegenerative diseases. Ageing Res Rev 65, 101202, doi:10.1016/j.arr.2020.101202 (2021).

No competing interests reported.

Download PDF

Journal Publication

published 23 Jun, 2024

Read the published version in Scientific Reports →

Editorial decision: Revision requested
26 Apr, 2024
Reviews received at journal
23 Apr, 2024
Reviews received at journal
15 Apr, 2024
Reviewers agreed at journal
01 Apr, 2024
Reviewers agreed at journal
23 Mar, 2024
Reviewers invited by journal
21 Feb, 2024
Editor assigned by journal
21 Feb, 2024
Editor invited by journal
17 Jan, 2024
Submission checks completed at journal
17 Jan, 2024
First submitted to journal
15 Jan, 2024

You are reading this latest preprint version

Neferine inhibits BMECs pyroptosis and maintains blood-brain barrier integrity in ischemic stroke by triggering a cascade reaction of PGC-1α

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials and methods

Ethics Statement

Establishment of the transient middle cerebral artery occlusion (tMCAO) model

Drug administration

Measurement of assessment

Quantification of the infarct volume, cerebral edema volume, and cerebral water content

BBB permeability measurement

Histopathological examination

Immunohistochemistry

Cell cultures

Oxygen-glucose deprivation/reoxygenation (OGD/R) establishment and drug treatment

Cell viability assays

Tube Formation Assay

Endothelial Barrier Permeability Measurement

Oxidative Stress Assay

Western blot analysis

Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)

Mitochondrial ROS (mtROS) measurement

Mitochondrial membrane potential (MMP) measurement

Molecular Docking

Short Interfering (Si) RNA and Plasmid Transfection

Statistical analysis

Results

Nef reduces injury of bEnd.3 cells underwent OGD/R

Nef alleviated brain ischemia-reperfusion induced brain injury and improves the integrity of BBB in mice

Nef activated PGC-1α to reduce mitochondrial oxidative stress and promote TJ proteins expression

Discussion

Abbreviations

Declarations

Author contribution

Competing interests

Author Contribution

Acknowledgements

Data availability statement

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1