Biomimetic Polydopamine Loaded with Janus Kinase Inhibitor for Synergistic Vitiligo Therapy via Hydrogel Microneedles

doi:10.21203/rs.3.rs-3868354/v1

Download PDF

Research Article

Biomimetic Polydopamine Loaded with Janus Kinase Inhibitor for Synergistic Vitiligo Therapy via Hydrogel Microneedles

https://doi.org/10.21203/rs.3.rs-3868354/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

Both oxidative stress and autoimmune responses play crucial roles in the development of vitiligo. Under oxidative stress, the apoptotic melanocytes exposure self-antigens and release high mobility group box 1 (HMGB1), triggering autoimmune activation and recruiting CD8⁺ T cells. This process further leads to the destruction of melanocytes, resulting in a lack of melanin granules. Additionally, oxidative stress induces keratinocytes to express and release T cell chemotactic factors, exacerbating vitiligo. The reduction of CD8⁺ T cells by safeguarding melanocytes and keratinocytes from oxidative stress may be contemplated as a promising approach for vitiligo therapy.

Results

In this study, we introduce a novel therapeutic agent called PDA-JAKi, which is capable of both eliminating oxidative stress and inhibiting T cell activation. Specifically, we have incorporated the janus kinase inhibitor (JAKi) tofacitinib into antioxidant polydopamine (PDA) nanoparticles, resulting in the formation of uniform PDA-JAKi nanodrug. PDA effectively mitigates apoptosis in melanocytes, reducing the antigen presentation and release of HMGB1. Simultaneously, PDA alleviates oxidative stress in keratinocytes, leading to a reduction in the expression of chemotactic factors. JAKi, binding to JAK, significantly diminishes the activation of T cells. We precisely deliver this therapeutic agent to the dermis using microneedle (MN) patches, aiming to enhance therapeutic efficacy compared to traditional drug administration methods. After PDA-JAKi MN treatment, the symptoms of vitiligo in mice are alleviated, and the affected areas regain pigmentation. Enhancements have been noted in the dermal thickness within the treated skin area. Concurrently, a decrease in the abundance of immune cells, particularly the infiltration of CD8⁺ T cells, have been observed. Moreover, there is a notable reduction in interferon-γ (IFN-γ) levels, along with a substantial decrease in the chemotactic factors C-X-C motif chemokine ligand 10 (CXCL10) and C-X-C motif chemokine ligand 16 (CXCL16).

Conclusions

In summary, PDA-JAKi MN nanoplatform emerges as a promising therapeutic agent in vitiligo treatment.

Oxidative stress

Polydopamine

JAK inhibitor

Microneedles

Vitiligo

Vitiligo is a chronic acquired depigmentation disease, with an incidence that ranges from approximately 1–2% of the global population and continues to increase year by year.^[1] The condition results from damaged melanocytes and keratinocytes, which fail to produce and transport melanin for normal pigmentation, leading to decolorized patches.^[2] This situation inflicts enormous physical and psychology distress on patients, particularly with depigmentation on the face. Topical or oral immunosuppressants (e.g., corticosteroids, calcineurin and corticosteroid inhibitors), narrowband UVB phototherapy, camouflage and surgery are the current treatments for vitiligo.^[2] Various factors contribute to the pathogenesis of vitiligo including metabolic abnormalities, oxidative stress, inflammation, and autoimmunity.^[3] Oxidative stress plays a pivotal role in the pathogenesis of vitiligo.^[4] Under oxidative stress conditions, apoptotic melanocytes release self-antigens and high mobility group box 1 (HMGB1), thereby activating the autoimmune system and recruiting CD8⁺ T cells.^[5] These CD8⁺ T cells further attack and destroy surrounding melanocytes, leading to the formation of depigmented patches.^[6] Oxidative stress induce keratinocytes to release T cell chemotactic factors (e.g., CXCL10 and CXCL16), exacerbating the progression of vitiligo.^[7] Hence, mitigating oxidative stress levels in melanocytes and keratinocytes is crucial for treatment. Polydopamine (PDA) is a kind of artificial melanin-like nanoparticle that exhibits good performance in scavenging free radicals and providing UV shielding. Researchers have utilized PDA to protect keratinocytes from UV damage in photoaging treatment, as well as to eliminate reactive oxygen species (ROS) for managing injuries induced by acute inflammation.^{[8, 9]} Moreover, PDA has been proven to mimic melanosomes, effectively increasing the exogenous melanin content.^{[10, 11]} Consequently, PDA shows considerable promise as an antioxidant agent in vitiligo therapy.

However, the therapeutic efficacy is always unsatisfactory, and challenges include the limitations of single-drug approaches and drug percutaneous penetration. Combination therapy is a promising solution. Janus kinase inhibitors (JAKi), exemplified by tofacitinib, have demonstrated excellent therapeutic effect in the management of vitiligo.^{[12, 13]} They can target JAK/STAT signaling pathways, effectively reducing the activation of T cells and reversing the inflammatory microenvironment.^[14] Nevertheless, the current modes of JAKi administration, whether oral or topical, often lead to a series of side effects and may not consistently achieve optimal therapeutic results.^[15] There is a need to explore more effective modes of administration for the treatment of vitiligo. Transdermal drug delivery can enhance the bioavailability of drugs in various skin diseases.^[16] This approach allows for the controlled release of medications through the skin, which can be particularly beneficial in dermatological conditions by ensuring localized and sustained drug delivery, reducing systemic side effects.^[17] Within the spectrum of transdermal drug delivery methods, microneedle (MN) patches stand out as an efficient approach.^[18] They can penetrate the protective stratum corneum layer, facilitating painless drug delivery to the skin and thereby enhancing patient compliance.

In this work, we have developed an effective therapeutic agent for combination therapy in the treatment of vitiligo. Specifically, tofacitinib, as an efficient JAK inhibitor, is incorporated into melanin-like PDA nanoparticles to form an anti-oxidative stress and anti-autoimmune nanodrug (PDA-JAKi). The PDA-JAKi nanodrug has safeguarded melanocytes against hydrogen peroxide (H₂O₂)-induced cell apoptosis, as demonstrated by its capacity to decrease mitochondrial membrane potential (MMP) decline and the release of HMGB1. Furthermore, the PDA-JAKi has effectively eliminated H₂O₂ in keratinocytes and reduced the expression of chemotactic factors. Both HMGB1 and chemotactic factors are indispensable components for the activation of CD8⁺ T cells, and also the binding of JAKi to JAK significantly diminishes CD8⁺ T cell activation. Clinically used hyaluronic acid microneedles (HA MN) patches are selected for the precise transdermal delivery of the PDA-JAKi in vivo, showing better efficacy compared to traditional ointment delivery. Animal experiments reveal increased epidermal melanin, decreased infiltration of CD8⁺ T cells, and reduced depigmentation in mice's skin following PDA-JAKi MN treatment. As a result, the combination therapy involving PDA and JAKi emerges as a promising approach in vitiligo treatment.

Materials

Dopamine (DA), D-methionine, riboflavin and nitrotetrazolium blue chloride (NBT) were purchased from Macklin (Shanghai, China). Polydimethylsiloxane (PDMS) mold was purchased from Taizhou Microchip Pharmaceutical Technology (Taizhou, China). Hyaluronic acid sodium salt (100 kDa) and super active hyaluronic acid (HA) (5 kDa) were purchased from Hefei BOSF Biotechnology Co., Ltd. 30% H₂O₂ was obtained from Sinopharm Chemical Regent Co., Ltd. Cell Counting Kit-8 (CCK8) was purchased from MeilunBio®. 2, 7-dichlorofluorescein diacetate (DCFH-DA), MitoTracker® Green FM, Annexin V-EGFP/PI Apoptosis Detection Kit, Hifair® Ⅱ 1st Strand cDNA Synthesis SuperMix for qPCR (gDNA digester plus), Hieff® qPCR SYBR Green Master Mix (No Rox) and Calcein-AM/PI Double Stain Kit were purchased from Yeasen biotech Co., Ltd. MMP assay kit with JC-1, Hydrogen Peroxide Assay Kit, Trizol were purchased from Beyotime (Shanghai, China). RhB, DPPH, and ABTS were purchased from J&K Scientific Co., Ltd. Anti-HMGB1 antibody was obtained from Abcam (catalog no. Ab79823).

Characterizations

Transmission electron microscopy (TEM) images were captured by a HT7700 transmission electron microscope (JEM-F200, Japan). Scanning electron microscope (SEM) images were captured by HITACHI UHR FE-SEM SU8000 Series (SU8010, Japan). The dynamic light scattering (DLS) size distribution was measured by Zetasizer Nano ZS ZEN3600 (Malven, England). UV/Vis absorption spectra were measured on a Cary 60 UV/Vis spectrophotometer (Agilent Technologies, Santa Clara, CA, USA). The immunofluorescence images were captured by Leica Stellaris 5 (Heidelberg, Germany). The morphology images of microneedles were captured by stereomicroscope (T1-HD206, China). The Quantitative Real-time PCR Analysis were conducted by iQ5 PCR assay systems (Bio-Rad Laboratory, Haglels, California). The mechanical strength of microneedles was conducted by Electronic Universal Material Testing Machine (Instron 5944). The permeation ability of microneedles was tested by multiphoton microscope (FVMPE-RS, Japan). All the fluorescent pictures were captured by fluorescence microscope (Leica Stellaris 5, Germany).

Synthesis of PDA and PDA-JAKi nanoparticles

180 mg DA was dissolved in 90 mL H₂O. When it was heated to 50 ℃, the 760 µL NaOH (1 M) was added immediately and stirred for 5 h. After cooling into room temperature, the PDA nanoparticles was obtained by centrifugation at 18000 rpm for 15 min. The deposit re-suspended in pure water and centrifugated at 4000 rpm to remove large particles. To obtain PDA-JAKi, various concentrations (0.5, 1, 1.5, 2 mg) of JAKi were feed into 2 mg PDA solution, after stirring for 4 h, the final product was centrifugated and the supernatant was collected for UV/Vis absorbance analysis. The loading efficiency of JAKi was determined using the formula: loading efficiency = 100% × (total JAKi - unloaded JAKi) / total JAKi. The loading capacity of JAKi was determined using the formula: loading capacity = (total JAKi - unloaded JAKi) / total PDA.

Catalytic ability against H₂O₂

50 and 100 µg mL^− 1 PDA and PDA-JAKi were co-incubated with 1 M H₂O₂ for 12 h at room temperature. Utilizing a hydrogen peroxide assay kit to quantify the concentration of H₂O₂ in the supernatant after centrifugation. The specific operation was carried out according to the instructions.

Free radical scavenging assays

For DPPH (1,1-diphenyl-2-picrylhydrazyl radical) depletion assay, 100 mM DPPH was co-incubation with different concentrations (0, 12.5, 25, 50 µg mL^− 1) PDA-JAKi for 20 min in the dark. Then, the reaction mixture solution was centrifuged and the supernatant was collected for further detection by UV/Vis at 515 nm.

For •OH depletion assay, the ability of •OH depletion was monitored by ABTS (2,2'-azino-bis(3-ethylbenzothiazoline 6-sulfonate). 920 µL of H₂O, 10 µL of H₂O₂ (200 uM), 20 µL of FeSO₄·7H₂O (18 mM), and 10 µg of PDA-JAKi were mixed together. After sonication for 5 min, the supernatant was collected by centrifugation and then incubated with 50 µL ABTS (10 µM) for different times (0, 1, 10, 30, 90, 120 min). Finally, the UV/Vis absorbance of the reaction solution at 800 nm was recorded.

For O₂^−• depletion assay, 12.5 mM methionine, 75 µM nitrogen blue tetrazole, 20 µM riboflavin and different concentrations (0, 12.5, 25, 50, 100 µg mL^− 1) of PDA-JAKi were resuspended in 1 mL of PBS. The reaction solution was collected for UV/Vis analysis at 560 nm after UV irradiation for 15 min.

Preparation of microneedle patches

180 mg mL^− 1 HA hydrogel solution (sodium hyaluronate: super active DA = 1:5, w/w) was added to the PDSM mold. Then, PDSM mold was placed into horizontal centrifuge and centrifuged three times at 4000 rpm for 5 min. The whole product was dried at 37℃ over night. Finally, the HA MN were carefully removed from molds for the following experiments. PDA MN, JAKi MN and PDA-JAKi MN were prepared by almost the same process as HA MN, with the PDA, JAKi and PDA-JAKi already doped in HA hydrogel solution respectively. For RhB-loaded HA MN preparation, RhB was added into the HA hydrogel solution for next steps.

Mechanical strength of MN detection

the various MN patches were placed on the steel plate and moved vertically direction with detector probe at a speed of 0.1 mm s^–1. When it touched the tip, recorded the displacement and force immediately. Meanwhile, when the tip started to break, the destructive force of the MN patch was recorded. A stereomicroscope was used to observe the broken MN patch.

Permeability ability of HA MN detection

The PDA-JAKi MN patches were inserted into the skin of mice. After 10 min of application, 10 mg mL^–1 methylene blue (MB) aqueous solution was applied to stain the microholes. After another 10 min application, the MB aqueous solution was removed and the images were recorded with stereomicroscope. To further understand the penetration, the mice skin was collected and fixed with 4% paraformaldehyde. The hematoxylin and eosin (H&E) staining was performed by Wuhan Service Biotechnology Co., Ltd. The rhodamine B (RhB)-loaded HA MN patches were prepared in advance. They were applied to the freshly excised skin of mice. The RhB-loaded HA MN were removed and the penetration depth was observed using a multiphoton microscope (𝜆ex = 540 nm, 𝜆em = 625 nm) after 10 min of application.

Cell experiments

For cytotoxicity assay, HaCaT and PIG1 cells were seeded into 96-well plates (5 × 10³ cells per well) and incubated overnight. Subsequently, the initial DMEM was disposed of and replaced with fresh DMEM solution that included varying concentrations of JAKi and PDA-JAKi individually. After further incubation for 24 h, cell viabilities were assessed by CCK-8 assay. Similarly, various doses of H₂O₂ ranging from 0 to 1000 µM were added into fresh DMEM, cell viabilities were assessed by CCK-8 assay after 24 h incubation. According to the result of CCK-8 assays, 1 mM H₂O₂ were chosen for PDA-JAKi antioxidative stress capacity detection. The DMEM was replaced with fresh DMEM containing 1 mM H₂O₂ and various concentration of PDA-JAKi. After co-incubation for 24 h, the cytotoxicity was conducted by CCK-8 assay.

To evaluate cellular apoptosis using flow cytometry, PIG1 cells were seeded into 6 wells with a density of 1 × 10⁵ and cultured for 12 h. Subsequently, the cells were exposed to DMEM supplemented with H₂O₂, H₂O₂ + PDA, and H₂O₂ + PDA-JAKi (1 mM H₂O₂, 50 µg mL^− 1 PDA, 50 µg mL^− 1 PDA-JAKi) for a duration of 24 h. Then, the cells were gathered and subjected to staining using the Annexin V-FITC/PI Apoptosis Detection Kit. The stained cells were promptly examined using a flow cytometer (Beckman Coulter, USA).

For live and dead cell observation, the HaCaT cells were seeded into a 6-well plate overnight and further exposed to different treatments for 24 h: H₂O₂, H₂O₂ + PDA, H₂O₂ + PDA-JAKi (1 mM H₂O₂, 50 µg mL^− 1 PDA, 50 µg mL^− 1 PDA-JAKi). And then, Calcin-AM solution (2 mM, 1:1000) and PI solution (1.5 mM, 1:1000) were added to stain the cells for 10 min. After that, the cells were observed using a fluorescence microscope.

To detect the MMP change, JC-1 Assay Kit was employed to detect the alterations. PIG1 cells were placed in a 6-well plate with a density of 1 × 10⁵ cells per well and incubated for 12 h. Following various treatments (Control, H₂O_2, H₂O₂ + PDA, H₂O₂ + PDA-JAKi; 1 mM H₂O₂, 50 µg mL^− 1 PDA, 50 µg mL^− 1 PDA-JAKi) for 24 h, the cells were conducted by JC-1 Assay Kit. And the fluorescence images were acquired using a fluorescence microscope.

To observe the mitochondrial integrity, HaCaT cells was seeded into a 6-well plate at a density of 1 × 10⁵ cells per well. After overnight incubation, the cells were treated with H₂O₂, H₂O₂ + PDA, and H₂O₂ + PDA-JAKi (1 mM H₂O₂, 50 µg mL^− 1 PDA, 50 µg mL^− 1 PDA-JAKi), respectively. MitoTracker Green probe was utilized to stain mitochondria in living cells. And the fluorescence images were acquired using a fluorescence microscope.

For in vitro ROS detection, the HaCaT cells were seeded into a 6-well plate (1 × 10⁵ cells per well) and cultured overnight. Afterwards, the origin DMEM was removed, and H₂O₂, H₂O₂ + PDA and H₂O₂ + PDA-JAKi (1 mM H₂O₂, 50 µg mL^− 1 PDA, 50 µg mL^− 1 PDA-JAKi) were introduced to the fresh DMEM for 4 h. Then, PBS solution with DCFH-DA probe was stained for 30 min. Cells were washed with PBS three times and observed by a fluorescent microscope or immediately detected by a flow cytometry.

Immunofluorescence staining in vitro

PIG1 cells were seeded into confocal dishes (1×10⁵ cells per dish) and incubated for 12 h. Afterwards, the cells were treated with H₂O₂, H₂O₂ + PDA and H₂O₂ + PDA-JAKi (1 mM H₂O₂, 50 µg mL^− 1 PDA, 50 µg mL^− 1 PDA-JAKi) for 24 h. Anti-HMGB1 (1:1000, Abcam, Cat. ab79823) was chosen for immunofluorescence stanning.

RNA isolation and quantitative real-time PCR analysis

Total RNA was isolated from HaCaT cells using Trizol reagent. It was reverse transcribed to cDNA using Hifair® 1st Strand cDNA Synthesis SuperMix for qPCR (gDNA digester plus). The QRT-PCR analysis was carried out using the Hieff® qPCR SYBR Green Master Mix (No Rox). All procedures were performed according to the instructions. Relative mRNA expression was normalised to the GADPH gene. The primers used in this study were as follows:

Gene	Primer	Sequence (5’→3’)
Human GADPH	Forward	CAGGAGGCATTGCTGATGAT
Human GADPH	Reverse	GAAGGCTGGGGCTCATTT
Human CXCL10	Forward	ATTCCTGCAAGCCAATTTTGTCCAC
Human CXCL10	Reverse	TGATGGCCTTCGATTCTGGATTCAG
Human CXCL16	Forward	GCAGCGTCACTGGAAGTTGTTATTG
Human CXCL16	Reverse	CCGATGGTAAGCTCTCAGGTTTC

Animal experiments

Female C57BL/6 mice aged 4–6 weeks were used in this experiment. All mice were purchased from Beijing Weitong Lihua Animal Experiment Co., LTD. All animal rearing and experiments were carried out in accordance with the regulations set by the Animal Care and Trial Committee of Wenzhou Medical University. The vitiligo mice model was established according to previously reported literature.^[11] The vitiligo mice were randomly divided into 6 groups including: 1) Control group 2) Untreated group; 3) HA MN group; 4) PDA MN group; 5) JAKi MN group; 6) PDA-JAKi ointment group; 7) PDA-JAKi MN group (PDA: 25 mg kg^− 1; JAKi: 2.9 mg kg^− 1). The ointment was purchased from Mannings. The PDA-JAKi ointment was prepared by simply mixing the ointment with the PDA-JAKi. The treatments were administered twice a day and two pieces at a time for the microneedles-mediated groups. For the PDA-JAKi ointment group, the ointment was applied thinly to the corresponding area of the back and gently massaged until absorbed. At the end of the treatments, the mice were sacrificed, and the treated skin was collected for ELISA assay, CD8⁺ T cells immunofluorescence staining, H&E staining and Masson-Fontana staining. Subsequently, the major organs were then harvested to confirm the compatibility of the therapeutic agents. All the samples were further performed by Wuhan Service Biotechnology Co., Ltd.

Statistical analysis

All the results above represented mean ± standard deviation. Statistically differences were determined by an Student’s t-test. post hoc test using Graphpad Prism software 8.2.1. P values < 0.05 was considered as a significant difference between data (*P < 0.05, **P < 0.01, ***P < 0.001; ns, no significance).

Preparation and characterization of PDA-JAKi

Primarily, the synthesis of PDA was conducted as previous report.^[10] The synthesized PDA nanoparticles exhibited a uniformly spherical structure and displayed good dispersion (Figure S1a and b). The absorbance of synthesized PDA was shown in Figure S1c. Subsequently, various concentrations of JAKi (tofacitinib) were individually feed into a 2 mg PDA aqueous solution and stirred for 4 h to obtain PDA-JAKi. It was observed that the quantity of JAKi fed had an insignificant impact on the morphology of PDA (Figure S2). The loading efficiency and loading capacity of JAKi were determined using a standard curve (Figure S3). It was observed that the loading capacity increased with the increase in the amount of JAKi fed. The PDA-JAKi achieved with a feeding ratio of 0.75:1 with loading efficiency of 15.7% was chosen for further studies (Figure S4). Similarly, PDA-JAKi also exhibited a well-dispersed spherical morphology (Fig. 2a and b). The presence of the characteristic absorption of JAKi (tofacitinib) further confirmed the successful incorporation of tofacitinib in the PDA-JAKi (Fig. 2c). As shown in Fig. 2d, the particle sizes and polydispersity index (PDI) showed no significant changes over time, indicating that PDA-JAKi possessed long-term stability. It has been observed that the levels of ROS (H₂O₂, •OH, O₂^−•) in the skin of vitiligo patients may be increased.^[19] This elevation could be attributed to factors such as oxidative stress and over UV radiation exposure. Excess ROS such as H₂O₂ can potentially lead to damage to melanocytes, thereby affecting pigment production in the skin, ultimately resulting in the formation of vitiligo. As previously reported, PDA has been extensively utilized as an antioxidative enzyme-like agent with ROS-scavenging properties due to its enrichment groups of catechol.^[20] H₂O₂ induced oxidative stress plays an inescapable role in vitiligo. After co-incubation with H₂O₂, the color of both PDA and PDA-JAKi lightened, indicating that PDA could react with H₂O₂ (Fig. 2e). Additionally, we used the H₂O₂ assay kit to assess the changes of concentration, and the result indicated that both PDA and PDA-JAKi effectively consumed H₂O₂ (Fig. 2f). DPPH and ABTS are commonly used to measure antioxidant capacity of free radical scavenger.^{[21, 22]} When they react with free radical scavenger, their absorption values will decrease. As shown in Fig. 2g, the absorption value of DPPH gradually decreased in a concentration-dependent manner in the presence of PDA-JAKi. Similarly, we observed the same results in the ABTS scavenging assay (Fig. 2h). Furthermore, we utilized NBT method to evaluate the O₂^−• scavenging ability of PDA-JAKi. Under UV irradiation, the generated O₂^−• reduces nitrogen blue tetrazole to form blue methylhydrazine, but after addition of PDA-JAKi, the absorption value decreased in a manner dependent on concentration (Fig. 2i). All of the above results indicate that PDA-JAKi exhibits antioxidant properties and holds promise for reducing oxidative stress in keratinocytes and melanocytes, potentially offering a treatment option for vitiligo.

Fabrication and characterization of PDA-JAKi MN

HA MN have been widely employed for accurate drug delivery into lesion, especially in skin-related diseases. HA MN and PDA-JAKi MN were characterized by stereomicroscope, and the dark color of the needles in PDA-JAKi MN confirmed the successful loading of PDA-JAKi (Fig. 3a and b). SEM images showed that the PDA-JAKi MN possessed pyramid-shaped needles with a sharp tip and uniform size(Fig. 3a and Figure S5a). The fracture force of the MN patch, including MN, PDA MN and PDA-JAKi MN, was 0.18, 0.21, and 0.23 N/needle respectively (Fig. 3d). These values were greater than the reported minimum skin insertion force of 0.1 N, allowing PDA-JAKi MN patch to penetrate the skin effectively.^{[25, 26]} To verify the penetration of our prepared MN, we carried out a study to assess their ability to penetrate the skin. The MB staining revealed that most of tip of the MN patch penetrated the skin after being applied for 10 min, forming microchannels in the skin (Fig. 3e). Additionally, H&E staining images of the skin confirmed that MN patch broke through the epidermis and entered the dermis (Fig. 3f). Furthermore, the RhB-loaded MN patch was fabricated to visualize the penetration depth (Fig. 3g). The detection of RhB fluorescence at deeper levels indicated that the MN possessed substantial penetration capability, facilitating the delivery of PDA-JAKi to subepidermal region (Fig. 3h). Once the MN penetrates the skin, the loaded drug will be released. We investigated the release performance of PDA MN. As time progressed, the MN gradually degraded in the PBS solution, releasing PDA (Figure S5c). The above results indicate that the MN delivery strategy exhibits effective transdermal capability, holding promise for loading PDA-JAKi for vitiligo treatment.

PDA-JAKi protect melanocytes from H₂O₂-induced apoptosis

As previously reported, H₂O₂ levels in epidermis or serum were significantly increased in individuals with vitiligo compared to healthy subjects.^[27] PDA has exhibited good competence in scavenging ROS, as substantiated by our prior experiments on free radical clearance. Subsequently, we aimed to validate the capability of PDA to eliminate H₂O₂ and mitigate oxidative stress-induced damage at the cellular level in HaCaT (normal human skin keratinocytes) and PIG1 (normal human skin melanocytes) cells. Firstly, we verified the safety of JAKi and PDA-JAKi on HaCaT and PIG1 cells using、CCK8 assays. As shown in Fig. 4a and S6a, JAKi and PDA-JAKi had no discernible effect on viability of HaCaT and PIG1 cells. To induce oxidative stress with H₂O₂, cells were treated with various concentrations (0–1 mM) of H₂O₂. In the presence of 1 mM H₂O₂, both HaCaT and PIG1 cells viability was significantly reduced after 24 h incubation (Figure S6b). 1 mM H₂O₂ was chosen as the optimal concentration to simulate oxidative stress at the cellular level according to previous report.^{[28, 29]} Conversely, co-treatment of HaCaT and PIG1 cells with PDA-JAKi and H₂O₂ led to a significant enhancement in cell viability compared to treatment without PDA-JAKi in HaCaT and PIG1 cells, respectively (Fig. 4b and c). In particular, the apoptosis of PIG1 results in the exposure of self-antigens, which is one of the major pathogenic mechanisms of vitiligo. The flow cytometric assay also showed that PDA and PDA-JAKi rescued H₂O₂-induced PIG1 cell apoptosis (Fig. 4d and e). This suggested that the addition of PDA-JAKi could be expected to interrupt melanocytes death caused by H₂O₂-induced oxidative stress, thus avoiding self-antigen exposure. Additionally, the decrease in MMP is a significant occurrence during the early stages of apoptosis.^[30] A transition from JC-1 aggregates to JC-1 monomers in JC-1 staining assay suggests a decline in cellular MMP. As illustrated in Fig. 4f and S7, there was a notable decrease in the fluorescence intensity ratio between JC-1 aggregates and JC-1 monomers in PDA (1.01) and PDA-JAKi (1.03) compared to untreated group (0.73). All these results related to cell apoptosis provide good evidence for the potent antioxidant capacity of PDA-JAKi at the cellular level, which was expected to alleviate the oxidative damage induced by H₂O₂.

PDA-JAKi reduce H₂O₂-induced oxidative stress in keratinocytes

On the other hand, oxidative stress plays a crucial role in keratinocytes. It is essential to mitigate the H₂O₂-induced oxidative stress on keratinocytes for the purpose of vitiligo treatment.^[27] We utilized Calcein-AM/PI double staining kit to validate that PDA-JAKi reversed the death of keratinocytes induced by H₂O₂-induced oxidative stress (Figure S8). Mitochondrial integrity is necessary for antioxidant stress and H₂O₂-induced oxidative stress will cause damage to the mitochondria.^[31] The green mitochondrial probe was used to detect changes in the integrity of mitochondria in keratinocytes undergoing treatment with H₂O₂. As illustrated in Fig. 5a, the green fluorescence was reduced after H₂O₂ treatment. However, co-incubation with PDA and PDA-JAKi reversed this phenomenon, demonstrating that the integrity of mitochondrial had been restored to some extent. Thereafter, the level of ROS was examined using DCFH-DA probe. In the presence of H₂O₂, the cellular ROS levels were significantly increased, as shown by the stronger green fluorescence (Fig. 5b). After PDA or PDA-JAKi treatment, the fluorescence intensity was reduced due to their ability to scavenge ROS. In addition, the flow cytometry analysis also confirmed that both PDA and PDA-JAKi could reduce the cellular ROS levels (Fig. 5c and d). Taken together, PDA-JAKi demonstrated the capability to protect HaCaT cells from H₂O₂-induced ROS attack, preserving the integrity of mitochondria.

PDA-JAKi inhibit the release of HMGB1 and secretion of CXCL10/16

HMGB1 is a typical damage-associated molecular pattern (DAMP) molecule that exerts a strong pro-inflammatory effect in the inflammatory response.^[32–34] Under oxidative stress, HMGB1 is released from the nucleus of apoptotic melanocytes to the cytoplasm and extracellular space, recruiting and activating T cells (Fig. 6a). As depicted in Fig. 6b, HMGB1 translocated from the nucleus to the cytoplasm after H₂O₂ treatment in PIG1 cells. Resembling the observation in the control group, HMGB1 remained confined to the nucleus in both the PDA and PDA-JAKi groups. Additionally, oxidative stress promotes keratinocytes to express and release T cell activation-related chemokines, CXCL10 and CXCL16, further expediting the recruitment and activation of T cells (Fig. 6a).^{[27, 35]} These processes can be alleviated by the antioxidant properties of PDA and PDA-JAKi. To verify the mRNA expression of CXCL10 and CXCL16 after H₂O₂ treatment in HaCaT cells, quantitative real-time PCR analysis was performed. Consistent with expectations, the levels of CXCL10 and CXCL16 in keratinocytes were elevated following treatment with H₂O₂. However, the introduction of PDA and PDA-JAKi effectively reversed this elevation (Fig. 6c and d). The above results revealed that the synthesized PDA-JAKi holds promise in protecting melanocytes and keratinocytes. Therefore, it was recommended to conduct animal experiments to assess the therapeutic efficacy of PDA-JAKi in mice model of vitiligo.

PDA-JAKi MN treatment improve hair follicle growth in vitiligo mice

The commonly recognized mice vitiligo models have been established by the application of 5% H₂O₂ to the dorsal skin of mice for 6 weeks. The successful establishment of the model was confirmed upon the observation of depigmentation in the growing hair. After that, the vitiligo mice were randomly divided into the following six groups: (1) Untreated group; (2) MN group; (3) PDA MN group; (4) JAKi MN group; (5) PDA-JAKi ointment group; (6) PDA-JAKi MN group. The ointment group served as an alternative administration method to better evaluate the effectiveness of MN delivery system. Different groups of mice received the indicated treatments every two days. The growing hair exhibited depigmentation after exposure to H₂O₂. After 14 days treatment, the depigmentation areas in mice exhibited varying degrees of recovery (Figure S9). We could observe that PDA MN, JAKi MN, PDA-JAKi ointment and PDA-JAKi MN groups reduced the area of depigmentation. With the aid of the MN delivery system, the PDA-JAKi MN group successfully overcame the skin epidermal barrier, exerting its effects in the subepidermal region. The delivery of PDA into melanocytes allows it to scavenge ROS and function as melanosomes, increasing the exogenous melanin content and leveraging its coloration potency. And the JAKi effectively reversed the inflammatory microenvironment. As a result, PDA-JAKi MN group exhibited a maximum increase in melanin deposition, alleviating symptoms of vitiligo.

To further investigate the therapeutic efficacy, the treated skin areas from different groups were collected for H&E stanning to observe the number of hair follicles. Generally, as the number of hair follicles increases, so does the dermal thickness. Analysis of the H&E staining images revealed that, in the treated groups, there was a noticeable increase not only in the number of hair follicles but also in the thickness of the dermis, showing varying degrees of enhancement compared to the untreated group. It was noteworthy that PDA-JAKi MN group showed the most pronounced increase in the thickness of the dermis (Fig. 7a and b). Similar augmentations were observed in JAKi MN group and PDA-JAKi ointment group. We also observed that infiltration of inflammatory cells in H&E images. As depicted in Fig. 7c and d, PDA-JAKi MNs exhibited the lowest count of immune cells compared to other treatment groups. This could be attributed to the effective elimination of ROS by PDA-JAKi, in conjunction with JAKi, mitigating the immune response and inflammation at the lesion site. Therefore, the mice treated with PDA-JAKi MN showed the greatest similarity in H&E stanning images compared to the control group (Figure S10).

PDA-JAKi MN treatment recover depigmentation area and inhibit the recruitment and activation of CD8 ⁺ T cells

The changes in melanin granules in the epidermis after treatment were analyzed by Masson-Fontana staining and a localized area containing melanin was amplified for better observation. As expected, after exposure to 5% H₂O₂, melanin was greatly reduced ompared to the Control group (Fig. 8a and S11). After treatment with PDA MN, the restoration of melanin production indicated that PDA cleared ROS and alleviated symptoms of vitiligo. Furthermore, some reports have suggested that PDA serve as melanin-like nanoparticles to supplement epidermal melanin content.^{[10, 11]} The combination of PDA and JAKi demonstrated good efficacy compared to the individual application of either JAKi or PDA alone in promoting the increase of melanin granules. Due to the effective delivery of MN, PDA-JAKi MN group overcame the skin barrier to achieve a better therapeutic effects performance than PDA-JAKi ointment group.

Vitiligo is indeed an autoimmune disorder wherein apoptotic melanocytes activate T cells. Subsequently, activated CD8⁺ T cells persist in attacking melanocytes, leading to further melanocyte apoptosis and establishing a detrimental cycle of continuous destruction.^{[19, 36, 37]} Immunofluorescence staining of CD8⁺ T cells was performed in H₂O₂-induced vitiligo mice model. As illustrated in Fig. 8b, we could observe that more CD8⁺ T cells were recruited in the H₂O₂-mediated vitiligo mice model. Both JAKi MN and PDA-JAKi MN groups exhibited a reduced presence of CD8⁺ T cells, indicating efficient delivery of JAKi into T cells, thereby inhibiting their activation. Similarly, the number of CD8⁺ T cells in PDA-JAKi MN group was lower than that in PDA-JAKi ointment group, highlighting the superiority of the MN delivery strategy. To further substantiate the degree of immune response at the lesion site, the skin of treated area was removed from various groups for ELISA assays. IFN-γ, a signature cytokine of CD8⁺ T cells, was also found to decreased in PDA-JAKi MN group (Fig. 8c). Consistent with the Fig. 6c and d, both PDA and PDA-JAKi MN group demonstrated a decrease in CXCL10 and CXCL16, suggesting that the ROS in keratinocytes was effectively eliminated by PDA and PDA-JAKi (Fig. 8d and e). Moreover, H&E staining images of the major organs displayed no viewable inflammation and damage after PDA-JAKi MN treatment (Figure S13). All of above results demonstrated that the combination of PDA and JAKi had a better therapeutic effect on vitiligo treatment. At the same time, it was necessary to maximize the therapeutic effect of this combination by MN delivery.

Vitiligo impairs the function of melanocytes in the epidermis and hair follicles, resulting in depigmentation. Due to various factors such as autoimmune response, overproduction of inflammatory mediators etc., CD8⁺ T cells were activated and secreted IFN-γ, which then acted on JAK/STAT signalling pathway in keratinocytes, promoting the further activation of CD8⁺ T cells. JAK inhibitors that specifically target the JAK/STAT pathway have been authorized as efficacious medications for treating vitiligo. However, JAK inhibitors were not sufficient for the treatment of vitiligo due to the complex pathogenesis. Oxidative stress had been widely recognised to have a significant impact on the development of vitiligo. Serum and epidermal analysis of clinical vitiligo patients revealed remarkable elevated levels of H₂O₂. Oxidative stress and autoimmune responses collaboratively drive the progression of vitiligo. In summary, we developed a combination nanodrug of PDA-JAKi for vitiligo treatment. PDA acted as a ROS scavenger, protecting melanocytes and keratinocytes from oxidative stress. The protected melanocytes could avoid self-antigen exposure and HMGB1 secretion. Additionally, the secretion of CXCL10 and CXCL16 by keratinocytes could be decreased. Furthermore, tofacitinib, a kind of JAKi, was utilized to inhibit the activity of JAK in T cells, thereby reducing the activation of T cells and mitigating their assault on melanocytes. The application of the MN delivery strategy contributed to achieving superior therapeutic outcomes in vivo. Improvements were observed in the dermal thickness of the skin area after PDA-JAKi MN treatment. There was a reduction in the number of immune cells in the region, especially the infiltration of CD8⁺ T cells. Similarly, IFN-γ levels showed a significant decrease. The chemotactic factors CXCL10 and CXCL16 also exhibited a substantial reduction. This combination therapy possessed the potential to disrupt the vicious cycle between oxidative stress and autoimmune activation, effectively alleviating symptoms in a mouse model of vitiligo. Importantly, all components of PDA-JAKi are comprised of biodegradable materials. Both JAKi (tofacitinib) and HA MN have been utilized in clinical trials. Therefore, the formulated PDA-JAKi MN nanoplatform presents a translational paradigm for vitiligo treatment.

HMGB1 high mobility group box 1

CXCL10 C-X-C motif chemokine ligand 10

CXCL16 C-X-C motif chemokine ligand 16

JAKi janus kinase inhibitor

PDA polydopamine

MN microneedle

IFN-γ interferon-γ

ROS reactive oxygen species

H₂O₂hydrogen peroxide

MMP mitochondrial membrane potential

HA MN hyaluronic acid microneedles

DA Dopamine

NBT nitrotetrazolium blue chloride

PDMS Polydimethylsiloxane

CCK8 Cell Counting Kit-8

DCFH-DA 2, 7-dichlorofluorescein diacetate

TEM Transmission electron microscopy

SEM Scanning electron microscope

DLS dynamic light scattering

HA hyaluronic acid

DPPH 1,1-diphenyl-2-picrylhydrazyl radical

ABTS 2,2'-azino-bis (3-ethylbenzothiazoline 6-sulfonate)

MB methylene blue

H&E hematoxylin and eosin

RhB rhodamine B

PDI polydispersity index

DAMP damage-associated molecular pattern

Availability of data and materials

All data generated or analyzed during this study are included in this published article or available from the corresponding author on reasonable request.

Funding

This work was supported by the Zhejiang Provincial Natural Science Foundation (LY22H160030).

Authors' contributions

CYL and WWW carried a majority of experments and analyzed data. CYL and XLJ wrote the main manuscript. WWW and YXX prepared figures. QYX and YHH performed the statistical analysis. YLW and ZML conceived the study, designed the study, evaluated data and revised the manuscript. All authors read and approved the final manuscript.

Acknowledgements

Not applicable.

Ethics approval and consent to participate.

All animal studies were approved by the Animal Ethics and Welfare Committee of the First Affiliated Hospital of Wenzhou Medical University.

Consent for publication

All authors have agreed to publish this manuscript.

Competing interests

The authors declare that they have no competing interests.

Diotallevi F, Gioacchini H, De Simoni E, Marani A, Candelora M, Paolinelli M, Molinelli E, Offidani A, Simonetti O. in Int J Mol Sci, Vol. 24, 2023.
Frisoli ML, Essien K, Harris JE. Annu Rev Immunol. 2020;38:621–48.
Chen J, Li S, Li C. Med Res Rev. 2021;41:1138–66.
Kuan A, Chuah SY, Sheng Yip Y, Tan NS. Steven Thng. J Am Acad Dermatol. 2020;83:AB11.
Xuan Y, Yang Y, Xiang L, Zhang C. Oxidative Medicine and Cellular Longevity 2022, 2022, 8498472.
Denat L, Kadekaro AL, Marrot L, Leachman SA. Abdel-Malek. J Invest Dermatology. 2014;134:1512–8.
Richmond JM, Bangari DS, Essien KI, Currimbhoy SD, Groom JR, Pandya AG, Youd ME, Luster AD, Harris JE. J Invest Dermatology. 2017;137:350–8.
Zhang J, Zhou Y, Jiang Z, He C, Wang B, Wang Q, Wang Z, Wu T, Chen X, Deng Z, Li C, Jian Z. J Nanobiotechnol. 2023;21:354.
Zhao H, Zeng Z, Liu L, Chen J, Zhou H, Huang L, Huang J, Xu H, Xu Y, Chen Z, Wu Y, Guo W, Wang JH, Wang J, Liu Z. Nanoscale. 2018;10:6981–91.
Huang Y, Li Y, Hu Z, Yue X, Proetto MT, Jones Y, Gianneschi NC. ACS Cent Sci. 2017;3:564–9.
Sun M-C, Xu X-L, Du Y, Lou X-F, Wang W, You Y-C, Liu D, Jin F-Y, Qi J, Zhu M-X, Zhu L-W, Wang J, Du Y-Z. ACS Nano. 2021;15:17361–74.
Chang Y, Kang P, Cui T, Guo W, Zhang W, Du P, Yi X, Guo S, Gao T, Li C, Li S. J Translational Med. 2023;21:434.
Liang J, Yu Y, Li C, Li Q, Chen P, Li W, Liu W, Li Z, Liu Y, Zhang S, Zhang X. Carbohydr Polym. 2023;305:120549.
Tang Q, Fakih HH, Zain Ui Abideen M, Hildebrand SR, Afshari K, Gross KY, Sousa J, Maebius AS, Bartholdy C, Søgaard PP, Jackerott M, Hariharan V, Summers A, Fan X, Okamura K, Monopoli KR, Cooper DA, Echeverria D, Bramato B, McHugh N, Furgal RC, Dresser K, Winter SJ, Biscans A, Chuprin J, Haddadi N-S, Sherman S, Yıldız-Altay Ü, Rashighi M, Richmond JM, Bouix-Peter C, Blanchard C, Clauss A, J. F., Alterman A, Khvorova. J. E. Harris, Nature Communications 2023, 14, 7099.
Hosking A-M, Juhasz M, Mesinkovska NA. J Am Acad Dermatol. 2018;79:535–44.
Phatale V, Vaiphei KK, Jha S, Patil D, Agrawal M, Alexander A. J Controlled Release. 2022;351:361–80.
Newell B, Zhan W. J Controlled Release. 2023;360:447–67.
Qu F, Geng R, Liu Y, Zhu J. Theranostics. 2022;12:3372–406.
Xie H, Zhou F, Liu L, Zhu G, Li Q, Li C, Gao T. J Dermatol Sci. 2016;81:3–9.
Wang L, Wang Z, Pan Y, Chen S, Fan X, Li X, Chen G, Ma Y, Cai Y, Zhang J, Yang H, Xiao W, Yu M. ACS Appl Mater Interfaces. 2022;14:19975–87.
Zhang D-Y, Younis MR, Liu H, Lei S, Wan Y, Qu J, Lin J, Huang P. Biomaterials. 2021;271:120706.
Zhang D-Y, Liu H, Li C, Younis MR, Lei S, Yang C, Lin J, Li Z, Huang P. ACS Appl Mater Interfaces. 2020;12:56830–8.
Saha I, Rai VK. Carbohydr Polym. 2021;267:118168.
Zhu J, Dong L, Du H, Mao J, Xie Y, Wang H, Lan J, Lou Y, Fu Y, Wen J, Jiang B, Li Y, Zhu J, Tao J. Adv Healthc Mater. 2019;8:1900896.
Ma G, Wu C. J Controlled Release. 2017;251:11–23.
Hou A, Quan G, Yang B, Lu C, Chen M, Yang D, Wang L, Liu H, Pan X, Wu C. Adv Healthc Mater. 2019;8:1900898.
Li S, Zhu G, Yang Y, Jian Z, Guo S, Dai W, Shi Q, Ge R, Ma J, Liu L, Li K, Luan Q, Wang G, Gao T, Li C. J Allergy Clin Immunol. 2017;140:177–189e179.
Kang P, Chen J, Zhang W, Guo N, Yi X, Cui T, Chen J, Yang Y, Wang Y, Du P, Ye Z, Li B, Li C, Li S. Cell Death Discovery. 2022;8:70.
Li B, Yi X, Zhuang T, Zhang S, Li S, Yang Y, Cui T, Chen J, Chang Y, Gao T, Li C, Liu L. J Invest Dermatology. 2021;141:2921–2931e2926.
Gottlieb E, Armour SM, Harris MH, Thompson CB. Cell Death & Differentiation. 2003;10:709–17.
Gumpper-Fedus K, Park KH, Ma H, Zhou X, Bian Z, Krishnamurthy K, Sermersheim M, Zhou J, Tan T, Li L, Liu J, Lin P-H, Zhu H, Ma J. Redox Biol. 2022;54:102357.
Kim JY, Lee EJ, Seo J, Oh SH. Br J Dermatol. 2017;176:1558–68.
Fakkar NMZ, Soltan MYA, Roble AAA. QJM: An International Journal of Medicine. 2023;116:hcad069214.
Cui T, Zhang W, Li S, Chen X, Chang Y, Yi X, Kang P, Yang Y, Chen J, Liu L, Jian Z, Li K, Wang G, Gao T, Song P, Li C. J Invest Dermatology. 2019;139:2174–2184e2174.
Rashighi M, Agarwal P, Richmond JM, Harris TH, Dresser K, Su M-W, Zhou Y, Deng A, Hunter CA, Luster AD, Harris JE. Sci Transl Med. 2014;6:223ra223–3.
Khaitan BK, Sindhuja T. Autoimmun rev. 2022;21:102932.
Xie B, Sun J, Song X. Clin Rev Allergy Immunol. 2022;63:417–30.

No competing interests reported.

SupportingInformation.docx

Download PDF

Editorial decision: Revision requested
19 Aug, 2024
Reviews received at journal
12 Aug, 2024
Reviewers agreed at journal
12 Aug, 2024
Reviews received at journal
26 Jul, 2024
Reviewers agreed at journal
08 Jul, 2024
Reviewers agreed at journal
22 Apr, 2024
Reviews received at journal
08 Apr, 2024
Reviewers agreed at journal
18 Mar, 2024
Reviewers agreed at journal
31 Jan, 2024
Reviewers agreed at journal
26 Jan, 2024
Reviewers invited by journal
26 Jan, 2024
Editor assigned by journal
17 Jan, 2024
Submission checks completed at journal
17 Jan, 2024
First submitted to journal
15 Jan, 2024

You are reading this latest preprint version

Biomimetic Polydopamine Loaded with Janus Kinase Inhibitor for Synergistic Vitiligo Therapy via Hydrogel Microneedles

Status:

Version 1

Abstract

Background

Results

Conclusions

Figures

Introduction

Methods

Materials

Characterizations

Synthesis of PDA and PDA-JAKi nanoparticles

Catalytic ability against H₂O₂

Free radical scavenging assays

Preparation of microneedle patches

Mechanical strength of MN detection

Permeability ability of HA MN detection

Cell experiments

RNA isolation and quantitative real-time PCR analysis

Animal experiments

Statistical analysis

Results and discussion

Preparation and characterization of PDA-JAKi

Fabrication and characterization of PDA-JAKi MN

PDA-JAKi protect melanocytes from H₂O₂-induced apoptosis

PDA-JAKi reduce H₂O₂-induced oxidative stress in keratinocytes

PDA-JAKi inhibit the release of HMGB1 and secretion of CXCL10/16

PDA-JAKi MN treatment improve hair follicle growth in vitiligo mice

Conclusions

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1

Biomimetic Polydopamine Loaded with Janus Kinase Inhibitor for Synergistic Vitiligo Therapy via Hydrogel Microneedles

Status:

Version 1

Abstract

Background

Results

Conclusions

Figures

Introduction

Methods

Materials

Characterizations

Synthesis of PDA and PDA-JAKi nanoparticles

Catalytic ability against H2O2

Free radical scavenging assays

Preparation of microneedle patches

Mechanical strength of MN detection

Permeability ability of HA MN detection

Cell experiments

RNA isolation and quantitative real-time PCR analysis

Animal experiments

Statistical analysis

Results and discussion

Preparation and characterization of PDA-JAKi

Fabrication and characterization of PDA-JAKi MN

PDA-JAKi protect melanocytes from H2O2-induced apoptosis

PDA-JAKi reduce H2O2-induced oxidative stress in keratinocytes

PDA-JAKi inhibit the release of HMGB1 and secretion of CXCL10/16

PDA-JAKi MN treatment improve hair follicle growth in vitiligo mice

Conclusions

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1

Catalytic ability against H₂O₂

PDA-JAKi protect melanocytes from H₂O₂-induced apoptosis

PDA-JAKi reduce H₂O₂-induced oxidative stress in keratinocytes