RESOURCE AVAILABILITY
Lead contact. Further information and requests for resources and reagents should be directed to the Lead Contact, Adrianus C.M. Boon ([email protected]).
Materials availability. All requests for resources and reagents should be directed to the Lead Contact author. This includes viruses, vaccines, and primer-probe sets. All reagents will be made available on request after completion of a Materials Transfer Agreement.
Data and code availability. All data supporting the findings of this study are available within the paper and are available from the corresponding author upon request. This paper does not include original code. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.
EXPERIMENTAL MODEL AND SUBJECT DETAILS
Cells and Viruses. Vero cells expressing human angiotensin converting enzyme 2 (ACE2) and transmembrane protease, serine 2 (TMPRSS2) (Vero-hACE2-hTMPRSS2 27,28, gift from Adrian Creanga and Barney Graham, National Institute of Health) were cultured at 37°C in Dulbecco’s Modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 10 mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid, pH 7.3), 100 U/mL Penicillin, 100 µg/mL Streptomycin, and 10 µg/mL of puromycin. Vero cells expressing TMPRSS2 (Vero-hTMPRSS2) 28 were cultured at 37°C in DMEM supplemented with 10% fetal bovine serum (FBS), 10 mM HEPES (pH 7.3), 100 U/mL Penicillin, 100 µg/mL Streptomycin, and 5 µg/mL of blasticidin.
The SARS-CoV-2 WT strain (2019-nCov/USA-WA1/2020) was obtained from BEI, the BA.5 variant of SARS-CoV-2 (hCOV-19/USA/COR-22-063113/2022) was a gift from R. Webby (St. Jude Children’s Research Hospital), the XBB.1.5 variant (hCoV-19/USA/MD-HP40900-PIDYSWHNUB/2022) was a gift from Andy Pekosz, and the EG.5.1 variant (hCoV-19/USA/CA-Standford-147_S01/2023, GISAID # EPI_ISL_17977757) was from M. Suthar. All viruses were propagated on Vero-hTMPRSS2 cells. The virus stocks were subjected to next-generation sequencing, and the S protein sequences were identical to the original isolates. The infectious virus titer was determined by plaque and focus-forming assay on Vero-hACE2-hTMPRSS2 or Vero-hTMPRSS2 cells.
Recombinant proteins. Prototype recombinant S was expressed as previously described 7,29. SARS-CoV-2 rS, construct BV2373, is a recombinant nanoparticle vaccine constructed from the full-length, wild-type SARS-CoV-2 spike glycoprotein (GenBank accession number, MN908947; nucleotides 21563–25384). The native full-length S protein was modified by mutation of the putative furin cleavage site RRAR to QQAQ (3Q) located within the S1/S2 cleavage domain to be protease resistant. Two additional proline amino acid substitutions were inserted at positions K986P and V987P (2P) within the heptad repeat 1 (HR1) domain to stabilize SARS-CoV-2 S in a prefusion conformation, which is believed to optimize presentation of neutralizing epitopes. The BA.5 rS variant vaccine (construct BV2540) sequence was obtained from the GISAID database (EPI_ISL_12097410.1). To produce construct BV2540, the native full-length S protein was subjected to mutations applied to the ancestral Wuhan-Hu-1 rS plus additional mutations: V3G, T19I, A27S, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, L452R, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K and deletions: ∆L24, ∆P25, ∆P26, ∆H69, ∆V70. The XBB.1.5 variant vaccine (construct BV2601) sequence was obtained from the GISAID database (EPI_ISL_16343574). To produce these constructs, in addition to the 3Q-2P mutations applied to the Prototype Wuhan-Hu-1 rS, the following mutations were introduced to the native full-length S protein: T19I, A27S, V83A, G142D, H146Q, Q183E, V213E, G252V, G339H, R346T, L368I, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, V445P, G446S, N460K, S477N, T478K, E484A, F486P, F490S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, and N969K, as well as Δ24–26 and ΔY144. To produce the XBB.1.16 rS vaccine (construct BV2633, the GISAID database (EPI_ISL_17351426), in addition to the mutations applied to the Prototype Wuhan-Hu-1 rS to produce the BV2601 construct the following mutations were introduced to the native full-length S protein: K986P, V987P, E180V, and K478R. The synthetic transgenes were engineered into the baculovirus vector for expression in Spodoptera frugiperda (Sf9) insect cells. Prototype rS, Prototype + BA.5 rS, XBB.1.15 rS, and XBB.1.16 rS were formulated with Matrix-M adjuvant and stored at 2-8°C.
Hamster experiments. Animal studies were carried out in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocols were approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (assurance number A3381–01).
Immunogenicity analysis. Seven five-week old male hamsters were obtained from Charles River Laboratories and housed at Washington University. Five days after arrival, the animals were immunized via intramuscular injection in the posterior thigh muscles with 1 µg of the protein nanoparticle Prototype rS in 100 µL (50 µL per leg), and 21 days later they were boosted with 1 µg of the same vaccine. Serum was collected 21 days later for the detection of S-specific IgG and IgA by ELISA. After 112 days, the animals received a third dose of the Prototype rS vaccine and 7 days later, the animals were euthanized, and the spleen and draining inguinal lymph nodes (DLN) were collected into 15 mL tubes containing 5 mL of ice-cold RPMI-1640 media with 2% FBS (R2). To generate a single cell suspension from the spleen or lymph nodes, the tissues were mashed using the plunger of a 1 mL syringe and filtered through a sterile 70 µm cell strainer. The cells were spin down at 300 x g for 5 min at 4 °C and red blood cells were lysed with 500 μL RBC lysis buffer (BioLegend) for 1 minute at room temperature. Next, 10 mL of R2 media was added, the cells were spin down, and resuspended in 1 mL ice-cold RPMI-1640 / 10% FBS (R10). Live and dead cells were counted using Acridine orange (AO) and propidium iodide (PI) (Sigma) using a cell counter (Nexcelom Bioscience), and the cells were diluted in R10 to a concentration of 107 cells/mL and used for flow cytometry analysis, and T- and B-cell ELISpot analysis.
Vaccine efficacy analysis. Five-week old male hamsters were obtained from Charles River Laboratories and housed at Washington University. Five days after arrival, the animals were immunized via intramuscular injection with 1 µg of the protein nanoparticle Prototype rS, Prototype + BA.5 rS (bivalent), XBB.1.5 rS, or XBB.1.16 rS vaccine. Control animals received PBS alone. Serum samples were obtained 21 days later and one week later the animals were immunized with a second dose of the same vaccine, and serum was collected 21 days later. Approximately two months later (day 59), the animals were randomly divided into two groups and one group was transferred to the enhanced Biosafety level 3 laboratory and challenged via intranasal route with 1 × 104 PFU of Omicron EG.5.1 variant. The second group followed a week later and was also challenged with 1 × 104 PFU of the EG.5.1 variant. Animal weights were measured daily for the duration of the experiment. Three days after challenge, the animals were necropsied, and their lungs, trachea, and nasal turbinates were collected for virological analysis. These tissues were homogenized in 1 mL of DMEM, clarified by centrifugation (1,000 × g for 5 min) and used for viral titer analysis by quantitative RT-PCR (RT-qPCR) using primers and probes targeting the N gene, and by plaque assay. A nasal wash was also collected, by inoculating 1 mL of PBS with 0.1% bovine serum albumin into one nostril and collecting the wash from the other nostril. The nasal wash was clarified by centrifugation (2,000 × g for 10 min) and used for viral titer analysis by RT-qPCR using primers and probes targeting the N gene, and by plaque assay.
METHOD DETAILS
Focus reduction neutralization titer assay (FRNT). Serial dilutions of serum samples, starting at 1:60, were incubated with 102 focus-forming units (FFU) of different strains of SARS-CoV-2 for 1 h at 37°C. Antibody-virus complexes were added to Vero-hTMPRSS2 cell monolayers in 96-well plates and incubated at 37°C for 1 h. Subsequently, cells were overlaid with 1% (w/v) methylcellulose in Eagle’s Minimal Essential medium (MEM, Thermo Fisher Scientific). Plates were fixed 30 h (WA1/2020 and B.1.351) or 50 h (BA.5, XBB.1.5, and EG.5.1) later with 10% formalin in PBS for 20 min at room temperature. The increase in incubation time for the Omicron variants of SARS-CoV-2 is due to slower replication kinetics. Overlay and formalin were aspirated and plates were washed and sequentially incubated with a pool of anti-S murine antibodies (SARS2–02, −08, −09, −10, −11, −13, −14, −17, −20, −26, −27, −28, −31, −38, −41, −42, −44, −49, −57, −62, −64, −65, −67 and −71 30 and HRP-conjugated goat anti-mouse IgG (Sigma Cat # A8924) in PBS supplemented with 0.1% saponin and 0.1% bovine serum albumin. SARS-CoV-2-infected cell foci were visualized using TrueBlue peroxidase substrate (KPL) and quantitated on an ImmunoSpot microanalyzer (Cellular Technologies).
Virus titration assays. Plaque assays were performed on Vero-hACE2-hTRMPSS2 cells in 24-well plates. Homogenates of lungs, trachea and nasal turbinates, and nasal washes were diluted serially by 10-fold, starting at 1:10, in cell infection medium (DMEM + 2% FBS + 100 U/mL of penicillin-streptomycin). Two hundred and fifty microliters of the diluted virus were added to a single well per dilution per sample. After 1 h at 37°C, the inoculum was aspirated, the cells were washed with PBS, and a 1% methylcellulose overlay in MEM supplemented with 2% FBS was added. Ninety-six hours after virus inoculation, the cells were fixed with 10% formalin, and the monolayer was stained with crystal violet (0.5% w/v in 25% methanol in water) for 30 min at 20°C. The number of plaques were counted and used to calculate the plaque forming units/mL (PFU/mL).
To quantify viral load in lung tissue homogenates and nasal washes, RNA was extracted from 100 µL samples using the MagMax Viral Pathogen Kit (ThermoFisher) on the KingFisher Flex Purification System following the manufacturer’s protocol and eluted with 50 µL of water. Four microliters RNA was used for real-time RT-qPCR to detect and quantify N gene of SARS-CoV-2 using TaqMan™ RNA-to-CT 1-Step Kit (Thermo Fisher Scientific) as described 31 using the following primers and probes: Forward: GACCCCAAAATCAGCGAAAT; Reverse: TCTGGTTACTGCCAGTTGAATCTG; Probe: ACCCCGCATTACGTTTGGTGGACC; 5'Dye/3'Quencher: 6-FAM/ZEN/IBFQ. Viral RNA was expressed as N gene copy numbers per mg for lung tissue homogenates or mL for nasal washes, nasal turbinates, and trachea based on a standard included in the assay, which was created via in vitro transcription of a synthetic DNA molecule containing the target region of the N gene.
ELISA. Ninety-six-well microtiter plates (Nunc MaxiSorp; ThermoFisher Scientific) were coated with 100 µL of recombinant SARS-CoV-2 S protein (Wuhan-1 strain, BA.2, BA.5, or XBB.1.5, generated by Novavax as described above) at a concentration of 1 µg/mL in PBS (Gibco) at 4°C overnight; negative control wells were coated with 1 µg/mL of BSA (Sigma). Plates were blocked for 1.5 h at room temperature with 280 µL of blocking solution (PBS supplemented with 0.05% Tween-20 (Sigma) and 10% FBS (Corning)). The sera were diluted serially in blocking solution, starting at 1:100 dilution and incubated for 1.5 h at room temperature. The plates were washed three times with T-PBS (1X PBS supplemented with 0.05% Tween-20), and 100 µL of HRP-conjugated anti-hamster IgG(H+L) antibody (Southern Biotech Cat. #6061-05) diluted 1:1000 in blocking solution, was added to all wells and incubated for 1 h at room temperature. Alternatively, plates were incubated with biotinylated anti-hamster IgA antibody (Brookwood Biomedical, Cat. # sab3002a) diluted 1:1000 in blocking solution for 1 hours, followed by three washes with T-PBS and 1:5000 diluted HRP-conjugated streptavidin (Zymed). Plates were washed 3 times with T-PBS and 3 times with 1X PBS, and 100 µL of 1-step Ultra TMB-ELISA substrate solution (Thermo Fisher Scientific) was added to all wells. The reaction was stopped after 10 min using 100 µL of 1N H2SO4, and the plates were analyzed at a wavelength of 450 nm using a microtiter plate reader (BioTek).
B-cell ELISpot assay. Enzyme-linked immune absorbent spot (ELISpot) assays were performed to determine the number of S-specific IgG and IgA ASC ELISpot Multiscreen Filter Plates (Millipore) were coated overnight at 4°C with 1 μg/mL of rS from the Wuhan-Hu-1 or EG.5.1 strains of SARS-CoV-2. Control plates were either coated with anti-Syrian hamster IgG (1:100, Jackson ImmunoResearch) or left uncoated. The next day, the plates were blocked for 60 min at 37°C with RPMI 1640 supplemented with 10% FBS. Single cell suspensions of freshly isolated spleen or DLN cells (500,000 cells/well) were added in duplicate to the first row followed by 3-fold serial dilution of the cells. After 6 hours at 37°C, the cells were washed off, and secreted hamster IgG or IgA were detected with a biotinylated anti-Syrian hamster IgG (1:1000, Jackson ImmunoResearch) or anti-Syrian hamster IgA (1:1000, Brookwood Biomedical) detection antibody respectively. Following overnight incubation at 4°C, the plates were washed 3x with T-PBS and streptavidin-conjugated horseradish peroxidase (HRP, Invitrogen) diluted 1:5000 in PBS was added for 1.5 hours at RT. Following another three washes with T-PBS and 1 wash PBS, the plates were developed, and spots were formed through an enzymatic reaction in the presence of 3-Amino-9-Ethyl Carbazole (AEC) and H2O2 (Sigma). ELISpot plates were analyzed using an ELISpot counter (Cellular Technology Limited). Each spot represents an individual ASC and the number of spots indicates the frequency of B cells in the original sample that produces antibodies against the target antigen.
T-cell ELISpot assay. Interferon-gamma (IFN-γ) ELISpot was done according to ELISpot Flex: Hamster IFN-γ kit (MABTECH) specifications. Briefly, the Polyvinylidene difluoride (PVDF)-lined microplates (Millipore) were coated overnight at 4°C with an IFN-γ capture antibody diluted in PBS (15 μg/ ml). Prior to the addition of cells, the wells were washed 5 times with PBS. A total of 500,000 cells in R10, were incubated peptide pools (10 µg/mL) of 15-mer overlapping peptides (BEI-Resources) corresponding to the S1 (1-668) and S2 (659-1273) subunit of S, PMA (phorbol myristate acetate, 0.5 μg/mL) plus ionomycin (1μg/mL) as a positive control, or 1% DMSO as a negative control. After 24 hours, the cells were washed off with PBS and the plates were incubated with 1 μg/mL of biotinylated IFN-γ-specific detection antibody in PBS-0.5% FBS for 2 hours at room temperature. Following another washing step 5 times with PBS the plates were incubated for 1 hours with streptavidin-conjugated alkaline phosphatase (ALP, 1:1000) in PBS-0.5% FBS. After washing 5x with PBS, BCIP/NBT substrate was added until the spots appeared. The color development was stopped by washing the plates extensively with water. ELISpot plates were analyzed using an ELISpot counter (Cellular Technology Limited).
CD4+ cell depletion. CD4+ cell depletion was performed on cells collected from the spleen or draining lymph nodes using DynabeadsTM Biotin Binder kit (Invitrogen) containing magnetic beads. In short, the beads were washed twice with 2% FBS in PBS (P2). As per manufacturer, 50 μL of pre-washed beads were incubated with 10 µg/mL of biotinylated anti-CD4 (GK1.5, BioLegend) for 45 minutes at room temperature. The beads were washed 5 times with P2 and added to one million cells from the spleen or draining lymph node. The mixture was incubated for 30 min on ice with occasional shaking. Using the magnetic stand, the CD4+ cells were removed from the cell population and used for Flow cytometry and ELISpot assay.
Flow cytometry. Staining was performed on the supernatant of CD4-depleted cells or 1x106 of non-depleted cells from the spleen or lymph node. The cells were stained for 30 min on ice with CD4-PE (GK1.5, 1:100, BioLegend), CD8b-BB700 (341, 1:100, BD Biosciences), B220-PE/Cyanine7 (RA3-6B2, 1:100, BioLegend) and Zombie Aqua (1:200, BioLegend) prepared in P2. Then, the cells were fixed with 2% paraformaldehyde and re-suspended in P2. Sample acquisition was done on an Aurora using SpectroFlo v2.2 (Cytek). Flow cytometry data were analyzed using FlowJo v10 (BD Biosciences). CD4 cells and CD8 were selected as live, singlet, and B220- cells.
QUANTIFICATION AND STATISTICAL ANALYSES
Statistical significance was assigned when P values were < 0.05 using GraphPad Prism version 9.3. Tests, number of animals, median and geometric mean values, and statistical comparison groups are indicated in the Figure legends. Analysis of weight change was determined by two-way ANOVA. Changes in infectious virus titer, viral RNA levels, or serum antibody responses were compared between all conditions, and were analyzed by one-way ANOVA with multiple comparisons correction on ln-transformed data. Pairwise comparisons were done using a pairwise t-test.