Identification and expression analysis of  Jr4CLs  gene family based on transcriptome and physiological data in Walnut ( Juglans regia )

doi:10.21203/rs.3.rs-3871772/v1

Shoot shriveling severely threat growth and development of deciduous trees in northern hemisphere, its essence is imbalance of water absorption and evaporation in the branches. In this study, the physiological characteristics of 'Xiangling' and 'Liaohe (Liaoning No. 4)' during the overwintering process were studied, and key overwintering periods were selected for transcripome analysis. The results showed that plant hormone metabolism, wax metabolism and lignin metabolism were significantly enriched during the overwintering process. Combined with Jr4CL family analysis, the high-expression gene (Jr4CL44) under drought stress was selected by real-time fluorescence quantitative screening for functional verification. Overexpression of Jr4CL44 can effectively remove the reactive oxygen species produced by drought stress, increase lignin content and up-regulate the expression of related genes to improve the drought resistance of Arabidopsis thaliana. These results indicate that Jr4CL44 plays an important role in plant resistance to drought stress, which laies a foundation for further study on the functions in practice.

Walnut

Shoot shriveling

Transcriptomics

Lignin metabolism

Jr4CL44

Drought

Walnut (Juglans regia) not only contains rich nutritional value and economic value of cultivation (Waqar et al. 2020), but also with the implementation of the project of returning farmland to forest, the planting areas of walnut have increased significantly, which have been become an important pillar industry for farmers in mountainous areas to get rid of poverty (Almario et al. 2001). Shoot shriveling caused by strong evaporation in early spring seriously threat fruit production in the dry and cold areas of northern China, it was found that early spring fruit trees such as Malus domestica (Erturk et al. 2020), Pyrus species (Yin et al. 2002) and Prunus persica (L.) Batsc (Lin et al. 2004) were all affected by shoot shriveling in wintering, and gradually intensified with global climate change. Therefore, shooting shriveling has become an important factor limiting the safe winter and large-scale development of walnuts.

Most researchers believes that the essence of the shoot shriveling is the physiological drought of the tree caused by the weak overwintering ability of the branches and the water consumption of the branches greater than the water absorption of the roots (Adrian et al. 2009). Studies had shown that soluble sugar, as a low-molecular-weight compound, played an important role in maintaining the stability of cell membranes and improving the cold resistance of plants (Kwon et al. 2022). In higher plants, the enzymes closely related to sucrose metabolism mainly include sucrose phosphate synthase (Wang et al. 2022), sucrose synthase (Banzouzi et al. 2022) and invertase (He et al. 2022) play an important role in the transportation, metabolism and accumulation of sugar. Plant hormones play a crucial part in abiotic stress they can improve the adaptability of plants to the external environment by regulating endogenous hormones (Waadt et al. 2022). As an important storage material in plants, the content of soluble starch was closely related to the cold resistance of plants under different low temperature stress (Yang et al. 2013). And the content of soluble starch will decrease when plants were subjected to salt stress, it is because the low temperature enhanced the activity of starch hydrolyzing enzymes, accelerating the decomposition of starch (Boriboonkaset et al. 2013).

Lignin is a complex macromolecular organic compound formed from p-coumarol, sinapol and coniferol (Dong et al. 2022), it is one of the components of the secondary wall, which provides a guarantee for the plant to resist the invasion of various adverse environments and transport the water necessary for growth and development (Qu et al. 2023). Recent studies had shown that drought stress can increase the expression of HCT, CCoAOMT and POD in phenylpropane metabolism pathway, thus increasing the lignin content (Gu et al. 2020). AtCCoAOMT1 gene positively responded to salt stress and its expression level was significantly up-regulated, and CCoAOMT1 can also respond to drought stress through ROS and ABA signals (Chun et al. 2021). Although lignin plays an essential role in plant growth and development, only a few cells accumulate large amounts of lignin under normal growth mechanisms (Chen et al. 2022). Therefore, the study of lignin biosynthesis mechanism and the regulation of lignin from molecular level have been a hot issue at home and abroad, which have great practical significance and industrial application prospect in actual production.

In recent years, transcriptome analysis has become an effective method to generate a large number of gene sequences and construct expression profiles, and plays an important role in the mining of plant resistance genes and stress response mechanisms. At present, the researches on shoot shriveling were only limited to the physiological basis, and the mechanism had not been systematically explored. Therefore, in this study, we conducted transcriptomic analysis of two kinds of walnut with different overwintering performance, the key gene 4CL of lignin metabolism was screened and the whole genome bioinformatics analysis was performed. The differentially expressed gene (Jr4CL44) was screened by real-time fluorescence quantitative analysis, and the expression of Jr4CL44 under drought stress was identified by bioinformatics analysis and genetic transformation, which will provide a new way to analyze the regulation mechanism of walnut responsed to drought.

Material handling and index determination

The annual walnut branches of 'Xiangling' and 'Liaohe (Liaoning No. 4)' from Bahutai Rongsheng Farm, Xinzhuang Town, Honggu District, Lanzhou City were used as experimental materials. The annual branches separately in November 25, 2020 (4 ℃ / -4 ℃), December 24, 2020 (4 ℃ / -10 ℃), January 25, 2021 (5 ℃ / -9 ℃), March 25 (15°C/-1°C) and March 25, 2021 (18°C/5°C) were collected, which were named as initial dormancy, middle dormancy, deep dormancy, freeze-thaw alternate and budding period according to their characterist.

The content of soluble sugar was determined by anthrone colorimetric method (Depuydt et al. 2011). The content of soluble starch was determined by iodine color development (Shibasaki et al. 2009).The sucrose phosphate synthase (SPS) activity was measured by high performance liquid chromatography (Irving et al. 1968). The plant sucrose invertase (Inv) activity was measured by spectrophotometry (Jeon et al. 2010). Amylase (Amy) activity was determined by iodine-starch colorimetry (Xing et al. 2015). Coomassie brilliant blue staining (G-250) method was used to determine SP (soluble protein) content (Deborah et al. 2015).

Transcriptome assay

According to the previous research on physiological and biochemical indicators, three periods with significant differences were screened out (initial dormancy, deep dormancy and freeze-thaw alternate phases). The branchesof three periods were delivered to Shanghai Ouyi Biomedical Technology Co., Ltd. for transcriptome analysis. To ensure data reliability, three replicates of each sample were sequenced.

The total RNA of each sample was extracted by Trizol method, and 1% agarose gel electrophoresis was used for preliminary analysis of RNA degradation. Nanodrop and Agilent 2100 were used to test the concentration and integrity of RNA. After passing the quality inspection, a cDNA library was constructed and sequenced using Illumina HiSeq 2000. The platform performed the high-throughput sequencing work of this experiment. Clean reads were obtained after removing the reads with adapters and low quality from the raw transcriptome data. Clean reads were assembled and assembled using Trinity software to obtain transcripts (Transcripts) and genes (Unigenes) of different sizes. FPKM values were used to estimate gene expression levels, and Cufflinks software was used to analyze the FPKM values obtained by sequencing.The DEGs were compared with databases such as PFAM (Protein family), KEGG (Kyoto Encyclopedia of Genes and Genomes), and GO (Gene Ontology) to obtain functional annotation information of DEGs, and GO and KEGG enrichment analysis was performed on DEGs.

Identification and bioanalysis of Jr4CLs in Walnut

Jr4CL family genes protein sequences were obtained from walnut genomic data (https://iris:angers.inra.fr/gddh13/). The hidden Markov model (PF01151) was downloaded from the website Pfam (http://pfam.xfam.org/), and the candidate gene family obtained by preliminary screening was verified by the online software SMART (https://smart.embl-heidelberg.de/). ExPASy Proteomics Server (http://web.expasy.org/protparam) was used to analyze the molecular weight, length, isoelectric point and hydrophilicity of Jr4CLs amino acid sequence. The online software MEME (http://meme-suite.org/tools/meme) was used to predict the conserved motifs of the Jr4CLs, and the maximum number of conserved sequences was set to 10. The gene structure and conserved motif of Jr4CLs in walnut were mapped by TBtools. The phylogenetic tree of the family members was analyzed using MEGA 7.0 software. Chromosome mapping of Jr4CLs in walnut was performed using MapChart2.2 software and TBtools. The cis-acting elements of 2000 bp upstream of the Jr4CLs promoter were analyzed by PlantCARE, and then the number of hormone induction, environmental adaptation and stress-induced expression elements were counted.

Quantitative expression analysis of Jr4CLs

The four-week-old 'Liaohe' was used as the material in the tissue culture room of the Department of Fruit Science, Horticulture College, Gansu Agricultural University. Walnut test-tube seedlings with robust and consistent growth were treated with 20% (w) polyethylene glycol (PEG) for 48 hours respectively, and the normal growth test-tube seedlings were used as control with three biological repeats. The leaves of the tested seedlings were collected and frozen with liquid nitrogen, and then stored at -80 ℃ for subsequent RNA extraction.

The total RNA was isolated by TRIzol kit (Invitrogen, Carlsbad, CA, USA), cDNA was synthesized from total RNA using a PrimeScript™ RT reagent kit with gDNA Eraser (Perfect Real Time; TaKaRa Biotechnology, Dalian, China) according to the manufacturer’s instructions.The qRT-PCR assays were performed with SYBR Green PCR Master Mix (Takara). The primers used for real-time PCR are shown in Table 1. The reaction system is: 10µL of TB GreenⅡ, 2µL of upstream and downstream mixed primers, 6 µL of ddH20, 2µL of cDNA, and a total volume of 20 µL. The reaction conditions are: 95°C predenaturation for 3 minutes; 95°C denaturation for 5 s, 58°C annealing for 30s, 72°C extension for 30s, 40 cycles. The qRT-PCR analysis of each sample was calculated from three biological replicates. And use 2-∆∆CT to calculate the relative expression of genes, and use SPSS software's single factor analysis method to analyze the significance of differences.

Table 1

Primers used in this study
Gene ID	Gene name	Primer sequence (F)	Primer sequence (R)	Purpose
JreChr01G10261	Jr4CL1	CATTTCCACTCTCCGCACCTTCTC	TTCTTCTTCGTCCTCTTCGTCTTCTTG	qPCR
JreChr01G10401	Jr4CL2	CGGTTCTTGATCTCACTGGCTTCC	GCATAATTCCAATTCGACCCGTTGAC
JreChr01G10828	Jr4CL3	AGGAACAGCACAAACCCTCGT	CGCTGGCTGAGCTTCTCTCT
JreChr01G10888	Jr4CL4	TGCTGTACTCACCTTACCTTCAACG	TTCTTCTTCCTTCTTGTTTCACCTCTCC
JreChr01G11687	Jr4CL5	GTGTGAGAGAGTGAAAGAAGCAAGAATG	ACATCCAGAGAAGCCAGTTCAATTACC
JreChr01G12667	Jr4CL6	ACAGCACAAACCCTCGTCTTTCAG	TTGAATCTCCCAGAACAGAAGCCTTG
JreChr01G13040	Jr4CL7	TGCTGTACTCACCTTACCTTCAACG	TTCTTCTTCCTTCTTGTTTCACCTCTCC
JreChr01G13626	Jr4CL8	CGGTTCTTGATCTCACTGGCTTCC	GCATAATTCCAATTCGACCCGTTGAC
JreChr02G10700	Jr4CL9	GTAGGTGGTTGTGGTGTGGAAGTG	CATTCATCAGTCTAGCATACGGGTAGTC
JreChr02G11270	Jr4CL10	CTGGTGGGACTCATCGTCAAGAAC	CAACTATGTCAGATTGCCATCCAAAGC
JreChr02G11899	Jr4CL11	CATTTCCACTCTCCGCACCTTCTC	TTCTTCTTCGTCCTCTTCGTCTTCTTG
JreChr03G10018	Jr4CL12	TTGGAGAATACGGAGAACATGAATCGG	GAGGACATAGAATCGGTGGTTGAGC
JreChr03G12827	Jr4CL13	GAGTACCTTGCTGTCCTCAGATCATTG	TGCTCCTCTTGTTGCTGTTCATGG
JreChr03G13128	Jr4CL14	CTGACATAGAAGTGACAATGGTGGAGAG	ACAACATTGAGATGGAGAACGGTAAGG
JreChr03G13375	Jr4CL15	CGAATACGATGAGTTTGGACCACCTAG	TTAAGCCGTTTCCCATCACAATCCC
JreChr03G13461	Jr4CL16	ACAAACTCAGCCGCCTCCAA	GGGTGCAATGGACCAACTGC
JreChr04G11976	Jr4CL17	GCAGCAGCAGCAACTAAATCAGAAG	TGAGTGGTTGGAGGCATTGGTAAAG
JreChr05G11706	Jr4CL18	CGAATACGATGAGTTTGGACCACCTAG	TTAAGCCGTTTCCCATCACAATCCC
JreChr05G11730	Jr4CL19	TCCGACCTCCTACCTGACCTAATTG	ATCTTGGTCTGCGGCAACGATAAG
JreChr05G12314	Jr4CL20	CTGACATAGAAGTGACAATGGTGGAGAG	ACAACATTGAGATGGAGAACGGTAAGG
JreChr05G12962	Jr4CL21	GAGTACCTTGCTGTCCTCAGATCATTG	TGCTCCTCTTGTTGCTGTTCATGG
JreChr06G11268	Jr4CL22	ACCCTTCATCTTCTTTCCTCCCAATTTC	TAGACTTCTTGATTGACGGTGGTGTTAC
JreChr06G11338	Jr4CL23	CGAGCCACCCAAGCAAGACTATATC	ACTTTCATCCTTTCGCTGATCTTCTCTC
JreChr06G11877	Jr4CL24	CAGCCATACCAACGACTCGGATTC	TCCCTGAATACCCTCCCTGTGAAC
JreChr07G11075	Jr4CL25	TCCGACCTCCTACCTGACCTAATTG	TGATCTTTATCTGCGGCAACAATAAGC
JreChr07G11306	Jr4CL26	GAAGCAGCCGAATAGCCAACAATTAC	CCACGAGCCTCATGTCCAAATCC
JreChr07G11325	Jr4CL27	CAATCTCCAAGCCAACCACCTCTC	AAGCAGTGTCAGTCTTCCCAAACG
JreChr07G11607	Jr4CL28	AGAGCTTGACAGTTGGGATTTGGATG	CTCTCAGACACAACATTCTTGGAGGAG
JreChr07G11893	Jr4CL29	AGTTTGGCAGAAAGGGTAAGAAGAGAG	TGACTGAACGTAGCTGATAACCACATC
JreChr07G11894	Jr4CL30	CAGTGGCAGTGTGGAAGAGGAAC	GACTAGGGAACGCAGAGCAAAGAG
JreChr07G11896	Jr4CL31	CAAGCTGGTCACATCAATTCAACTCTG	AAGAGGAGGAGGAGGAGGAGGAG
JreChr08G10014	Jr4CL32	CACAGCCGTCCACAACCTCATC	AGGTGTTGGGTGGGAAGCAGAG
JreChr08G11472	Jr4CL33	CAACCTCAACCTCCTCCTCCTCTC	GCAAACAGATAATCCAGAAGGGGTAGG
JreChr08G11573	Jr4CL34	ATCTTCTTCCATCTCTACCCTCCCATC	TTCTGTTCATGTTCATTTGTGCATCCC
JreChr08G11599	Jr4CL35	CCCAGCAAAGGATGAGGAAGATAGTG	AGCAAGAACATCTCCATATCAGTGACC
JreChr08G12150	Jr4CL36	AAGAAGCAACCGAGTGACCAACAG	ACATCTCCCTGATCCACCAACCTC
JreChr09G10404	Jr4CL37	CTTTCCACCCTTTGACACCCACTC	CGTCCTTCTCGCTGCCTAACTTC
JreChr10G10412	Jr4CL38	GGCTCTCAAAATCATTTCCGCTCTTG	TTCCTCGGCACTAAGTTGGCATTC
JreChr10G10423	Jr4CL39	GCTTCGGCTCCTTCTTCTACTCAAC	GCTTCGGCTCCTTCTTCTACTCAAC
JreChr10G10964	Jr4CL40	CTGGTTTCTTAGGTGACGGCATCC	GCTTCAAGACCCTCCTCGCTTTC
JreChr11G10166	Jr4CL41	ACACCATCATCGTCATCACACTCATC	TCCAAGCTCTTCTTCACCAGTTGC
JreChr11G10952	Jr4CL42	TAAGGGTTGGCTATCTCGGGGAAG	GGCGTGTGGCTCAAGAACTCTATAG
JreChr11G11200	Jr4CL43	CTGGTTTCTTAGGTGACGGCATCC	GCTTCAAGACCCTCCTCGCTTTC
JreChr11G11369	Jr4CL44	TGGGCGTCAGGAAAGGTGAC	GTCACCTTTCCTGACGCCCA
JreChr12G10316	Jr4CL45	CTGGTTTCTTAGGTGACGGCATCC	GCTTCAAGACCCTCCTCGCTTTC
JreChr12G10871	Jr4CL46	GAACTGATTGGAAAGCTCGGAAACATC	GCGAGTTCAACGGAGTGCTGTAG
JreChr12G11007	Jr4CL47	ACTCCTCCCAAATCGTCTCTCCTG	TTGTGGCACTGTGTCGCTGTATTG
JreChr13G10323	Jr4CL48	GGATGGGTGGATTCAAGCCTTCTG	AGCCTCTTCAGCCTCCTGTGTAG
JreChr13G11269	Jr4CL49	CCAGCGGGAAGACGACAAAGG	CGGTAAACGGCAGGACGAGTG
JreChr14G10240	Jr4CL50	AGGCTCCTTCAAGTATGTGCTGTTC	TGGTGAATTACGGCTCGAAGTATGC
JreChr14G11032	Jr4CL51	TGTTGTGCTGAGGGAGATGAGAGG	CAGTGAAAGAGGTGCTTGGAGAGAG
JreChr16G11309	Jr4CL52	ACACCATCATCGTCATCACACTCATC	TCCAAGCTCTTCTTCACCAGTTGC
	18S	ACACGGGGAGGTAGTGACAA	CCTCCAATGGATCCTCGTTA	Reference gene
JreChr11G11369	Jr4CL44	ATGACACGTACGGAGAGCGAA	TCAAAGTTTGGAGGTGGTAGTAAGTT	Gene clone

Cloning and bioinformatics analysis of Jr4CL44

qRT-PCR analysis showed that the members of Jr4CL family could be significantly induced by drought stress, among which Jr4CL44 displayed the highest expression level. Therefore, Jr4CL44 was selected for gene cloning and functional verification. Leaf RNA was extracted by Trizol method for reverse transcription and concentration determination. cDNA with high concentration was selected as template for target gene cloning. After that, the glue recovery product of the target gene was connected to pMD19-T and transferred to Escherichia coli for testing. The biogenic analysis of Jr4CL44 gene was the same as above.

Acquisition of transgenic Arabidopsis thaliana and determination of physiological indexes

Transgenic Arabidopsis seeds were obtained by infusing inflorescence. The seeds were disinfected with 75% alcohol for 5min, then with 2.6% sodium hypochlorite for 10min, and finally washed with deionized water 4–5 times. The plants were seeded on MS medium containing 30 mg/L kanamycin, and the resistant plants were screened by PCR to obtain hybrid transgenic plants. After three consecutive screening, T3 generation pure and seed transgenic plants were obtained.

Wild type and transgenic lines were selected for normal culture for 5–6 weeks, and 20 leaves of each line were taken and dried at 65℃ overnight, finally mixed and ground into powder with liquid nitrogen. The lignin content of each sample was determined by TGA method (Dampanaboina et al. 2021). The flavonoid content was determined by referring to the method of Böttner (Böttner et al. 2020). In order to investigate the effect of Jr4CL44 on 4CL gene expression downstream of lignin synthesis pathway, Arabidopsis Thaliana of WT and OE-Jr4CL44 were cultured for 6 weeks, the effect of qRT-PCR on the gene expression of 4CL downstream lignin synthesis pathway in two types Arabidopsis thaliana was analyzed. 18s gene was used as the reference and three times was repeated. Primers used in this study were shown below.

Data processing

Parameters were statistically tested by analyses of variance and comparisons of means were performed with a Duncan test (P < 0.05). Statistical analyses were performed with SPSS, version 22.0 (IBM, Armonk, NY, USA). Figures were prepared using the Origin 8.0 software (OriginLab, Hampton, MA, USA).

Analysis of physiological characteristics of overwintering branches of Walnut

The most intuitive manifestation of the shoot shriveling is that the epidermis of the branch shrinks due to water loss. According to the phenotype in the figure below, the epidermal shrinkage of 'Liaohe' was more obvious than that of 'Xiangling'. As we can seen from Fig.1-a, the soluble starch of the two branches increased first and then decreased in the whole overwintering stage, and the content of soluble starch in 'Liaohe' was higher than that of 'Xiangling'. The Fig.1-b showed the change trend of soluble sugar content in 'Xiangling' and 'Liaohe' were basically the same (with a gradual decline from P1 to P5), and the soluble sugar content in 'Liaohe' is always higher than that of 'Xiangling' during the whole overwintering period. The soluble sugar content of 'Xiangling' and 'Liaohe' reach the highest value in P1 (6.585% and 7.347%), while it drops to the lowest in P5 (4.848% and 5.798%). As can be seen from the sucrose content (Fig.1-c), the sucrose content of 'Xiangling' showed a trend of first increasing and then decreasing, reaching the highest point in P2. The sucrose content of 'Liaohe' was higher than that of 'Xiangling', and the sucrose content was 1.25% in P1.

It is showes in Fig.1-d that the glucose content of 'Xiangling' showed a trend of gradual decrease, while that of 'Liaohe' showed a trend of first increase and then decrease. The glucose content of 'Liaohe' was always higher than that of 'Xiangling' from P2. As we can see from Fig.1-e that the sucrose phosphorylase in two walnut varieties generally increased first and then decreased with the extension of overwintering time, and reach the maximum value of 0.0101 mg/g ('Xiangling') and 0.0129 mg/g ('Liaohe') at the same time. It can be seen from Fig.1-f that the amylase activity of the branches of 'Xiangling' and 'Liaohe' increased first and then decreased during the overwintering period, and from P1 to P5, the amylase activity of 'Xiangling' was higher than that of 'Liaohe' in the same period, and the amylase activity of the two branches reach the highest in P4 and P3, respectively, where the amylase activity of 'Xiangling' was 0.1830mg/g, while the activity of amylase in 'Liaohe' is 0.1660mg/g. The activity of sucrose synthase in 'Xiangling' decreases during the overwintering process, while that in 'Liaohe' increase first and then decrease (Fig.1-g). The sucrose invertase activity of 'Liaohe' was higher than that of 'Xiangling' from P1 to P3, and reach a maximum value of 25.485mg/g in P3, while the sucrose invertase activity of 'Liaohe' was always lower than that of 'Xiangling' from P4 to P5 (Fig.1-h).

Transcriptomic analysis of overwintering branches of Walnut

In order to further explore the molecular and related metabolic pathways of shoot shriveling in overwintering, three key periods were selected for transcriptomic analysis. The clustering diagram of sequencing samples obtained according to gene expression is shown in Fig.2-a, and the correlation between the same biological repeats are better. The density distribution of FPKM reflects the expression patterns of protein-coding genes in each sample. It could be seen that 'Liaohe' and 'Xiangling' showed similar change curves during the three overwintering periods, showing non-standard normal distribution (Fig.2-b). In order to clarify the repeatability and overall change trend of transcriptome samples of 'Liaohe' and 'Xiangling' after overwintering stress, intersample principal component analysis (PCA) was conducted using the FPKM values of all annotated genes in six transcriptomic samples as parameters. The results showed that the horizontal, vertical and vertical coordinates could explain 78.59% (PC1), 6.12% (PC2) and 6.37% (PC3) of the total sample variation, the explainable overall variation rate is 91.08%, and there is a significant aggregation trend among samples, indicating that the samples have good repeatability and could be used for subsequent difference analysis (Fig.2-c).

DEGs involved in the plant hormone, cutin and wax biosynthesis pathways

According to KEGG analysis, phytohormone metabolism, cutin and wax play an important role in the overwintering process of plants (Fig.3-a,c). The metabolism of abscisic acid mainly involves PYR, PP2C, SnRK2, and ABF, which can inhibit growth and accelerate aging. XP-035550417 was downregulated in both 'Liaohe' and 'Xiangling', while XP-0188085889 was not significantly different in 'Liaohe', and was up-regulated first and then downregulated in 'Xiangling'. The expression of genes such as AUX1, SUAR and ARF in the auxin pathway regulated cell division and plant growth, and they all showed different trends during overwintering. The metabolism of cytokinin mainly involves CRE1, AHP, B-ARR and A-ARR which reach shoot initiation and cell division, the expression of these genes showed diversity, and XP-018808887 was up-regulated in 'Liaohe' and 'Xiangling', while XP-018819058 showed a trend of rising first and then falling in 'Liaohe', and continue to rise in 'Xiangling' (Fig.3-b).

The formation of long-chain acyl-coA from acetyl-coA can be derived into other fatty compounds through three processes (initialization, elongation, and termination) through three pathways. Acetyl-coA forms long chain acyl-coA by 2.3.1.85 and 6.2.1.3 gene, in which XP-018815548 in 'Liaohe' and 'Xiangling' were progressively down-regulated, while XP-018808861 and XP-018809212 had no significant changes. The other two pathways are more complex and involve multiple genes. For example, acetyl-coA forms 3-Oxoacyl-acp through 2.3.1.180 or Malonyl-CoA through 2.3.1.39, and finally through 3.1.2.14 forms a Long-chain acyl-coA, in with a rising trend in 3.1.2.14 (Fig.3-d).

In the process of lignin biosynthesis, many genes participate in the formation of different types of lignin, among which 4CL gene playes an important role. XP-018812460.2, a gene essential for the formation of P-Coumarcyl CoA from P-Coumaric acid, showed different expression trends in 'Liaohe' and 'Xiangling', suggesting that the expression of lignin genes may affect lignin biosynthesis to regulate plant stress adaptability (Fig.3-e).

qRT-PCR validation of differentially expressed genes

In order to further verify the reliability of transcriptome data, major differential genes involved in plant hormone signal transduction, lignin and wax biosynthesis were selected for qRT-PCR analysis (Fig.4). Transcriptomic analysis revealed that plant overwintering was related to lignin and flavonoid metabolic pathways. 4CL, as a functional gene with both properties, showed a gradual decline in 'Xiangling', while an increase in 'Liaohe' during the overwintering process. In plant signal transduction, SnRK2 and other genes play an important role and the expression trend changed significantly during overwintering. The B-ARR of 'Liaohe' and 'Xiangling' decreased gradually during overwintering, while the change was not obvious in qRT-PCR. CYP86, 1.2.1.84, CER1 and other genes played an important role in fatty acid metabolism and can regulate overwintering. CYP86 of 'Liaohe' increased gradually with the extension of overwintering time, while that of 'Xiangling' decreased gradually. In general, the expression trend of most genes in RNA-seq were more obvious than that in qRT-PCR, but the expression patterns of the two genes are similar, which further proves the reliability of sequencing results.

Identification and analysis of physicochemical properties of Jr4CL family members

AMP-binding-C (PF13193.9) hidden Markov model was used to search and screen walnut 4CL family members, and the analysis was carried out in combination with SMART, NCBI CDD and pfam, and the final retained sequences were identified as members of the walnut Jr4CL gene family, designated as Jr4CL1 to Jr4CL52 according to their chromosomal locations (Table 2). The physicochemical property analysis of the protein sequence showed that the amino acid length is between 268 and 1219 aa using the ProtParam tool. Jr4CL45 has the smallest molecular mass of 29.4 kD. Jr4CL1 has the largest molecular weight of 135.7 kD, the theoretical isoelectric point is between 5.39 and 9.26. The total average hydrophilicity of the protein is 0.120 - 0.295.

Table. 2 Analysis of physicochemical properties of Jr4CL gene family

Gene name	Gene ID	Amino acid number	Molecular weight/D	Isoelectri point	Instability index	GRAVY
Jr4CL1	JreChr01G10261	1219	134709.30	6.04	43.12	0.087
Jr4CL2	JreChr01G10401	565	61938.44	6.79	35.70	-0.027
Jr4CL3	JreChr01G10828	603	66935.68	6.34	45.64	-0.156
Jr4CL4	JreChr01G10888	653	72914.57	6.28	45.57	-0.153
Jr4CL5	JreChr01G11687	694	76587.12	6.91	31.00	-0.069
Jr4CL6	JreChr01G12667	554	60772.60	5.63	37.18	-0.154
Jr4CL7	JreChr01G13040	573	62260.32	5.86	41.61	-0.020
Jr4CL8	JreChr01G13626	544	59499.91	6.06	41.19	-0.013
Jr4CL9	JreChr02G10700	800	88525.12	8.70	31.41	-0.245
Jr4CL10	JreChr02G11270	573	62514.69	6.31	34.47	-0.157
Jr4CL11	JreChr02G11899	394	42854.74	5.39	36.17	0.047
Jr4CL12	JreChr03G10018	832	92312.08	6.26	36.28	-0.203
Jr4CL13	JreChr03G12827	730	80196.55	8.56	30.20	-0.062
Jr4CL14	JreChr03G13128	582	64270.92	7.60	34.50	-0.136
Jr4CL15	JreChr03G13375	555	60992.05	6.83	38.14	-0.087
Jr4CL16	JreChr03G13461	523	56465.37	5.64	32.84	-0.025
Jr4CL17	JreChr04G11976	587	65052.87	8.17	32.67	-0.147
Jr4CL18	JreChr05G11706	572	62357.74	5.54	37.10	0.067
Jr4CL19	JreChr05G11730	697	76624.15	6.91	31.28	-0.054
Jr4CL20	JreChr05G12314	574	62574.92	5.42	33.61	0.014
Jr4CL21	JreChr05G12962	558	60999.74	5.81	36.82	0.023
Jr4CL22	JreChr06G11268	661	73865.53	5.94	40.28	-0.164
Jr4CL23	JreChr06G11338	573	62384.45	7.16	35.08	0.084
Jr4CL24	JreChr06G11877	697	76527.42	6.85	29.46	0.006
Jr4CL25	JreChr07G11075	660	74219.24	6.39	30.63	-0.208
Jr4CL26	JreChr07G11306	563	61944.21	8.39	32.91	-0.132
Jr4CL27	JreChr07G11325	550	59855.19	8.63	34.35	0.044
Jr4CL28	JreChr07G11607	1106	122555.35	9.04	39.53	-0.095
Jr4CL29	JreChr07G11893	550	60700.08	5.86	33.68	-0.011
Jr4CL30	JreChr07G11894	542	59598.00	5.53	30.86	-0.009
Jr4CL31	JreChr07G11896	542	59548.01	5.70	30.09	0.007
Jr4CL32	JreChr08G10014	712	79988.84	6.11	31.42	-0.220
Jr4CL33	JreChr08G11472	694	76403.81	6.81	38.21	-0.068
Jr4CL34	JreChr08G11573	590	65128.47	6.80	33.78	-0.162
Jr4CL35	JreChr08G11599	546	59807.53	6.34	32.74	-0.110
Jr4CL36	JreChr08G12150	534	57489.92	8.41	39.25	-0.050
Jr4CL37	JreChr09G10404	577	63214.78	8.94	43.99	-0.058
Jr4CL38	JreChr10G10412	564	62168.99	7.00	43.88	0.077
Jr4CL39	JreChr10G10423	594	65639.98	7.88	44.52	0.028
Jr4CL40	JreChr10G10964	542	59454.94	8.76	41.64	0.028
Jr4CL41	JreChr11G10166	561	61032.36	7.18	48.20	0.047
Jr4CL42	JreChr11G10952	573	62656.33	6.25	35.24	0.120
Jr4CL43	JreChr11G11200	662	74108.18	5.74	32.05	-0.196
Jr4CL44	JreChr11G11369	524	56485.44	6.36	37.46	-0.019
Jr4CL45	JreChr12G10316	268	29351.72	9.26	47.48	-0.295
Jr4CL46	JreChr12G10871	639	71566.70	6.67	34.22	-0.152
Jr4CL47	JreChr12G11007	525	56369.53	6.22	34.54	0.015
Jr4CL48	JreChr13G10323	544	59467.97	8.80	38.52	0.083
Jr4CL49	JreChr13G11269	727	80820.81	6.82	37.27	-0.116
Jr4CL50	JreChr14G10240	540	59238.40	8.22	38.87	0.066
Jr4CL51	JreChr14G11032	727	80459.38	6.97	37.88	-0.063
Jr4CL52	JreChr16G11309	545	60360.72	6.74	35.30	0.060

Bioinformatics analysis of the Jr4CL family

The gene structure analysis results of the members of Jr4CLs showed that Motif 2 and Motif 6 were common in the family. According to the number and species of Motifs, the evolutionary tree can be roughly divided into three groups, among which Group I contained Motif 1-Motif 7, Motif 9 and Motif 10, without Motif 8, and Group II and Group III do not contain Motif 8. Conservative motif analysis found that most members of the same group have similar Motif, indicating that the genes in the same group have functional similarity (Fig. 5-a). Motif analysis is performed on 52 Jr4CL family member genes using MEME online tool, the results show that the motif 1 and motif 2 have typical AMP-binding -c domains (Fig.5-b).

In order to study the evolutionary relationship of Jr4CL in walnut, phylogenetic tree analysis is performed on 52 4CL amino acid sequences (Fig.5-c). According to sequence similarity and topological structure, the evolutionary tree is divided into 7 4CL subfamilies (I, II, III, IV, V, VI, VII). Subclass I has 8 Jr4CL amino acid sequences, subclass II has 5 Jr4CL amino acid sequences, and subclass III has 7 Jr4CL amino acid sequences. Subclass IV has 4 Jr4CL amino acid sequences, Subclass V has 9 Jr4CL amino acid sequences, Subclass VI has 7 Jr4CL amino acid sequences, and subclass VII has 12 Jr4CL amino acid sequences.

The Fig.5-d showes the chromosome localization and gene replication of the Jr4CL gene family in Walnut. Members of the 4CL gene family are unevenly distributed on 16 chromosomes, and only one gene is found on chromosomes 4, 9 and 16, namely Jr4CL17, Jr4CL37 and Jr4CL52. Eight genes (Jr4CL8, Jr4CL1, Jr4CL2, Jr4CL3, Jr4CL4, Jr4CL5, Jr4CL6, Jr4CL7) are most distributed on chromosome 1, while the genes on chromosome 15 are least distributed. A total of 4 pairs of tandem repeats are identified, including 1 pair of tandem repeats in chromosome 8 and 10, and 2 pairs of tandem repeats in chromosome 7.

To analyze how Jr4CL in walnut is involved in gene expression regulation, cil-acting element analysis of the promoter region (2000 bp) of the Jr4CL family gene in walnut is performed using PlantCARE online (Fig.5-e,f).The results show that the genes promoter of Jr4CL family in walnut contain photoresponsive elements, abscisic acid, gibberellin, auxin and other hormone response elements, and the response elements related to low temperature and defense. Among the many response elements, the number of light response elements is relatively large (ACE, G-box, AE-box, I-box, AT1-motif, GA-motif, etc.), which may play an important role in the growth and development of plants, and the Jr4CL gene of walnut may be able to resist various stresses, speculating that the gene function is diverse.

Expression of Jr4CLs gene under drought stress

In order to identify the expression characteristics of Jr4CLs under stress, drought stress is used as the background. Fig.6 showes that drought stress can significantly induce the expression of most Jr4CLs genes, among which Jr4CL44 and Jr4CL37 have the highest expression. In addition, genes represented by Jr4CL36 and Jr4CL21 are down-regulated.

Bioinformatics analysis of Jr4CL44 gene

The identification of the secondary structure of Jr4CL44 protein showes that it mainly included Alpha helix (Hh) and random coil (Cc), in which α-helix accounted for the largest proportion (Figure .7-a). The hydrophilicity/hydrophobicity of Jr4CL44 protein is predicted by Protscale online software. The results showes that the whole polypeptide chain encoded by Jr4CL44 was less than zero, and it is a hydrophilic protein (Figure .7-b).

The analysis of cis-acting elements on the Jr4CL44 promoter (Figure .7-c,d) showes that it contained a variety of abiotic stress and hormone response elements, such as drought response elements (MBS) and anaerobic induced regulatory elements (ARE), suggesting that Jr4CL44 may be involved in the regulation of abiotic stress tolerance. At the same time, there are several hormone-related elements such as Methyl Jasmonate (CGTCA-motif) and Abscisic acid (ABRE), which indicated that this gene could respond to various external hormone signals, and may play an important role in plant growth and development.

Cloning of Jr4CL44 gene and identification of transgenic Arabidopsis

We clone Jr4CL44 gene using Juglans regia L. cDNA as template, and its band size is 1734bp (Figure .8-a). In order to verify the successful transfer of Jr4CL44 into Arabidopsis Thaliana, RNA and DNA levels of the transformed plants are verified. RNA level verification showes that the PCR band size is about 1734bp, which is consistent with the expected results, indicating that transgenic Arabidopsis thaliana plants are obtained (Figure .8-b). At the DNA level, there are bands in transgenic Arabidopsis using 18s as a reference, but no bands in WT (Figure .8-c).

Determination of physiological indexes of transgenic Arabidopsis thaliana under drought stress

To determine the response ability of Jr4CL44 to drought stress, three Jr4CL44-OE A. thaliana lines and the WT control are cultured under normal and drought stress for 20 days, respectively. As shown in Fig.9-a, WT and transgenic A. thaliana grow well without significant differences in the control of pouring water, while under drought stress, transgenic A. thaliana leaves wilte and yellow more seriously than WT, suggesting that overexpression of Jr4CL44 increased Arabidopsis tolerance to drought. After obtaining the transgenic Arabidopsis thaliana, we quantitatively detect the expression level of Jr4CL44 in WT and overexpressed lines using real-time fluorescence. The results show that the expression level of Jr4CL44 in transgenic Arabidopsis thaliana plants is significantly higher than that in WT ( Fig.9-b).

In order to investigate the function of Jr4CL44 in lignin synthesis pathway, the lignin content in leafs of Arabidopsis thaliana lines at 6 weeks and 8 weeks of age is determined by thioglycolic acid method. The results show that the lignin content of Jr4CL44-OE A. thaliana lines is significantly increased compared with the WT (the content of S-type lignin increased), indicating that Jr4CL44 plays a positive regulatory role in lignin synthesis ( Fig.9-c,d).

The lignin synthesis pathway is closely related to the flavonoid synthesis pathway. In order to study the effect of Jr4CL44 on the flavonoid synthesis pathway, the flavonoid content in Arabidopsis thaliana lines growing normally for 1 month is determined according to the above method. The results show that the flavonoid content of OE-Jr4CL44 is not significantly different from that of WT (Fig.9-e). To investigate the effect of overexpression of Jr4CL44 on downstream gene expression of lignin synthesis pathway, we analyze the expression changes of genes encoding multiple enzymes downstream of 4CL in WT and OE-Jr4CL44 Arabidopsis thaliana. The result showes that C3H, F5H, COMT and CCR genes are significantly up-regulated, indicating that overexpression of Jr4CL44 affectes the expression of some genes downstream of the lignin pathway ( Fig.9-f).

Through DAB and NBT staining of Arabidopsis leaves, it is found that under normal growth conditions, the staining of WT and transgenic Arabidopsis are relatively light and have no significant difference. However, the color of overexpressed Arabidopsis leaves is light under drought stress (Fig.10-a), indicating that the degree of oxidative damage suffered by transgenic Arabidopsis is low under drought stress.

The results of chlorophyll content determination show that there is no significant difference between WT and overexpressed lines under normal conditions, but the chlorophyll content of overexpressed Jr4CL44 is significantly higher than that of WT under drought stress. Electrolyte leakage showes that the electrolyte content of WT is higher than that of OE1, OE2 and OE3 under drought stress, indicating that overexpression of Jr4CL44 reduces the electrolyte leakage of Arabidopsis thaliana under drought stress. Under normal conditions, there is no significant difference in fresh weight between WT and transgenic plants, but the fresh weight of WT and overexpressed lines decrease significantly after drought stress, and the fresh weight content of transgenic lines are higher than that of WT (Fig.10-b).

Additionally, we can know that overexpression of OE-Jr4CL44 could increase the content of various substances to resist stress after drought stress by measuring SOD, POD of two types of Arabidopsis thaliana, but the difference is not significant with WT under normal condition. Therefore, overexpression of Jr4CL44 remarkably increases tolerance to drought stress in Arabidopsis thaliana (Fig.10-b).

Shoot shriveling is one of the common natural stresses in fruit tree production, and has become a research hotspot in fruit tree production and cultivation. The response of fruit trees to shoot shriveling is a complex phenomenon, which is regulated by the pleiotropic genes of many specific molecular networks, the result of the changes of many plant traits, the interaction of various physiological and biochemical effects and genes.

Accumulating osmotic regulating substances is also one of the important mechanisms for plants to adapt to adversity (Álvaro et al. 2018). Soluble sugar is an important osmoregulatory substance in plants and has been shown to be closely related to the cold tolerance of plants (Wang et al. 2022). When plants are subjected to low temperature, soluble sugars will be greatly accumulated in plant cells under low temperature exercise, and the frost resistance of plants will be enhanced (Wan et al. 2012). In this study, the content of soluble sugar and sucrose in osmotic adjustment substances in walnut overwintering period showed a trend of first increase and then decrease, both of which were always higher in 'Liaohe' than in 'Xiangling'. A large number of studies have shown that the content of soluble starch was related to plant cold resistance under different low temperature stresses (Liang et al. 2022). The content of soluble starch in this study showed a trend of low and high, which was similar to the results of Liu (Liu et al. 2018). Invertase (Inv), sucrose synthase (SS), sucrose phosphate synthase (SPS) and amylase are key enzymes in sugar metabolism and are closely related to plant growth and development (Guan et al. 2019). Inv can irreversibly catalyze the decomposition of sucrose into glucose and fructose, SPS is an important enzymes that catalyze the synthesis of sucrose from glucose and fructose (Su et al. 2021). In this study, the SPS activity of 'Liaohe' was always higher than that of 'Xiangling', and the SPS activity increased to the highest value when the temperature was the lowest. Zhang also found convertase and amylase in the study of cold resistance of sugarcane, which had a certain relationship with low temperature stress (Zhang et al. 2015).

At present, transcriptome sequencing technology has been widely used in various plants and adversity studies. The biological processes of plants and the complex regulatory networks involved in plant growth and development play an irreplaceable role in the analysis of stress (Khan et al. 2021, Zhou et al. 2017, Lin et al. 2019). In this study, the Illumina HiSeq sequencing platform was used to sequence the transcriptomes of the three periods of walnut overwintering. KEGG enrichment analysis showed that the overwintering process of walnut was enriched into a variety of biological processes (lipid metabolism, amino acid metabolism, secondary Metabolite metabolism, energy metabolism), among which the main differential genes are mainly concentrated in plant hormone signal transduction, cutin and wax metabolism. Therefore, the overwintering process of plants are a complex process involved the participation of multiple genes and the mutual influence of multiple metabolic processes. Plant hormones are the initiators of cold resistance gene expression and play an important role in the regulation of plant cold resistance (Li et al. 2017). It is generally believed that plant endogenous hormones auxin, gibberellin and cytokinin are growth-promoting hormones, while ethylene and abscisic acid are growth-suppressing hormones (Wang et al. 2017). Under normal circumstances, low temperature stress will increase the content of inhibitory hormones and reduce growth hormones (Meng et al.2016). Although the process of lignin anabolic metabolism have been clearly studied, further studies on lignin regulation of stress are still needed. 4CL in plants mainly exist in the form of gene families, one is involved in lignin monomer synthesis, the other is involved in flavonoid biosynthesis, and both flavonoids and lignin can protect plants from stress (Tomotaka et al. 2014). In this study, 52 members were identified from the whole genome of walnut by bioinformatics method, and cis-acting element analysis showed that 4CL family contains plant hormone response elements and several stress response elements. Combining transcriptome and drought stress experiments, and a highly expressed gene (Jr4CL44) is choosed. For the sake of characterize the response of Jr4CL44 under external stress, we cloned Jr4CL44 gene with 1734bp using template of Juglans regia for subsequent study. Analysis of cis-acting elements of Jr4CL44 was involved in several hormone response elements and drought elements.

Drought stress is carried out after obtaining transgenic Arabidopsis thaliana, the results showed that transgenic and WT Arabidopsis thaliana had different wilting degree under drought stress, but the wilting degree of WT was more serious, which indicated that Jr4CL44 gene could effectively improve drought resistance of Arabidopsis. The results of lignin determination showed that the lignin content of Arabidopsis thaliana with overexpression of Jr4CL44 was significantly higher than that of the WT, while the result of flavonoid determination showed that the overexpression of Jr4CL44 did not affect the synthesis of flavonoids in Arabidopsis Thaliana, indicating that Jr4CL44 was mainly involved in lignin biosynthesis, but did not affect the synthesis of flavonoids. AtC3H, AtF5H and AtHCT have important regulatory functions on the phenylpropane pathway and growth of Arabidopsis (Mondal et al. 2018). The expression analysis of 4CL lignin-synthesis-related genes in Arabidopsis thaliana showed that overexpression of Jr4CL44 significantly increased the expressions of C3H, F5H and COMT genes. These results suggested that Jr4CL44 may promote the lignin deposition in transgenic Arabidopsis thaliana lines by affecting the expression of some downstream genes, and indirectly affected the growth and development of transgenic plants (Wang et al. 2023).

Leaf wilting can seriously affect chlorophyll synthesis, which in turn affects a series of physiological activities of plants (Ahmed et al. 2021). In this study, the chlorophyll content and fresh weight of Arabidopsis decreased under drought stress, and the content of transgenic Jr4CL44 was higher than that of WT, which was consistent with the results of Doron's study (Doron et al. 2020). A large amount of reactive oxygen species (ROS) is produced in plants under abiotic stress (Zhanassova et al. 2021). A small amount of ROS can trigger the signaling pathway in adaptive response, while a high concentration of ROS will cause damage to large molecules such as DNA, proteins and membrane lipids (Melicher et al. 2022). NBT can react with superoxide anion to form blue formosa particles which are insoluble in water and precipitate on the surface of leaves, the lighter the blue color, the stronger the antioxidant capacity of the plant (Li et al. 2022). In this study, the staining degree of transgenic Arabidopsis thaliana was lighter than that of WT, indicating that transgenic strains could better remove superoxide anions and improve the drought resistance of plants. DAB can react with H₂O₂ to produce yellowish-brown insoluble precipitation, which accumulates on the surface of leaves, the darker the color, the higher the H₂O₂ content (Kim et al. 2019). In this study, the staining of non-stressed Arabidopsis was relatively light, and the degree of reddish-brown staining of leaves was gradually deepened after drought stress. Plants themselves will activate two types of protective systems, enzymatic and non-enzymatic, to reduce or eliminate the damage of reactive oxygen species under abiotic stress (Samia et al. 2021). This study showed that drought stress reduced the activities of SOD and POD, and the activities of SOD and POD in transgenic Arabidopsis thaliana were higher than those in WT, indicating that Jr4CL44 can increase the scavenging ability of ROS to a certain extent, which was consistent with the results of Geng in sweet oranges (Geng et al. 2019).

The overexpression of Jr4CL44 in Arabidopsis thaliana have better growth under drought conditions compared to WT, and can effectively clear more reactive oxygen species (ROS). Meanwhile, the expression of genes related to lignin synthesis was up-regulated. Therefore, Jr4CL44 gene playes an important role in drought resistance, which pointe out the direction for further research on other functions of Jr4CL44, and provide a theoretical basis for the improvement of stress resistance of fruit trees.

Contributions

XLM and XYW designed the research. XLM and YLG performed the experiments. YLG and ZXZ performed the data analysis and interpretation. XLM and ZXZ prepared the figures and tables. XLM wrote the manuscript. All authors read, commented on and approved the manuscript.

Declaration of Interest Statement

The authors declare that they have no competing interests.

Funding Information

This work was supported by Special Fund for National Natural Science Foundation of China (Project Number 32160696).

Waqar K, Manzoor H, Kishwar A, Murad A, Mohammad N (2020) Distribution and phenotypic variation in Juglans regia L. growing in Hindu Kush ranges of Pakistan. Acta Ecologica Sinica 40:363-372.
Almario R U, Vonghavaravat V, Wong R (2001) Effects of walnut consumption on plasma fatty acids and lipoproteins in combined hyperlipidemia. The American journal of clinical nutrition 74:72.
Erturk U, Solak A O, Yucel S, Borkoyev B (2020) Determination of nut properties and chemical compositions of Walunt (Juglans regia L.) genotypes grown in genotypes grown in walnut-fruit forests of kyrgyzstan. Fresenius environmental bulletin 29:2809-2817.
Yinsheng L, Falin W, Chunhui M (2002) Adaptability and use of introduced cultivars of Pyrus pyrifolia nakai in Gansu province of China. Acta Horticulturae 587:195-200.
Lin SZ, Zhang ZY, Lin YZ, Zhang L, Guo H (2004) The role of calcium and calmodulin in freezing-induced freezing resistance of Populus tomentosa cuttings. Journal of plant physiology and molecular biology 30:59-68.
Adrian N, Klaus W, Wilhelm B, Koch K (2009) Thermal evaporation of multi-component waxes and thermally activated formation of nanotubules for superhydrophobic surfaces. Progress in Organic Coatings 66:221-227.
Kwon, Hyun J,Nam, Young E, Seok k (2022) Comparative carbohydrate metabolism in the shoots of a cold-hardy and a cold-sensitive peach (Prunus persica) cultivar during cold acclimation and deacclimation[J]. Horticulture, Environment, and Biotechnology 63:39-53.
Wang LH, Zhai YN, Wu JX, Stevanato P, Sha SS, Geng G, Wang YG (2022). Low night temperature-induced feedback inhibition of photosynthesis through sucrose accumulation in sugar beet (Beta vulgaris L.) leaves. Environmental and Experimental Botany 204:55-60.
Banzouzi B V J, Chong PF, Jia XY, Lu WT, Tin YL (2022) Effects of foliar-spraying nitric oxide on the carbon metabolism enzymes activities and nutrients in leaves and roots of Reaumuria soongorica (pall.) maxim seedlings under NaCl stress. Plant Stress 5: 80-92.
He S, Li B, Wang H, Liang SC, Ding ZT, Wang Y, Qian WJ (2023) Characterization of invertase inhibitors (InvInhs) in tea plant, and their potential roles in participating in growth, development and cold response. Scientia Horticulturae 308:23-40.
Waadt R, Seller C A, Hsu P, Takahashi Y, Munemasa S, Schroeder J I (2022) Publisher Correction: Plant hormone regulation of abiotic stress responses. Nature reviews. Molecular cell biology 7:23.
Yang ZF, Wang YF, Xu SH, Xu CW, Yan CJ (2013) Molecular evolution and functional divergence of soluble starch synthase genes in Cassava (Crantz). Evolutionary Bioinformatics 9.
Boriboonkaset T, Theerawitaya C, Yamada N, Pichakum A, Kirdmanee C (2013) Regulation of some carbohydrate metabolism-related genes, starch and soluble sugar contents, photosynthetic activities and yield attributes of two contrasting rice genotypes subjected to salt stress. Protoplasma 250.
Dong XC, Jiang CC, Wei SW, Jiao HJ, Ran K, Dong R, Wang SM (2022) The regulation of plant lignin biosynthesis under boron deficiency conditions. Physiologia plantarum 174:e13815.
Qu DH, Wu FL, Yang J, Li MJ, Yang LN, Xie RX, Su HY (2023) Transcription factor PtNAC101 negatively regulates the lignin synthesis and salt tolerance in Populus trichocarpa. Environmental and Experimental Botany 205.
Gu HL, Wang Y, Xie H, Qiu C, Zhang SN, Xiao J, Ding ZT (2020) Drought stress triggers proteomic changes involving lignin, flavonoids and fatty acids in tea plants. Scientific reports 10:15504.
Chun HJ, Lim L H, Cheong M S, Baek D, Park M S, Cho H Mi, Kim M C (2021) Arabidopsis CCoAOMT1 plays a role in drought stress response via ROS-and ABA-dependent manners. Plants (Basel, Switzerland) 10:831.
Chen RZ, Deng YW, Ding YL, Guo JX, Qiu J,Wang B, Li JY (2022) Rice functional genomics: decades' efforts and roads ahead. Science China (Life Sciences) 65:33-92.
Depuydt S, Hardtke C S (2011) Hormone signalling crosstalk in plant growth regulation. (Special Issue: Plant signalling pathways: A comparative evolutionary overview.). Current Biology 21:9-9.
Shibasaki K, Uemura M, Tsurumi S, Rahman A (2009) Auxin response in Arabidopsis under cold stress: underlying molecular mechanisms. The Plant cell 21.
Irving R M, Lanphear F O (1968) Regulation of Cold Hardiness in Acer negundo. Plant physiology 43:9-13.
Jeon J, Kim N Y, Kim S, Kang N Y, Kim J (2010) A subset of cytokinin two-component signaling system plays a role in cold temperature stress response in Arabidopsi. The Journal of biological chemistry 285:24-30.
Xing H, Chen MH, Li TY, Li JM (2015) Effects of exogenous abscisic acid on cell membrane and endogenous hormone contents in leaves of sugarcane seedlings under cold stress. Sugar Tech 17:59-64.
Deborah L W, Richard H L, Suleiman S B, Dh M (2005) Cold tolerance evaluation of improved diploid and tetraploid cultivars of perennial ryegrass. Crop Management 4:1-11.
Dampanaboina L, Yuan N, Mendu V (2021) Estimation of plant biomass lignin content using thioglycolic acid (TGA). Journal of visualized experiments : JoVE(173).
Böttner L, Grabe V, Gablenz S, Böhme N, Appenroth K J, Gershenzon J, Huber M (2020) Differential localization of flavonoid glucosides in an aquatic plant implicates different functions under abiotic stress. Plant, cell & environment 44:900-914.
Álvaro C B, Carlos P R, Mari C C, José L (2018) Nitric oxide controls constitutive freezing tolerance in Arabidopsis by attenuating the levels of osmoprotectants, stress-related hormones and anthocyanins. Scientific Reports 8:9268.
Wang L, Qian BL, Zhao L, Liang MH, Zhan XQ, Zhu JH (2022) Two triacylglycerol lipases are negative regulators of chilling stress tolerance in Arabidopsis[J]. International Journal of Molecular Sciences 23.
Liu WP, Su SC, Liu X, Hou ZX (2012) Comparison of different cultivars of Blueberry overwintering ability in Qingdao of China[J]. American Journal of Plant Sciences 3:391-396.
Liang G P, Li YM, Wang P, Jiao SZ, Wang H, Mao J, Chen BH (2022) VaAPL1 promotes starch synthesis to constantly contribute to soluble sugar accumulation, improving low temperature tolerance in Arabidopsis and Tomato. Frontiers in Plant Science 13: 920424.
Liu WH, Cheng CZ, Chen FL, Ni SS, Lin YL, Lai ZX (2018) High-throughput sequencing of small RNAs revealed the diversified cold-responsive pathways during cold stress in the wild banana (Musa itinerans). BMC plant biology 18:308-308.
Guan SX, Xu Q, Ma DR, Zhang WZ, Xu ZJ, Zhao MH, Guo ZF (2019).Transcriptomics profiling in response to cold stress in cultivated rice and weedy rice. Gene 685:96-105.
Su JY, Yao Y, Liu YH, Han QY, Zhang WL (2021) Function, structure and catalytic mechanism of sucrose phosphate synthase:a review. Sheng wu gong cheng xue bao=Chinese journal of biotechnology 37:1858-1868.
Zhang BQ, Yang LT, Li YR (2015) Physiological and biochemical characteristics related to cold resistance in sugarcane. Sugar Tech 17:49-58.
Khan H, Ullah I, Zeb U, Zhao P (2021) Identification, characterization and expression profiles of dof transcription factors in common Walnut (Juglans Regia L.). Polish Journal of Environmental Studies 30: 1-12.
Zhou ZC, Han MX, Hou M, Deng XJ, Tian R, Min SF, Zhang JB (2017) Comparative study of the leaf transcriptomes and ionoms of Juglans regia and its wild relative species Juglans cathayensis[J]. Acta Physiologiae Plantarum 39:224-224.
Lin QH, Zhong QZ, Zhang ZH (2019) Comparative transcriptome analysis of genes involved in anthocyanin biosynthesis in the pink-white and red fruits of Chinese bayberry (Morella rubra). Scientia Horticulturae 250:278-286.
Li HB, Li N, Yang SZ, Peng HZ, Wang LL, Wang Y, Gao ZH (2017) Transcriptomic analysis of Casuarina equisetifolia L. in responses to cold stress. Tree Genetics & Genomes 13:7-7.
Wang XC, Zhao QY, Ma CL, Zhang ZH, Gao LH, Kong YM, Yang YJ (2013) Global transcriptome profiles of Camellia sinensis during cold acclimation. BMC genomics 14:415.
Meng D, Tian Z, Hu YH, Zhou HJ, Keith E (2016) De Novo Assembly and Characterization of Bud, Leaf and Flowers Transcriptome from Juglans Regia L. for the Identification and Characterization of New EST-SSRs[J]. Forests 7:247.
Tomotaka S, Kazunori H, Shinichi O, Akiyoshi K (2014) Transcript level analysis of lignin and flavonoid biosynthesis related genes in Eucalyptus globulus. American Journal of Plant Sciences 5:2764-2772.
Mondal S K, Roy S (2018) Genome-wide sequential, evolutionary, organizational and expression analyses of phenylpropanoid biosynthesis associated MYB domain transcription factors in Arabidopsis. Journal of biomolecular structure & dynamics 6:1577-1601.
Wang L, Chen YL, Wu MT, Dai FW, Ye MQ, Chen FP, Huang H (2023) Involvement of lignin deposition and cell wall degradation in stem senescence of Chinese flowering cabbage during storage. Postharvest Biology and Technology 198:112256-112256.
Ahmed A A M, Mohamed E A, Hussein M Y, Sallam A (2021) Genomic regions associated with leaf wilting traits under drought stress in spring wheat at the seedling stage revealed by GWAS. Environmental and Experimental Botany (prepublish) 184:104393-104393.
Doron L, Xu LX, Rachmilevitch S, Stern D B (2020) Transgenic overexpression of rubisco subunits and the assembly factor RAF1 are beneficial to recovery from drought stress in maize. Environmental and Experimental Botany(prepublish) 177:58-63.
Zhanassova K, Kurmanbayeva A, Gadilgereyeva B, Yermukhambetova R, Iksat N, Amanbayeva U, Masalimov Z (2021) ROS status and antioxidant enzyme activities in response to combined temperature and drought stresses in barley. Acta Physiologiae Plantarum 43:1-12.
Melicher P, Dvořák P, Šamaj J, Takáč To (2022) Protein-protein interactions in plant antioxidant defense. Frontiers in Plant Science.
Li J J, Zhang C Lin, Zhang Y L, Gao H N, Wang H B, Jiang H, Li YY (2022) An apple long-chain acyl-CoA synthase, MdLACS1, enhances biotic and abiotic stress resistance in plants. Plant Physiology and Biochemistry 297:110597.
Kim S E, Lee C J, Ji C Y, Kwak S S (2019) Transgenic sweetpotato plants overexpressing tocopherol cyclase display enhanced α-tocopherol content and abiotic stress tolerance. Plant Physiology and Biochemistry 144:436-444.
Samia F, Shah A A, Naveed N H, Nijabat A, Yasin N A, Batool A I, Ali A (2021) Synergistic application of silver nanoparticles and indole acetic acid alleviate cadmium induced stress and improve growth of Daucus carota L. Chemosphere 290:133200.
Geng J J, Liu J H (2019) Supplementary data for the transcription factor Csbhlh18 of sweet orange (citrus sinensis) functions in modulation of cold tolerance and reactive oxygen species homeostasis by regulating the antioxidant gene. Journal of Experimental Botany 69:2677-2692.

Identification and expression analysis of Jr4CLs gene family based on transcriptome and physiological data in Walnut ( Juglans regia )

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Material handling and index determination

Transcriptome assay

Cloning and bioinformatics analysis of Jr4CL44

Acquisition of transgenic Arabidopsis thaliana and determination of physiological indexes

Data processing

Results

Discussion

Conclusion

Declarations

References

Supplementary Files

Status:

Version 1