Experimental design
To address our hypothesis, first, we investigated the association between CART gene (CARTPT) expression and follicular atresia. For that purpose, the expression levels of the CART gene were determined in both healthy and atretic follicles. In addition, the expression levels of the target genes involved in apoptosis (BAX and BCL2), cell survival and proliferation (AKT and β-catenin) and the CYP19A1 gene, which is known to be responsible for converting androgen to estrogen, were evaluated. Second, we examined the effect of FSH, which is known as the primary survival factor for antral follicles by preventing GC apoptosis and inducing steroidogenesis, and CART supplementations on the GC estradiol production. Third, to address whether CART can influence GC steroidogenesis and regulate cell apoptosis in buffalo, we established an in vitro model in which GCs were cultured under four different treatment conditions—either alone (0xFSH) or supplemented with CART (0xFSH + CART), furthermore, two additional groups of GCs were cultured in medium containing FSH, either in the absence (1xFSH) or presence (1xFSH + CART) of CART. In all the studied groups, the main function of the GCs, E2 production, was assessed. Gene expression analysis of CARTPT, BAX, BCL2, AKT and CYP19A1 and protein expression of AKT, p-AKT, GSK3β, p-GSK3β, β-catenin, and LEF1 were also performed. In addition, apoptosis was evaluated in all the experimental groups.
Materials, supplies and chemicals
All plasticware used in this study was purchased from Nunc (Wiesbaden, Germany), while all chemicals and media were purchased from Sigma‒Aldrich Chemical (St. Louis, MO, USA); with the exception of antibodies, fetal bovine serum (FBS) and DMEM were purchased from Gibco BRL (Paisley, Scotland, U.K.).
All studies and procedures were reviewed and approved by the Animal Ethics Committee of the Guangxi Water Buffalo Research Institute (AECGXBRI).
Classification of follicles as healthy or atretic and sample collection
Buffalo ovaries were collected at a local abattoir and transported to the laboratory (within 3 h) in sterile 0.9% NaCl solution at 25–30°C. Follicles with a diameter greater than 8 mm were used to collect follicular fluid for E2 and progesterone (P4) assays. Using previously defined criteria for assessing follicle health, a practical classification system was established based on the relative levels of E2 and P4 found in the follicular fluid [34, 35]. Follicles with an E2/P4 ratio < 1 were classified as atretic follicles, while follicles with E2/P4 > 5 were considered healthy follicles. The GCs from those follicles were collected in Trizol for mRNA extraction and quantification of the differences in the expression levels of relative genes related to healthy and atretic follicles.
Assessment of estradiol and progesterone levels in follicles
The concentrations of E2 and P4 in follicular fluids and of E2 in GC culture medium were evaluated using commercially available enzyme‑linked immunosorbent assay (ELISA) kits supplied by Fankewei (Shanghai, China) according to the manufacturer’s instructions. The assay sensitivity was 0.5 pmol/L, the inter- and intra-assay coefficients of variation (CVs) for E2 were 8.2 and 7.9%, respectively, and the inter- and intra-assay CVs for P4 were 9.4 and 5.6%, respectively. Six replicates were examined for each tested condition, and the results are presented as the levels of the steroids (pmol/L).
RNA isolation and complementary DNA (cDNA) synthesis
Total RNA from buffalo GCs was extracted by using Trizol ® reagent (TaKaRa, Dalian, China) and dissolved in RNase-free water. DNAse digestion was performed to remove any genomic DNA from the extracted samples. A constant amount of RNA (100 ng) was then directly reverse-transcribed into 20 µL of first-strand cDNA by using the PrimeScript RT Reagent Kit with gDNA Eraser (Perfect Real Time, TAKARA BIO INC, Japan) according to the instructions provided by the manufacturer. Finally, the resulting cDNA was stored at -20°C until further use.
Cloning and homology assessment of buffalo CART partial cDNA
A pair of specific primers (F: 50- GCCTACAGACGGTTGACCC-30 and R: 50-TTGCTAAAGCCAGACTCCAGG-30) was designed based on conserved regions found in the nucleotide sequence from the National Center for Biotechnology Information GenBank Nucleotide database for reverse transcription‒polymerase chain reaction analysis of CARTPT mRNA expression in the buffalo ovary. Specimens of buffalo ovarian stroma were obtained from three different animals. A partial CART cDNA fragment was amplified from the buffalo samples by using a TaKaRa Ex Taq kit (TaKaRa, Dalian, China). The thermal cycler program consisted of 35 cycles at 98°C for 10 s, 57°C for 30 s, and 72°C for 1 min. The amplified cDNA was subsequently purified by using a TIAN Gen Mini Purification Kit (TIANGEN Biotech; Beijing Co., Ltd., Beijing, China) and cloned and inserted into the pMD19-T vector (TaKaRa). Next, the plasmids containing inserts were sequenced, and alignment of the nucleotide sequences was performed with the NCBI BLAST program (http://www.ncbi.nlm.nih.gov/BLAST).
Relative quantification of gene expression
The relative expression levels of CART mRNA and related genes in both healthy and atretic follicles and in buffalo GCs cultured under different in vitro culture conditions were measured via quantitative real-time polymerase chain reaction (qRT–PCR). qRT‒PCR. Reactions were performed in a total volume of 20 µL and contained an equal amount of cDNA (100 ng), 10 mM each of the forward and reverse primers (The primer sequences of genes used in this experiment were designed via Primer-Blast online tool, http://www.ncbi.nlm.nih.gov/tools/primer-blast, and listed in Table 1) and 10 µL of 2× SYBR Green Master Mix (SYBR® Premix Ex Taq™ II, TAKARA, Japan). All reactions for all the genes of interest were performed in triplicate and run on a Light Cycler 480 system (Roche Diagnostics) under the following conditions: 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 58°C for 30 s. The relative expression of all the target genes was normalized to that of the endogenous control reference genes β-actin and GAPDH and analyzed with the 2−ΔΔCT method. Before performing the quantitative RT-PCR reactions for the selected genes, the suitability of the both used endogenous control (β-actin and GAPDH) was confirmed by investigating the consistency of their expressions among the experimental samples.
Table 1
Real-time PCR primers data
Gene symbol | Primer Sequence (5’-3’) | Product size (bp) | Accession No. |
BAX | F:GTCTGAAGCGCATCGGAGAT R:GATGGTCCTGATCAACTCGGG | 224 | XM_025269476.1 |
BCL2 | F:AGCGGGAGTTCAGTGTGACT R:AATCGGATGCACTCGTTAGG | 118 | XM_025273634.1 |
AKT | F:AAGAGGCAGGAGGAGGAGAC R:CCCAGCAGCTTCAGGTACTC | 140 | NM_001290841.1 |
CYP19A1 | F:GCTTTTGGAAGTGCTGAACC R:ATCCAGTGAGCAGCAGGACT | 98 | XM_025295054.1 |
CARTPT | F:CTCTGAGCTCTTGCCCATCT R:TGCGCTCCCACCTTTTATAG | 104 | XM_006078190.2 |
β-Catenin | F: GATACCCAGCGTCGTACATC R: TCCTTGTCCTGAGCAAGTTC | 242 | XM_025272907.3 |
β-actin | F: GTCACCAACTGGGACGACAT R: GGTCTCGAACATGATCTGGGT | 153 | XM_025274489.3 |
GAPDH | F: CCTGCCAAGTATGATGAGA | 130 | XM_006065800.4 |
R: AGGTAGAAGAGTGAGTGT |
GC collection, culture and treatment
After the ovaries were collected as described above, they were washed with new saline solution supplemented with 1000 U/mL penicillin and 1000 µg/mL streptomycin. Follicular fluid containing GCs was aspirated from buffalo follicles with a diameter of 3 to 5 mm by using an 18-gauge needle attached to a 10-mL injection syringe, and the GCs were collected by differential centrifugation as described previously [36]. The collected GCs were then pooled together in a 15-mL tube containing DMEM medium supplemented with ITS + 3 (2 µL/mL), IGF-1 (1×10− 6M), androstenedione (1×10− 7M), insulin (10 ng/mL), BSA (0.1%), nonessential amino acids (1.1 mM) and antibiotics (100 IU/mL penicillin and 0.1 mg/mL streptomycin). The cells were washed twice with culture medium and resuspended in 2 mL of medium. Then, the cell number and viability were estimated by using trypan blue exclusion. The determination of GC purity was confirmed based on the presence of follicle stimulating hormone receptor (FSHR), a marker specific to GCs, and the absence of CYP17A1, a marker specific to theca cells.
To explore the effect of either FSH and/or CART on GC function, GCs at a concentration of 2×106 viable cells/well were cultured in 24-well plates at 38.5°C under a humidified atmosphere of 5% CO2 in air. The cells were grown until they reached 40–50% confluence. Next, the cells were incubated with different FSH concentrations (0, 0.25, 0.5, 1, 2, and 4 ng/mL) (Sigma‒Aldrich) for 24 h, after which the E2 concentration in the culture medium was measured. The optimum concentration of FSH was subsequently used to culture GCs with different concentrations (0, 12.5, 25, and 50 µM) of CART (13240; Sino Biological, China) for 24 h, after which the E2 concentration in the collected culture medium was evaluated. The resultant optimum concentrations of both FSH and CART were used in the established culture system of GCs in all further investigations. To investigate the effect of CART on GC steroidogenesis and apoptosis in the presence or absence of FSH, a GC culture model was established. For that, cells (2×106 viable cells/well) were cultured in 24-well plates under a humidified atmosphere of 5% CO2 in air at 38.5°C. The medium was changed every three days. On the sixth day of culture, the GCs were cultured in medium alone (0xFSH), medium supplemented with CART (25 µM; 0xFSH + CART), or medium supplemented with FSH (1 ng/mL) in the presence (1xFSH + CART) or absence of CART (1xFSH) for 24 h. The media were collected and stored at -80°C for subsequent measurement of E2 levels. The cells were washed two times with Dulbecco’s PBS. Afterward, the cultured GCs were subjected to various morphological assessments or harvested using trypsin EDTA and preserved at -80°C for subsequent analysis. All the experiments were replicated at least three times.
Cell apoptosis assay
Cell apoptosis was assessed by using the One Step TUNEL Apoptosis Assay Kit (Green Fluorescence, product code: C1086; Beyotime Biotechnology, Shanghai, China) following the manufacturer’s instructions. In brief, the cells from the treated groups were gently washed with PBS, followed by fixation in 4% paraformaldehyde for 15 minutes at room temperature. Subsequently, the cells were washed again and exposed to a permeabilization solution (freshly prepared with 0.1% Triton X-100 in 0.1% sodium citrate) for 2 minutes on ice. After a brief rinse with PBS, the cells were incubated with the TUNEL reaction mixture in a humidified chamber at 37°C for 1 hour. After a brief PBS rinse, the cells were counterstained with DAPI for 8 minutes to visualize the nuclei. Stained GCs were observed and evaluated with a fluorescence microscope (Nikon Corporation, Tokyo, Japan) to determine the proportion of TUNEL-positive cells.
Immunofluorescence analysis of AKT and β-catenin proteins
The cells in each treatment group were subjected to the immunocytochemistry procedure described in a previous study [37] with some modifications. In brief, the GCs were washed three times with warm PBS and then fixed in a solution of 4% paraformaldehyde in PBS for 1 h at room temperature. The cells were then washed three times with PBS, permeabilized with 0.2% Triton X-100 (Sigma‒Aldrich) in PBS for 20 min at RT and blocked by incubation at RT for 1 h with PBS supplemented with 1% BSA. Afterward, the GCs were incubated overnight at 4°C with a specific primary antibody against AKT (1: 500 dilution, 10176-2-AP; Proteintech), and β-Catenin (1:100 dilution, ab32572; Abcam). In the next day, the GCs were washed three times with 0.05% Tween 20 (P9416; Sigma‒Aldrich) in PBS and incubated in the dark with fluorescein-conjugated goat anti-rabbit (1:500 dilution, ab150077; Abcam) secondary antibody at 37°C for 1 h. After washing twice with PBS, the nuclei were stained with Hoechst 33342 (5 mg/mL) for 5 min. Finally, the cells were washed twice to remove excess Hoechst. Fluorescence was detected using the green and blue fluorescence of a Nikon microscope (Nikon Corporation, Tokyo, Japan).
Western blot analysis of the tested proteins
Western blotting (WB) was performed as described previously [38]. In brief, GCs from each group were harvested, washed twice with cold PBS and lysed in RIPA buffer containing PMSF (R0010; Solarbio, China) at 4°C for 30 min. This was followed by centrifugation at 12,000 rpm for 5 min at 4°C. The lysates were subsequently diluted with 6× protein loading buffer (DL101-02; TransGen, China) and heated to 100°C for 5 min. After cooling on ice, the samples were loaded on a 12% gradient polyacrylamide gel (P0012AC; Beyotime, China), transferred to a polyvinylidene difluoride (PVDF) membrane (ISEQ00011; Millipore, China), and blocked in 8% (wt/vol) Difco Skim Milk in Tris-buffered saline containing 0.1% (vol/vol) Tween-20 (TBST) for 2 hr. As the molecular weight of tested proteins, including β-Catenin (85 kDa), GSK3β (46 kDa), phosphorylated GSK3β (p-GSK3β) (46 kDa), AKT (56 kDa), P-AKT (60 kDa), LEF1 (44 kDa) and β-actin (43 kDa), were different from each other, therefor, each half was probed with a separate primary antibody. The membrane was incubated overnight at 4°C with monoclonal anti-β-catenin (Abcam, ab32572), anti-GSK3β (Abcam, ab227208), p-GSK3β (CST, 9336), anti-AKT (Proteintech, 10176-2-AP), P-AKT (CST, 9271), anti-LEF1 (Abcam, ab22884) and a control protein, β-actin (Abcam, ab8226), diluted 1:1000 in blocking buffer. After washing three times with TBST for 15 min each, the membranes were incubated for 1 hr at 37°C with anti-rabbit IgG (Proteintech, SA00001-2) for GSK3β, p-GSK3β, AKT, P-AKT, LEF1 and β-catenin, while goat anti-mouse IgG (Abcam, ab205719) was used for β-actin as a secondary antibody at a dilution of 1:1000 in blocking buffer. The membranes were then washed three times in TBST (Tris Buffered Saline + Tween 20) and developed using ECL Plus (Beyotime, P0018). Finally, the blot bands were detected with a multifunction imager (Syngene, Cambridge, UK). The intensities of individual bands were normalized to the expression of β-actin. WB was performed three times.
Statistical analyses
A minimum of three biological replicates were used in each experiment. The normality of the distribution of the data was examined. All the data were analyzed using the SPSS11.0 software program (SPSS, Chicago, IL, USA). The statistical differences between the treatment groups were calculated as the mean expression levels of the genes and proteins tested, either in granulosa cells or in healthy and atretic follicles of buffalo, and hormone concentrations, either in follicular fluids or in culture media, were analyzed via one-way ANOVA. All the data are expressed as the means ± SDs of three biological replicates. Probability values less than 0.05 (P < 0.05) and 0.01 (P < 0.01) were considered to indicate statistical significance.