Molecular mechanism of N-acetylcysteine regulating proliferation and hormone secretion of granulosa cells in sheep

doi:10.21203/rs.3.rs-3883705/v1

Download PDF

Research Article

Molecular mechanism of N-acetylcysteine regulating proliferation and hormone secretion of granulosa cells in sheep

https://doi.org/10.21203/rs.3.rs-3883705/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Granulosa cells are not only important supporting cells in follicular development, but also the main cells secreting steroids. The proliferation of GCs and steroid hormone synthesis play a key role in follicular development and atresia. In this experiment, GCs were isolated by follicular fluid aspiration, and identified by immunofluorescence technique. The effects of different concentrations of NAC (50, 100, 500, 1000 µmol/L) on sheep GCs with regards to the antioxidant levels, proliferation, apoptosis, and steroid hormone secretion were investigated. PI3K/AKT inhibitor LY294002 was used to explore the molecular mechanism of NAC on GCs proliferation and steroid hormone secretion in sheep. The results showed that in sheep GCs, all concentration of NAC group could promote the proliferation of GCs and inhibit their apoptosis. Among them, 100 µmol/L NAC had the most significant promote on the proliferation of sheep GCs for 48 h. The expression of CCND1, CDK4 and Bcl-2 in all NAC concentration group was significantly increased, and the expression of Bax was significantly decreased. All concentrations of NAC significantly decreased reactive oxygen species (ROS) concentration and increased the expression of CAT and SOD1. NAC significantly increased the expression of CYP19A1, 3β-HSD and the secretion of estradiol (E₂) and progesterone (P₄) in GCs. In conclusion, NAC activates the PI3K/AKT signaling pathway to promote the proliferation of GCs, E₂ and P₄ secretion of sheep GCs in vitro.

N-acetylcysteine

Granulosa Cell

Proliferation

Hormone Secretion

Ovaries are the main reproductive organs of female animals(Anja and Jens 2013). Follicle is the basic functional unit of ovarian physiological activity(Wang, et al. 2022). Follicles are composed of oocytes and the surrounding GCs and TCs, which can participate in the development and atresia of follicles(Ma, et al. 2023). Granulosa cells are the main functional cells of follicles and play a key role in follicular development. The proliferation and differentiation of GCs directly affect ovarian function, such as follicular growth and development, ovulation, luteal formation and steroid hormone secretion(Li, et al. 2022). Various factors secreted by GCs, including growth factors, cytokines and steroids, are essential for its own survival and follicular growth and development(Matsuno, et al. 2017). Estradiol synthesized and secreted by GCs is one of the main hormones in follicular genesis, which can control the order of follicular development, oocyte selection and maturation before ovulation(Juan, et al. 2021). GCs can also convert androgen synthesized and secreted by TCs into E₂ and produce P₄, while E₂ and P₄ cooperate to regulate the reproductive physiological activities of animals(Havelock, et al. 2004). Therefore, it is necessary to study the physiological function of GCs for ovarian development and improving the reproductive ability of female animals.

Follicular atresia is a normal physiological phenomenon during follicular growth and development. Only a few follicles are selected and develop to ovulation, while more follicles develop atresia, but abnormal follicular atresia can reduce reproductive performance(Zhou, et al. 2019). Follicular atresia exists in different stages of follicular development and is regulated by many factors(Manabe, et al. 2004). Apoptosis is a common trigger of follicular atresia, and GCs is the initial cell group of apoptosis in atretic follicles, earlier than oocytes and TCs, indicating that GCs is also the initiator of follicular atresia(Canugovi, et al. 2010). Apoptosis of GCs directly determines the development and maturation of follicles(Wang, et al. 2014). Studies have shown that granulosa cell apoptosis is an important cause of follicular atresia in cattle, rats and sheep(Jolly, et al. 1994, McRae, et al. 2005, Murdoch 1995).

N-acetylcysteine is the precursor of cysteine and reduced glutathione. It is a compound containing sulfhydryl groups, which can interfere with the formation of free radicals and scavenge reactive oxygen radicals(Uraz, et al. 2013). During follicular development, granulosa cell proliferation and ovulation, the increase of metabolites reduces the activity of antioxidant enzymes, resulting in the rapid accumulation of ROS(Luo, et al. 2021), thus reducing the secretion of estrogen, promoting granulosa cell apoptosis and affecting the quality of oocytes(Tripathi, et al. 2013). However, NAC plays a key role in reducing ROS, inhibiting autophagy and maintaining cell function and morphology(Kang, et al. 2020, Mokhtari, et al. 2017). The results showed that the addition of 0.07% NAC to the diet could promote the embryo survival rate of early pregnant goats(Luo, et al. 2021). Feeding the diet containing NAC could alleviate the oxidative stress and excessive energy loss caused by endotoxin and increase the growth rate(Yang, et al. 2012). At the cellular level, when porcine follicular granulosa cells were cultured in vitro, the addition of 100 µmol/L NAC could improve the proliferation activity of porcine follicular granulosa cells(Guo, et al. 2020), increase the recovery rate of mouse oocytes after cryopreservation and enhance their developmental ability(Whitaker and Knight 2010). Internationally, NAC has been widely studied and has become the focus of medical researchers and livestock industry. With the deepening of research, NAC as an antioxidant, has been widely used in human clinical practice, but there are few studies on its application in animal husbandry. The effects of NAC on proliferation, apoptosis, antioxidation and steroid secretion of sheep GCs and its regulatory mechanism have not been reported.

In this study, the effects of NAC on the proliferation, apoptosis, antioxidant and steroid hormone secretion of sheep GCs in vitro were studied. To explore the molecular mechanism of NAC on GCs proliferation and steroid hormone secretion in sheep. Further deepen the understanding of the ovarian endocrine system, and provide a theoretical basis for the use of NAC to improve the reproductive performance of mammals at the cellular level.

This study was approved and monitored by the Animal Experiments Ethical Review Committee of Northwest Minzu University (XBMU-shmkx-20200025), Lanzhou, China.

2.1 Reagents and culture medium

All chemicals and reagents used in this study were purchased from Sigma-Aldrich Chemical Company (St. Louis, MO, USA) unless otherwise stated. The NAC stock solution concentration of 10 mM was obtained by dissolving 0.1632 g of NAC (MCE, New Jersey, USA) in 100 mL of serum-free DMEM/F12 culture solution (Gibco, Carlsbad, CA). After filtration with 0.22 filter membrane, it was subpackaged and stored at -20°C.

2.2 Isolation and culture of GCs

In July-September (long days), sheep ovaries were collected in Tianzhu County, Gansu, China. Ovaries were collected from three-to four-month-old sheep immediately after slaughter, rinsed with PBS and placed in saline containing 10,000 U/mL penicillin and 10,000 U/mL streptomycin, stored at 37 ℃ for transport and returned to the laboratory within 2 h. Follicular fluid was extracted from ovaries about three to eight mm in diameter, collected into 15 mL centrifuge tubes and then mixed repeatedly with liquid transfer gun. The follicular fluid was filtered by a cell filter with a pore diameter of 100 nm, centrifuged for 8 min at a rotational speed of 1500 r/min and the sediment was collected. Cell precipitates were resuspended with Gibco Dulbecco's Modified Eagle Medium: F-12 (DMEM/F12) culture medium containing 10% FBS (Gibco, Carlsbad, CA) and inoculated in culture dishes. The cell morphology was observed under an inverted microscope and incubated at 37°C, with saturated humidity, in a 5% CO₂ incubator with fluid changes every 24 h until the apposition was complete.

2.3 Immunofluorescence staining

Primary passage GCs were seeded in 96-well plates and the culture was terminated when cells reached 80% confluence. Immunofluorescence was then performed. The GCs were fixed in 4% paraformaldehyde for 30 min and cell membranes were permeabilized with 0.4% TritonX-100 for 15 min. Nonspecific antibody binding was blocked using 5% BSA (Gibco, Carlsbad, CA) for two hours at room temperature. Cells were incubated with FSHR at a concentration of 1:200 (Servicebio, Wuhan, China) overnight at 4 ℃. Cells were incubated with anti-rabbit secondary antibody at a concentration of 1:1000 (Servicebio, Wuhan, China) for one hour the next day at room temperature in the dark. The blank control was incubated with secondary antibodies only. The 4༇,6-Diamidino-2-phenylindole, dihydrochloride (DAPI) stain was used to counterstain nuclei. Cells were washed briefly with PBS three times at the beginning, end and between each step of the staining. Finally, immunostaining was assessed using a fluorescent microscope. The experiment was performed in triplicate.

2.4 GCs treatment

Primary sheep GCs with good growth condition and high cell purity were selected. When the cell confluence reached 80 to 90%, the cells were digested with 0.25% trypsin and cultured in a 1:2 ratio for passaging. The first generation of GCs were selected for subsequent experiments and the influencing drugs were added six hours after the inoculation of the passaged cells. To study the effect of NAC on antioxidants, proliferation, apoptosis and hormone secretion in cultured GCs in vitro, the cells were incubated for 48 h as a blank control group without NAC addition and a test group with an NAC final concentration of 50, 100, 500 and 1000 µmol/L. Three biological replicates were set in each group.

To study the mechanism of NAC on proliferation, hormone secretion in cultured GCs in vitro, Set blank control group, 100 µmol/L NAC group, 20 µmol/L LY294002 (MCE, New Jersey, USA) were incubated with 100 µmol/L NAC for GCs 24 h. All experiments were performed in triplicate.

2.5 Reactive oxygen staining

The ROS levels in GCs were examined using the fluorescent dye 2ʹ,7ʹ- dichlorodihydro fluorescein diacetate (H2DCF-DA). The H2DCF-DA 1:1000 with was diluted with a serum-free culture medium to a final concentration of 10 mM. After treatment, GCs were washed three times slowly with PBS and the diluted stain was added. Incubation for 2 h at 37 ℃ protected from light was followed by three washes with serum-free culture medium. The images were photographed under a fluorescence microscope and the images were analyzed for fluorescence intensity using Image J 2020 to generate histograms. For ROS, the intra- and inter-assay coefficients of variation (CV) were 4.8 and 14.6%, respectively. All experiments were performed in triplicate.

2.6 CCK-8 method

The CCk-8 kit was used to detect the proliferation of sheep GCs cultured with different concentrations of NAC in different time periods. The cells were inoculated in 96-well plates with 1×10⁴ cells per well and the culture medium was discarded after six hours of incubation. The control wells, test wells and blank wells were set up separately and the test wells were spiked with culture solution containing different concentrations of NAC set at 50, 100, 500 and 1000 µmol/L, with the volume of culture solution for each group set at 100 µL. The cells were incubated for 24 h, 48 h and 72 h. 10 µL of CCK-8 solution (MCE, New Jersey, USA) were added to each well and incubated for two hours at 37 ℃ and the optical density (OD) value of each well was measured by UV spectrophotometer. Calculate the cell proliferation viability according to the formula. Cell viability (%) =[(As-Ab)/(Ac-Ab)] ×100. As: absorbance of experimental wells (containing cells, culture medium, CCK-8 solution and NAC); Ac: absorbance of control wells (containing cells, culture medium, CCK-8 solution, without drugs); Ab: absorbance of blank wells (containing culture medium, CCK-8 solution, without cells and drugs). Three biological replicates were set in each group.

2.7 Hormone determination

Enzyme-linked immunosorbent assay (ELISA) was performed to quantify the secretion levels of E₂ and P₄. Sheep GCs were inoculated on a six-well culture plate and cultured with 0, 50, 100, 500 and 1000 µmol/L NAC culture medium for 48 h. The culture fluid was aspirated and the supernatant was collected by centrifugation. The content of E₂ and P₄ in the supernatant was determined according to the steps in the instructions of the Sheep E₂ and P₄ Kit (Mlbio, Beijing, China). Three biological replicates were set in each group.

2.8 RNA isolation, reverse transcription, and quantitative RT-PCR

Total RNA was extracted by the Trizol method (Solarbio, Beijing, China). The concentration and purity of the RNA were measured using a NanoDrop One/OneC spectrophotometer. Gene samples with D260/D280 values between 1.8 and 2.0 were selected and cDNA synthesis was performed with 1 mg high purity RNA using Prime Script TMRT reagent Kit (TaKaRa, Shiga, Japan). The cDNA samples were then assayed by qRT-PCR using SYBR Premix Ex Taq™ II (TaKaRa, Shiga, Japan) and real-time PCR System (Bio-Rad, Hercules, CA, USA). Reaction conditions used for qRT-PCR were initial denaturation and enzyme activation at 95 ℃ for three min, denaturation, amplification and quantification at 95 ℃ for 10 s, 60 ℃ for 30 s, respectively, for 40 cycles. The reactions were performed in triplicate. The internal reference gene was GAPDH and the relative expression of each gene was calculated using the 2^{−ΔΔ Ct} method. Based on the coding regions of each sheep gene published in the GenBank database, real-time fluorescent quantitative PCR primers were designed using Primer Premier 5.0 software. The primers involved in this experiment were all synthesized by Beijing Bginfo, as shown in Table 1.

Table 1

Real-time PCR primer sequences
Gene	Primer sequence (5′-3′)	Product size/bp	Accession number
CDK4	F-AAGTGACCCTGGTGTTTGA	142	NM_001127269.1
CDK4	R-CAGTTGGCATGAAGGAAAT	142	NM_001127269.1
CCND1	F-ATGCTGGTCTGGTGA	185	XM_027959928.2
CCND1	R-GAGGGTGGGTTGGAAATGA	185	XM_027959928.2
Bcl-2	F-ATGCCTTTGTGGAGCTGTATGG	80	XM_027960877.2
Bcl-2	R-ACTGAGCAGTGCCTTCAGAGACA	80	XM_027960877.2
Bax	F-GACAGGGGCCCTTTTGCTT	128	XM_027978592.2
Bax	R-TCAGACACTCGCTCAGCTTC	128	XM_027978592.2
3β-HSD	F-GGAGACATTCTGGATGAGCAG	200	XM_027961610.2
3β-HSD	R-TCTATGGTGCTGGTGTGGA	200	XM_027961610.2
CYP19A1	F-ATGCTGGTGCTGAGTATGTGGT	192	NM_001123000.1
CYP19A1	R-GCTGACAATCTTGAGGGTGTTG	192	NM_001123000.1
CAT	F-TTACCAGATACTCCAAGGCGAAG	221	XM_004016396.5
CAT	R-AAAGGACGGAAACAGTAGAGCAT	221	XM_004016396.5
SOD1	F- CAATCACAGCATCTTCTGGACAAAT	215	NM_001280703.1
SOD1	R-CCTGGTTAGAACAAGCAGCAATCT	215	NM_001280703.1
GAPDH	F-ATGCTGGTGCTGAGTATGTGGT	192	NM_001190390.1
GAPDH	R-GCTGACAATCTTGAGGGTGTTG	192	NM_001190390.1

2.9 Western blot analyses

The treated cells were collected and lysate and PMSF (100:1, Servicebio, China) were added to the cell precipitate. Lysis was performed on ice for 30 min followed by centrifugation at 10,000r at 4 ℃ for 15 min. Protein concentration was determined using the BSA kit (Servicebio, China). The protein loading volume was 50 mg. Separation was performed by electrophoresis using 10% SDS-PAGE followed by electrotransfer to polyvinylidene difluoride membranes (MCE, New Jersey, USA). The membranes were closed in 5% skim milk in TBS/Tween for 1 h at room temperature and then mixed with murine monoclonal antibody Bcl-2(Affinity, USA) and Bax (Servicebio, China) 1:500, rabbit monoclonal antibody PI3K (Servicebio, China), p-PI3K (Servicebio, China), AKT (Servicebio, China), p-AKT (Servicebio, China) 1:2000, mouse monoclonal antibody β-actin 1:1000 (Servicebio, China) with skim milk-PBST co-incubated. The membranes were then incubated with HRP conjugated anti-rabbit or anti-mouse secondary antibody 1:1000 (Servicebio, China) with 5% skim milk-PBST and detected by the Western Lighting ECL detection system. Signals were quantified using Image J 2020.

2.10 Statistical analysis

The entire study was repeated in three separate runs, with three biological replicates for each treatment within each run. Statistical analyses were performed using GraphPad Prism statistics program (version 8.0.2 for windows). A t-test was used to compare two independent groups. A one-way ANOVA followed by Tukey's posthoc test was used to compare more than two groups. Data were expressed as the mean ± standard error of mean.

3.1 Isolation and culture of GCs

Follicular fluid was obtained by aspiration of follicles with a diameter of 3 ~ 8 mm (Fig. 1A). The primary cultured GCs adhered less at 24 h, and basically adhered to the wall at 48 h, showing an irregular polygon. At 72 h, the cells were completely adherent and evenly distributed. When they were spindle-shaped, they could be subcultured (Fig. 1B). When subcultured, the inoculation density was maintained at 1×10⁵ cells/mL, and the cells were partially adherent at 48 h. The cells were basically adherent at 72 h, and the bottom of the dish was covered at 96 h (Fig. 1C).

3.2 GCs identification

Follicle-stimulating hormone receptor is specifically expressed on the cell membrane of GCs, and its immunofluorescence staining is often used as a standard for identifying the purity of GCs. In this study, the positive rate of FSHR in sheep GCs was > 95% (Fig. 2). Immunofluorescence staining confirmed that the isolated cells were GCs, and the purity met the requirements of subsequent experiments.

3.3 NAC promotes GCs proliferation

The proliferation ability of GCs in each NAC concentration group was higher than that in the control group (P < 0.05). Within 48 h of in vitro culture, cell proliferation activity gradually increased. After 48 h in vitro culture, the cell proliferation activity of each group began to decrease. Different concentrations of NAC had different degrees of proliferation-promoting effects on sheep GCs cultured in vitro. When GCs were cultured in vitro for 48 h, the proliferation-promoting effect of NAC concentration of 100 µmol/L was the most significant (Fig. 3A). The expression levels of cell proliferation-related genes CCND1 and CDK4 were detected by qRT-PCR. The results showed that compared with the control group, the expression levels of CCND1 and CDK4 in the 100 µmol/L NAC experimental group were significantly up-regulated (P < 0.05, Fig. 3B ~ C). The above results suggested that different concentrations of NAC could promote the proliferation of sheep GCs in vitro, and the 100 µmol / L NAC treatment group had the most obvious effect.

3.4 NAC inhibits GCs apoptosis

The expression levels of apoptosis-related genes Bax and Bcl-2 were detected by quantitative RT-PCR to investigate the effect of NAC on GCs apoptosis. The results showed that compared with the control group, the expression level of Bcl-2 in GCs of each concentration of NAC group was significantly up-regulated, and the expression level of Bcl-2 in 100 µmol/L NAC group was the most significantly up-regulated (P < 0.05, Fig. 4A), while the expression level of Bax gene in each concentration of NAC group was significantly down-regulated, and the 100 µmol/L NAC group was the most significantly down-regulated (P < 0.05, Fig. 4B). WB test results showed that compared with the control group, the expression level of Bcl-2 protein in GCs of NAC test group was significantly up-regulated (P < 0.05), and the expression level of Bcl-2 in 100 µmol/L NAC group was the most significant (P < 0.05). The expression level of Bax protein was significantly down-regulated (P < 0.05), and the 100µmol/L NAC group was most significantly down-regulated (Fig. 4C ~ E). These results indicated that NAC could inhibit the apoptosis of sheep GCs in vitro.

3.5 NAC enhances the antioxidant capacity of GCs

The effect of NAC on ROS content in GCs was observed by reactive oxygen staining. Compared with the control group, each NAC experimental group decreased ROS content (Fig. 5A). Image J software was used to analyze the fluorescence intensity of staining and generate histograms. The results showed that compared with the control group, the ROS content in GCs of each NAC test group was significantly reduced (P < 0.05), and the ROS content in 100 µmol/L NAC group was the most significant (Fig. 5B). The expression levels of endogenous antioxidant genes SOD1 and CAT were detected by qRT-PCR. The results showed that compared with the control group, the expression levels of SOD1 and CAT in each NAC concentration group were significantly up-regulated (P < 0.05), and the expression levels of SOD1 and CAT in the 100 µmol/L NAC group were significantly up-regulated (P < 0.01, Fig. 5C ~ D). The above results indicate that NAC can improve the antioxidant capacity of sheep GCs cultured in vitro.

3.6 NAC promotes GCs secretion of P₄ and E₂ through 3β-HSD and CYP19A1

The contents of P₄ and E₂ in the supernatant of GCs cultured in vitro were detected by ELISA to explore the effect of NAC on the secretion of steroid hormones by GCs. The results showed that the secretion of E₂ and P₄ in each NAC concentration group was significantly higher than that in the control group (P < 0.05). Among them, the secretion of E₂ and P₄ in the 100 µmol/L NAC test group was significantly higher than that in other groups (P < 0.01, Fig. 6A ~ B). The expression levels of hormone production-related genes CYP19A1 and 3β-HSD were detected by qRT-PCR. The results showed that compared with the control group, the expression levels of P₄ and E₂-related synthetic genes 3β-HSD and CYP19A1 were significantly up-regulated in each NAC concentration group (P < 0.05), and the expression levels of CYP19A1 and 3β-HSD in the 100 µmol/L NAC group were the most significant (P < 0.01, Fig. 6C ~ D). The above results indicated that NAC could promote the secretion of P₄ and E₂ by sheep GCs cultured in vitro by enhancing the expression of 3β-HSD and CYP19A1.

3.7 NAC regulates GCs proliferation and hormone secretion through PI3K/AKT signaling pathway.

CCK-8 kit was used to detect the cell proliferation activity of blank control group, NAC treatment group (100 µmol/L), PI3K inhibitor LY294002 (20 µmol/L) and NAC (100 µmol/L) co-treatment group. To explore the molecular mechanism of NAC promoting GCs proliferation. The results showed that the proliferation ability of GCs in NAC group was significantly higher than that in blank control group (P < 0.05), while the proliferation ability of GCs treated with PI3K inhibitor LY294002 and NAC was significantly lower than that in NAC treatment group (P < 0.01, Fig. 7A). The contents of E₂ and P₄ in the supernatant of different treatment groups were determined by ELISA kit to explore the molecular mechanism of NAC promoting the secretion of E₂ and P₄ by GCs. The results showed that the PI3K inhibitor LY294002 and NAC co-treatment group significantly inhibited NAC-induced GCs secretion of E₂ and P₄ (P < 0.05, Fig. 7B ~ C).

To further confirm the above results, we used Western blot analysis to detect the expression levels of PI3K, p-PI3K, AKT, and p-AKT proteins in different treatment groups. The results showed that compared with the control group, the expression of p-PI3K/PI3K and p-AKT/AKT proteins in the NAC treatment group was significantly up-regulated (P < 0.05). Compared with the NAC group, the expression of p-PI3K/PI3K and p-AKT/AKT protein was significantly down-regulated after co-treatment with PI3K inhibitor LY294002 and NAC (P < 0.05, Fig. 7D ~ F). These results indicate that NAC regulates the proliferation of sheep GCs cultured in vitro by activating the PI3K/AKT signaling pathway and promotes the secretion of E₂ and P₄ by GCs.

The ovary is the main reproductive organ of female animals and plays a key role in mammalian reproduction. The proliferation, apoptosis and signal communication of ovarian GCs determine the developmental fate of oocytes(Giovanni, et al. 2015). Studies have found that NAC has a significant inhibitory effect on PM2.5-mediated apoptosis and autophagy of human bronchial epithelial cells, reducing cell damage(Guo, et al. 2021), proving that NAC plays an active role at the cellular level. This study found that different concentrations of NAC had a certain effect on the proliferation of sheep GCs cultured in vitro, and 100µmol/L NAC was the most significant, which also confirmed that NAC had a positive effect at the cellular level. Studies have shown that NAC can significantly promote the proliferation of porcine intestinal epithelial cells, and the optimal concentration is 100µmol / L(Long 2014). These findings are consistent with the results of this study.

Follicular development, GCs proliferation, follicular maturation and ovulation are highly complex but regular physiological processes(Prasad, et al. 2016). In this series of processes, the rapid increase in metabolites leads to a decrease in antioxidant enzyme activity, resulting in a rapid increase in ROS levels(Luo, et al. 2021). Under normal physiological conditions, ROS production and antioxidant are in a state of dynamic balance. Appropriate concentration of ROS can promote ovarian development and ovulation(Ketty, et al. 2011). Excessive ROS can lead to oxidative stress, enhance cell damage and activate apoptosis pathways(Kawamoto, et al. 2016), resulting in abnormal follicular atresia(Yamei, et al. 2016), ultimately affecting oocyte quality and reproductive effects(Tripathi, et al. 2013). In this experiment, different concentrations of NAC can reduce the expression of ROS in GCs cells cultured in vitro. It is suggested that NAC can improve the antioxidant capacity of GCs by reducing the content of ROS, thereby inhibiting the apoptosis of GCs. The ROS content was the lowest in the 100 µmol/L NAC group. Compared with the 100 µmol/L NAC group, the ROS content in the 500 and 1000 µmol/L NAC groups increased significantly. It has been found that when different concentrations of NAC are used to detect the glutathione-redox equilibrium in resting macrophages, NAC can steadily increase GSH levels at lower concentrations without significantly affecting GSH conversion to the oxidized form GSSG. However, at higher concentrations of NAC, GSH was significantly converted to GSSG, resulting in a lower GSH/GSSG ratio. Therefore, in unstimulated macrophages, low concentrations of NAC act as antioxidants, while at higher concentrations, it is shown to be a pro-oxidant(Alam, et al. 2010). It has also been found that NAC can inhibit the expression of ICAM-1 induced by tumor necrosis factor-α in endothelial cells at low concentrations, but at higher concentrations(Mukherjee, et al. 2007). In vivo studies have found that low doses of NAC protect rats from endotoxin-mediated oxidative stress, while high doses of NAC increase their mortality due to their pro-oxidative effects(Sprong, et al. 1998). Similarly, high-dose NAC has a pro-oxidant effect on the striatum of healthy rats(Harvey, et al. 2008). High doses of NAC as a pro-oxidant can reduce GSH levels and increase GSSG levels in healthy subjects(Kleinveld, et al. 1992). Therefore, whether NAC can be used as a pro-oxidant or antioxidant depends on factors such as concentration and existing redox state. In this study, unstimulated GCs were used, and there was already an existing GSH pool. Adding a high concentration of NAC may cause a sudden increase in GSH levels in the cells, resulting in a certain cell stress, which may quickly convert part of the GSH pool into GSSG, so that the GSH/GSSG ratio is biased towards a state conducive to oxidation. In addition, by measuring the expression levels of antioxidant-related genes, it was found that the addition of different concentrations of NAC could also change the expression levels of antioxidant genes SOD1 and CAT. Therefore, in unstimulated GCs, the activity of these enzymes will change differently with different concentrations of NAC, resulting in this biphasic effect of NAC.

GCs are important functional cells of endocrine steroid hormones in female animals. The main steroid hormones synthesized and secreted by GCs are P₄ and E₂, which are essential for the normal circadian rhythm and pregnancy process of female animals. Steroid hormones in the ovary are mainly produced by GCs and TCs(Richards 1994). GCs are an important part of the synthesis of P₄, while E₂ is synthesized by TCs and GCs(Li, et al. 2018). During follicular development, TCs secrete AR. When AR diffuses to the GCs layer, AR is aromatized to E₂ by the CYP19A1 gene encoding estrogen synthase. Studies have shown that estrogen can promote the proliferation of GCs and inhibit the apoptosis of GCs(An, et al. 2021). Estrogen production can also increase the activity of goat follicular GCs(Yao, et al. 2018). In this study, the steroid hormone secretion level of sheep GCs cultured for 48 h was determined. It was found that the P₄ and E₂ secreted by GCs in the 100 µmol/L NAC group were significantly higher than those in the blank control group. At the gene expression level, 100µmol/L NAC significantly increased the expression of P₄ and E₂ synthesis-related genes 3β-HSD and CYP19A1, and its hormone secretion level was consistent with cell proliferation results. It is suggested that NAC can promote the secretion of P₄ and E₂ by sheep GCs cultured in vitro by enhancing the expression of 3β-HSD and CYP19A1.

During follicular development, more than 99% of follicles undergo atresia and degeneration, and less than 1% of follicles can develop to maturity(Aguiar, et al. 2020). The essence of follicular atresia is apoptosis. Follicular atresia has two forms : oocyte apoptosis and follicular GCs apoptosis. Fetal follicular atresia is mainly caused by oocyte apoptosis, and adult follicular atresia is mainly caused by GCs apoptosis(Matikainen, et al. 2001). Follicular atresia caused by GCs apoptosis in adulthood is characterized by DNA cleavage, cell atrophy and the formation of apoptotic bodies(Boone and Tsang 1997). Apoptosis is a process that activates apoptotic genes and ultimately induces apoptosis through the co-regulation of pro-apoptotic genes and anti-apoptotic genes in cells(Krysko, et al. 2008). The Bcl2 family plays an important role in animal follicular atresia and GCs apoptosis, including anti-apoptotic gene Bcl-2 and pro-apoptotic gene Bax(Fuko, et al. 2012). Studies have shown that when the Bcl-2/Bax ratio increases, it can inhibit apoptosis, while reducing the Bcl-2/Bax ratio can promote apoptosis (Kiraz, et al. 2016). The greater the proportion of Bcl2/Bax gene in rat ovarian GCs apoptosis, the greater the possibility of cell survival(Ma, et al. 2020). It has been found that Bcl2/Bax gene plays an important role in the development and apoptosis of rat oocytes at different developmental stages(Ratts, et al. 1995). In this experiment, NAC increased the expression of anti-apoptotic gene Bcl-2 and decreased the expression of pro-apoptotic gene Bax in GCs cultured in vitro. Bcl2/Bax ratio increased significantly. At the same time, the expression levels of Bcl-2 and Bax protein were measured, and the results were consistent with the gene level, suggesting that NAC could inhibit the apoptosis of GCs.

The PI3K / AKT signaling pathway is involved in regulating the growth and apoptosis of GCs during follicular development(Devi, et al. 2011). In this study, it was proved that NAC had a positive effect on the growth of sheep GCs through the PI3K/AKT signaling pathway. The use of PI3K / AKT specific inhibitor LY294002 can inhibit the promotion of NAC on GCs proliferation and steroid hormone secretion. In addition, PI3K/AKT specific inhibitor LY294002 inhibited the phosphorylation of PI3K and AKT protein after NAC treatment. These results suggest that the PI3K/AKT signaling pathway plays a major role in NAC-mediated proliferation and steroid hormone secretion.

Data availability statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

CRediT authorship contribution statement

Jine Wang: designed the study, performed the experiments, and, Writing e original draft, the manuscript. Junyuan Ma: performed the experiments and, Writing e original draft, the manuscript. Yang Li: helped in performing the experiments and, Formal analysis, the, Data curation. Yahua Yang: performed the experiments and, Writing e original draft, the manuscript. Chongfa Yang: helped in performing the experiments and, Formal analysis, the, Data curation. Songming Hu: Writing e review & editing, the manuscript and, Formal analysis, the, Data curation. Shengdong Huo: designed the study and helped in, Writing e original draft, the manuscript. Yanmei Yang: designed the study and helped in, Writing e original draft, the manuscript. Yingpai Zhaxi: designed the study and helped in, Writing e original draft, the manuscript. Wenxue Luo: helped with the collection of test samples.

Declaration of competing interest

None of the authors have any conflict of interest to declare.

Acknowledgments

This study was supported by the Fundamental Research Funds for the Central Universities (31920230026), Lanzhou Science and Technology Bureau (No.2022-2-44).

Author Contribution

W.J.E: designed the study, performed the experiments, and, Writing e original draft, the manuscript. M.J.Y: performed the experiments and, Writing e original draft, the manuscript. L.Y: helped in performing the experiments and, Formal analysis, the, Data curation. Y.Y.H: performed the experiments and, Writing e original draft, the manuscript. Y.C.F: helped in performing the experiments and, Formal analysis, the, Data curation. H.S.M: Writing e review & editing, the manuscript and, Formal analysis, the, Data curation. H.S.D: designed the study and helped in, Writing e original draft, the manuscript. Y.Y.M: designed the study and helped in, Writing e original draft, the manuscript. Z.X.Y.P: designed the study and helped in, Writing e original draft, the manuscript. L.W.X: helped with the collection of test samples.

Aguiar, FLN, GDA Gastal, KA Alves, BG Alves, JR Figueiredo, and EL Gastal 2020 Supportive techniques to investigate in vitro culture and cryopreservation efficiencies of equine ovarian tissue: A review. Theriogenology 156 296-309.
Alam, K, S Ghousunnissa, S Nair, VL Valluri, and S Mukhopadhyay 2010 Glutathione-redox balance regulates c-rel-driven IL-12 production in macrophages: possible implications in antituberculosis immunotherapy. J Immunol 184 2918-2929.
An, X, H Ma, Y Liu, F Li, Y Song, G Li, Y Bai, and B Cao 2021 Effects of miR-101-3p on goat granulosa cells in vitro and ovarian development in vivo via STC1. Journal of Animal Science and Biotechnology 12 549-568.
Anja, B, and V Jens 2013 Increasing cell plating density mimics an early post-LH stage in cultured bovine granulosa cells. Cell and tissue research 354 869-880.
Boone, DL, and BK Tsang 1997 Identification and localization of deoxyribonuclease I in the rat ovary. Biology of reproduction 57 813-821.
Canugovi, C, S Maynard, AC Bayne, P Sykora, J Tian, NC de Souza-Pinto, DL Croteau, and VA Bohr 2010 The mitochondrial transcription factor A functions in mitochondrial base excision repair. DNA Repair (Amst) 9 1080-1089.
Devi, YS, AM Seibold, A Shehu, E Maizels, J Halperin, J Le, N Binart, L Bao, and G Gibori 2011 Inhibition of MAPK by prolactin signaling through the short form of its receptor in the ovary and decidua: involvement of a novel phosphatase. The Journal of biological chemistry 286 7609-7618.
Fuko, M, I Naoko, M Noboru, and O Satoshi 2012 Follicular Growth and Atresia in Mammalian Ovaries: Regulation by Survival and Death of Granulosa Cells. Journal of Reproduction and Development 58 44-50.
Giovanni, C, DC Mariabeatrice, MR Mario, GM Cristina, B Fausta, T Diana, NP Vittoria, and F Rubens 2015 Oocyte maturation: gamete-somatic cells interactions, meiotic resumption, cytoskeletal dynamics and cytoplasmic reorganization. Hum Reprod Update 21 427-454.
Guo, M, P Yan, G Han, ZHU Ming, J Shan, X Kun, and X Lixin 2021 Protective effect of N-acetylcysteine on PM2.5-induced injury of bronchial epithelial cells in vitro. Academic Journal of Chinese PLA Medical School 42 99-103.
Guo, X, J Zhang, Y Li, D Chunxiao, T Jianhui, L Junjie, and ZX Weng Shiqiao 2020 Effects of N-acetylcysteine on porcine ovarian granulosa cell culture in vitro. Heilongjiang Animal Science and Veterinary Medicine 59-62.
Harvey, BH, C Joubert, JL du Preez, and M Berk 2008 Effect of chronic N-acetyl cysteine administration on oxidative status in the presence and absence of induced oxidative stress in rat striatum. Neurochem Res 33 508-517.
Havelock, JC, WE Rainey, and BR Carr 2004 Ovarian granulosa cell lines. Molecular and cellular endocrinology 228 67-78.
Jolly, PD, DJ Tisdall, DA Heath, L S, and MK P 1994 Apoptosis in bovine granulosa cells in relation to steroid synthesis, cyclic adenosine 3',5'-monophosphate response to follicle-stimulating hormone and luteinizing hormone, and follicular atresia. Biology of reproduction 51 934–944.
Juan, D, R Xiangyan, J Fengyu, L Yanglu, C Jiaojiao, G Muqing, and MA Otto 2021 Abnormalities of early folliculogenesis and serum anti-Müllerian hormone in chinese patients with polycystic ovary syndrome. Journal of Ovarian Research 14.
Kang, KS, S Shin, and SI Lee 2020 N-acetylcysteine modulates cyclophosphamide-induced immunosuppression, liver injury, and oxidative stress in miniature pigs. J Anim Sci Technol 62 348-355.
Kawamoto, Y, Y-i Nakajima, and E Kuranaga 2016 Apoptosis in Cellular Society: Communication between Apoptotic Cells and Their Neighbors. International Journal of Molecular Sciences 17 2144-2158.
Ketty, S, T Ari, B-D Shifra, N Nava, G Dalia, and D Nava 2011 Reactive oxygen species are indispensable in ovulation. Proceedings of the National Academy of Sciences of the United States of America 108 1462-1467.
Kiraz, Y, A Adan, M Kartal Yandim, and Y Baran 2016 Major apoptotic mechanisms and genes involved in apoptosis. Tumour Biol 37 8471-8486.
Kleinveld, HA, PN Demacker, and AF Stalenhoef 1992 Failure of N-acetylcysteine to reduce low-density lipoprotein oxidizability in healthy subjects. Eur J Clin Pharmacol 43 639-642.
Krysko, DV, A Diez-Fraile, G Criel, AA Svistunov, P Vandenabeele, and K D'Herde 2008 Life and death of female gametes during oogenesis and folliculogenesis. Apoptosis 13 1065-1087.
Li, X, J Lin, Y Chen, L Wang, B Han, B Jia, Y Wu, and J Huang 2022 FSH promotes the proliferation of sheep granulosa cells by inhibiting the expression of TSP1. Anim Biotechnol 33 260-272.
Li, Y, H Wang, D Zhou, S Ting, Z Haibo, and C Biliang 2018 Up-Regulation of Long Noncoding RNA SRA Promotes Cell Growth, Inhibits Cell Apoptosis, and Induces Secretion of Estradiol and Progesterone in Ovarian Granular Cells of Mice. Medical science monitor : international medical journal of experimental and clinical research 24 2384-2390.
Long, M 2014 A Study of Effects of N-acetylcysteine on Grpwth and Intestinal Porcine Epithelial Cells and the Related Mechanisms. Wuhan Polytechnic University.
Luo, J, Z Ao, Z Duan, Y Ao, S Wei, W Chen, and X Chen 2021 Effects of N-Acetylcysteine on the reproductive performance, oxidative stress and RNA sequencing of Nubian goats. Vet Med Sci 7 156-163.
Ma, J, J Wang, S Hu, Y Li, Y Zhang, Y Yang, C Yang, S Huo, Y Yang, Y Zhaxi, and W Luo 2023 Effects of melatonin on development and hormone secretion of sheep theca cells in vitro. Theriogenology 198 172-182.
Ma, X, M Yu, C Hao, and W Yang 2020 Shikonin induces tumor apoptosis in glioma cells via endoplasmic reticulum stress, and Bax/Bak mediated mitochondrial outer membrane permeability. J Ethnopharmacol 263 113059.
Manabe, N, Y Goto, F Matsuda-Minehata, N Inoue, A Maeda, K Sakamaki, and T Miyano 2004 Regulation mechanism of selective atresia in porcine follicles: regulation of granulosa cell apoptosis during atresia. J Reprod Dev 50 493-514.
Matikainen, T, GI Perez, TS Zheng, KT R, RB R, FR A, and TJ L 2001 Caspase-3 gene knockout defines cell lineage specificity for programmed cell death signaling in the ovary. Endocrinology 142 2468-2480.
Matsuno, Y, A Onuma, YA Fujioka, K YASUHARA, W FUJII, K NAITO, and K SUGIURA 2017 Effects of exosome-like vesicles on cumulus expansion in pigs in vitro. Journal of Reproduction and Development 63 51-58.
McRae, RS, HM Johnston, M Mihm, and OSP J 2005 Changes in mouse granulosa cell gene expression during early luteinization. Endocrinology 146 309–317.
Mokhtari, V, P Afsharian, M Shahhoseini, SM Kalantar, and A Moini 2017 A Review on Various Uses of N-Acetyl Cysteine. Cell J 19 11-17.
Mukherjee, TK, AK Mishra, S Mukhopadhyay, and JR Hoidal 2007 High concentration of antioxidants N-acetylcysteine and mitoquinone-Q induces intercellular adhesion molecule 1 and oxidative stress by increasing intracellular glutathione. J Immunol 178 1835-1844.
Murdoch, WJ 1995 Programmed cell death in preovulatory ovine follicles. Biology of reproduction 53 8-12.
Prasad, S, M Tiwari, AN Pandey, TG Shrivastav, and SK Chaube 2016 Impact of stress on oocyte quality and reproductive outcome. Journal of biomedical science 23 36-40.
Ratts, VS, JA Flaws, R Kolp, CM Sorenson, and JL Tilly 1995 Ablation of bcl-2 gene expression decreases the numbers of oocytes and primordial follicles established in the post-natal female mouse gonad. Endocrinology 136 3665-3668.
Richards, JS 1994 Hormonal control of gene expression in the ovary. Endocrine reviews 15 725-751.
Sprong, RC, AM Winkelhuyzen-Janssen, CJ Aarsman, JF van Oirschot, T van der Bruggen, and BS van Asbeck 1998 Low-dose N-acetylcysteine protects rats against endotoxin-mediated oxidative stress, but high-dose increases mortality. Am J Respir Crit Care Med 157 1283-1293.
Tripathi, A, TG Shrivastav, and SK Chaube 2013 An increase of granulosa cell apoptosis mediates aqueous neem (Azadirachta indica) leaf extract-induced oocyte apoptosis in rat. Int J Appl Basic Med Res 3 27-36.
Uraz, S, G Tahan, H Aytekin, and V Tahan 2013 N-acetylcysteine expresses powerful anti-inflammatory and antioxidant activities resulting in complete improvement of acetic acid-induced colitis in rats. Scand J Clin Lab Invest 73 61-66.
Wang, CL, Y Fan, and H Chun 2014 Salmonella Enteritidis Infection Slows Steroidogenesis and Impedes Cell Growth in Hen Granulosa Cells. Avian Dis 58 511-517.
Wang, W, J Lv, H Duan, Z Ding, J Zeng, C Lv, J Hu, Y Zhang, and X Zhao 2022 Regulatory role of melatonin on epidermal growth factor receptor, Type I collagen α1 chain, and caveolin 1 in granulosa cells of sheep antral follicles. Anim Sci J 93 e13760.
Whitaker, BD, and JW Knight 2010 Effects of N-acetyl-cysteine and N-acetyl-cysteine-amide supplementation on in vitro matured porcine oocytes. Reprod Domest Anim 45 755-759.
Yamei, H, D Honghui, J Zhongliang, L Qingwang, S Meihong, C Huali, and H Zengsheng 2016 Effects of melatonin on follicular atresia and granulosa cell apoptosis in the porcine. Molecular reproduction and development 83 692-700.
Yang, Zg, W Zhang, Y Hou, D Binying, W Lei, L Yulan, and Z Huiling 2012 Effects of N-acetylcysteine on Immunological Stress and Energy Status of Piglets Chronically Challenged with Lipopolysaccharide. Acta Veterinaria et Zootechnica Sinica 43 564-571.
Yao, X, MA EI-Samahy, L Fan, L Zheng, Y Jin, J pang, G Zhang, Z Liu, and F Wang 2018 In vitro influence of selenium on the proliferation of and steroidogenesis in goat luteinized granulosa cells. Theriogenology 114 70-80.
Zhou, J, X Peng, and S Mei 2019 Autophagy in Ovarian Follicular Development and Atresia. Int J Biol Sci 15 726-737.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Molecular mechanism of N-acetylcysteine regulating proliferation and hormone secretion of granulosa cells in sheep

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials and methods

2.1 Reagents and culture medium

2.2 Isolation and culture of GCs

2.3 Immunofluorescence staining

2.4 GCs treatment

2.5 Reactive oxygen staining

2.6 CCK-8 method

2.7 Hormone determination

2.8 RNA isolation, reverse transcription, and quantitative RT-PCR

2.9 Western blot analyses

2.10 Statistical analysis

3. Results

3.1 Isolation and culture of GCs

3.2 GCs identification

3.3 NAC promotes GCs proliferation

3.4 NAC inhibits GCs apoptosis

3.5 NAC enhances the antioxidant capacity of GCs

3.6 NAC promotes GCs secretion of P₄ and E₂ through 3β-HSD and CYP19A1

3.7 NAC regulates GCs proliferation and hormone secretion through PI3K/AKT signaling pathway.

4. Discussion

Declarations

References

Additional Declarations

Status:

Version 1

Molecular mechanism of N-acetylcysteine regulating proliferation and hormone secretion of granulosa cells in sheep

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials and methods

2.1 Reagents and culture medium

2.2 Isolation and culture of GCs

2.3 Immunofluorescence staining

2.4 GCs treatment

2.5 Reactive oxygen staining

2.6 CCK-8 method

2.7 Hormone determination

2.8 RNA isolation, reverse transcription, and quantitative RT-PCR

2.9 Western blot analyses

2.10 Statistical analysis

3. Results

3.1 Isolation and culture of GCs

3.2 GCs identification

3.3 NAC promotes GCs proliferation

3.4 NAC inhibits GCs apoptosis

3.5 NAC enhances the antioxidant capacity of GCs

3.6 NAC promotes GCs secretion of P4 and E2 through 3β-HSD and CYP19A1

3.7 NAC regulates GCs proliferation and hormone secretion through PI3K/AKT signaling pathway.

4. Discussion

Declarations

References

Additional Declarations

Status:

Version 1

3.6 NAC promotes GCs secretion of P₄ and E₂ through 3β-HSD and CYP19A1