Animals: Adult, male, 5xFAD transgenic mice harboring the five familial Alzheimer’s disease linked mutations (APP KM670/671NL (Swedish), APP I716V (Florida), APP V717I (London), PSEN1 M146L (A > C), PSEN1 L286V) were used in this study (Oakley et al., 2006). Original breeders were obtained from Jackson Laboratories and bred in-house on a C57Bl/6J background. For this study cohorts of young (1.5 months old) 5xFAD mice and aged-matched wild type C57Bl/6J littermates were used. The animals were group-housed (3–5 animals/cage) in climate-controlled conditions (30–50% humidity, 21 ± 2°C, 12:12 h light/dark cycle) with ad libitum access to food and water. Animals were habituated to housing conditions for 1 week prior to the beginning of the experimental procedures. All procedures were performed under the approval of Veterinary Directorate of Prefecture of Heraklion (Crete) and carried out in compliance with Greek Government guidelines and the guidelines of FORTH ethics committee and were performed in accordance with approved protocols from the Federation of European Laboratory Animal Science Associations (FELASA) and Use of Laboratory animals [License number: EL91-BIOexp-02), Approval Code: 360667, Approval Date: 29/11/2021 (active for 3 years)].
BNN27 administration
BNN27 was administered using a Matrix-Driven Delivery (MDD) Pellet system as previously described (Bonetto et al., 2017). BNN27 custom made pellets (Innovative Research of America, Sarasota, FL) comprised of a biodegradable matrix were subcutaneously implanted at the lateral side of the neck of 2 months old 5xFAD and wild type mice which allowed a 60-day release of 10 mg/kg/day BNN27 (18 mg in total, average weight of the animals ≈ 30g). Placebo pellets comprised of only the biodegradable matrix were also implanted as controls.
Behavioral testing: After the completion of the 60-day release, the 3.5 months old mice were habituated (1h every day for 1 week) in an enclosed apparatus in the shape of a T placed horizontally, called T-maze [Start alley, Goal arm (x2): 30 cm x 10 cm, wall height: 20 cm, central partition: extended 7 cm into start arm]. The T-maze was used to test hippocampal-dependent working memory retention. Before T-maze testing, mice were acclimated in the same room where the test would take place for 1 hour (the mice were familiarized for 1 week with the experimenter). Mice were taken out of the cage and let freely to walk on the experimenter's loosely folded arms and hands for at least 10 minutes. The animals are started from the base of the T and allowed to choose one of the goal arms (placed in the T-maze facing the wall of the start arm). The rationale of the test is that, if two trials are given in quick succession, on the second trial the rodent tends to choose the arm not visited before, reflecting memory of the first choice. Between two successively trials, the guillotine door blocks the access to the central partition for 30 seconds so as for the mouse to familiarize with the surroundings. This is called ‘spontaneous alternation’. Spontaneous alternation is very sensitive to dysfunction of the hippocampus, but other brain structures are also involved. Ten trials were given for each mouse to test the alternation capability. Each trial should be completed in under 2 minutes, if that is not the case the mouse is removed from the maze and reintroduced to the start arm abutting the central partition (Deacon and Rawlins, 2006). Behavioral tests were conducted between 8:00 am and 12:00 pm. A custom-made interface connected to the computer allowed us to video record each animal.
Tissue processing
After the completion of behavioral testing, the animals (n = 7–9 per group) were sacrificed. For adult neurogenesis analysis, a separate cohort of animals (n = 4 per group) that had not undergone behavioral testing and had been injected with (5-bromo-2′-deoxyuridine) BrdU (100mg/kg) 21 days prior to sacrifice were used. Animals were deeply anesthetized with 5% isoflurane (Iso-Vet, Biovet) in a mixture of 30% O2 and 70% N2O and trans-cardially perfused with 20 mL 0.9% heparinised saline. Brains were immediately extracted and bisected along the midline. One hemibrain was post-fixed for 24 h in 4% paraformaldehyde (Sigma-Aldrich, St. Louis, MO, USA) and serial sagittal 40 µm sections starting at lateral 2.40 ± 0.1 mm, according to Franklin and Paxinos(1997) were cut using a vibratome (Hydrax V50, Zeiss, Germany). The brains for neurogenesis analysis were cut in coronal sections of 40 µm in the dorsoventral axis of hippocampus (from bregma − 1.34 mm to − 3.80). Sections were stored in cryoprotective medium (30% glycerol/30% ethylene glycol in phosphate buffer) at -20°C for subsequent immunohistochemical analysis. The hippocampi were dissected from the other hemibrain, snap frozen in liquid nitrogen and stored at -80°C for subsequent proteomic analysis.
Amyloid beta (Aβ) treatment
Aβ42 peptide was purchased from AnaSpec (San Jose, CA). Aβ42 oligomers and fibrils were prepared according to previously established protocols (Li et al., 2011) For oligomeric Aβ treatment, peptides were diluted in DMEM / F-12 or Neurobasal medium at the indicated concentrations and incubated at 37°C for 24 hours. Then, the solution was centrifuged at 14,000 rpm for 5 minutes and the supernatant was collected as oligomeric Aβ to treat the primary cultures (Li et al., 2011).
NS/PCs cultures
The protocol we followed is described in detail in Efstathopoulos et al. (2015). The hippocampi of postnatal day 7 (P7) C57/BL6 mice were digested for 30 min in accutase solution (Sigma-Aldrich) at 37 oC. After mechanical dissociation, cells were plated at a density of 5 × 104 cells/ mL into uncoated T25 culture flasks in Dulbecco’s Modified Eagle’s Medium/Nutrient Mixture F-12 Ham (Sigma-Aldrich) supplemented with 1% B27 w/o Vitamin A (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA), L-glutamine 2 mM (Gibco, Thermo Fisher Scientific), D-glucose 0.6%, primocin 100 µg/ mL (Invivogen), in the presence of 20 ng/ mL FGF2 (R&D Systems, Minneapolis, MN, USA), 20 ng/ mL EGF (R&D) and heparin (2mg/ mL STEMCELL Technologies) and allowed to form neurospheres. Cells were passaged every 5th day by dissociating neurospheres into single cells with accutase (Sigma-Aldrich).
Hippocampal neuronal cultures
E17.5 primary hippocampal cell culture was performed as previously discussed (Beaudoin 3rd et al., 2012). Brains of C57/BL6 mice fetuses [embryonic day 17.5–18 (E17.5)] were dissected, the meninges, vascular tissue excess were removed under a stereoscope and the hippocampi were isolated. Hippocampi were transferred to a 15 mL tissue culture tube and the volume was adjusted to 5 mL with dissection medium [HBSS (10X) (14185-045, GIBCO), 0.1% D-(+)-Glucose solution (G8769, Sigma), 10mM HEPES Buffer Solution (1X, 15630080 GIBCO), 500 U/ mL Penicillin-Streptomycin (10,000 U/ mL, 15140122, Thermo Fischer Scientific)] supplemented with 2.5% Trypsin 10x. Hippocampi were mechanically dissociated by trituration with a Pasteur pipet (-15 times) followed by trituration (-15 times) with a reduced-bore Pasteur pipet. The cells were pelleted by centrifugation at 1000 x g for 5 min. Cells were taken up in 500µl of Neurobasal medium, passed through a cell strainer and counted in a hemocytometer. Approximately 8 x 104 cells per well were plated on poly-D-lysine coated 24-well plates in DMEM/F-12 medium containing 10% fetal bovine serum (FBS, 10270 Thermo Fischer Scientific, South American Origin), 10 mM HEPES Buffer Solution (1X, 15630080 GIBCO), 500 U/ mL Penicillin-Streptomycin (10,000 U/ mL, 15140122, Thermo Fischer Scientific) and cultured at 37 C in 5% C02/95% air. After 2 hours, the ‘plating’ medium described above was aspirated and cells were incubated in ‘feeding’ medium, thus Neurobasal medium containing B-27 (TM) plus supplement (50X) (A3582801, Thermo Fischer Scientific), GLUTAMAX I, 100X (3505006, Thermo Fischer Scientific), 10 mM HEPES Buffer Solution (1X, 15630080 GIBCO), 500 U/mL Penicillin-Streptomycin (10,000 U/ mL, 15140122, Thermo Fischer Scientific). Medium was changed every 3–4 days.
Glial primary cultures: Cerebral cortices from P2-P4 C57BL/6 mice were dissected and mixed glial cultures were prepared. Pure astrocytic cultures were isolated and cultured as described in Solà et al. (2011). Briefly, at DIV 6–8, Ara-C 10 µM was added to the culture medium for 4 days. Culture medium was then changed to with fresh medium without Ara-C. Cultures were expanded the next day. Medium was replaced every 3 days. Astrocytic cultures were used after the 2nd passage when their purity was > 98%. Pure microglial cultures were prepared and cultured using a mild trypsinization protocol as described in Saura et al. (2003). Briefly, after preparation of the mixed glial cultures, medium was replaced every 5–7 days. At DIV 18–20, culture medium is replaced with fresh. After 48 h, culture medium is collected and kept at 37 0C as conditioned culture medium. Cultures are then washed once with serum-free medium and then incubated with trypsin solution 1:4 in serum-free culture medium for 35–45 min inside the incubator until the astrocytic feeding layer is fully detached. Then, an equal volume of culture medium with serum is added and the medium with the detached cells is removed. The stored conditioned medium is then returned to the cultures. Microglial cells can be used experimentally the next day, when their purity is > 98%. Microglia condition media (MCM) treatments in astrocytes were achieved by performing an initial 24 h-long treatment in microglia cultures. LPS was used at a concentration of 100 ng/mL, Aβ42 oligomers were used at a concentration of 10µM and BNN27 at a concentration of 10− 7 M. After 24 h, MCM was collected and transferred into naïve astrocytic cultures for 24 h.
Neural Stem (NS)/Precursors (PCs) proliferation and survival assay, receptor inhibition
For the proliferation assay, at the end of the treatments of the primary hippocampal Neural Stem Cell (NSC) cultures, 10 mM BrdU was applied for 4 hours to label all actively proliferating cells before they were fixed and stained against BrdU. Furthermore, for the inhibition observation experiments, cells were exposed for 24 h to 100 ng/ mL human BDNF (100 µg/ mL, B-250, Alomone) or 100 ng/ mL mouse NGF 2.5S (> 95%) (100µg/ mL, N-100, Alomone) or 100nM BNN27 dissolved in DMSO (A3672, APPLICHEM) in the presence or absence of 50 nM of panTrk inhibitor (50 µM AZD-1332, A-495, Alomone) or p75NTR inhibitor [Anti-p75 NGF Receptor antibody MC-192, ab6172, Abcam]. Conclusively, for the cell death or cytotoxicity detection and quantification of both NSC and neuronal cultures, cells were fixed and stained with in situ cell death detection labeling kit (terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL, 11684795910, Roche, Basel, Switzerland) and Celltox Green Cytotoxicity Assay (G8742, Promega), respectively, according to the manufacturer's instructions.
Immunofluorescence: Free-floating sections or neural stem/precursor cells (NS/PCs), hippocampal neuronal cultures (attached in Poly-D-Lysine 0.1 mg/ mL w/ or w/o Laminin 10 mg/ mL were fixed with 4% paraformaldehyde solution for 10–15 min, washed with PBS (1X), PBSTx (Triton X-100, 0.1% in PBS) and blocked in 10% Normal Serum (specific to the species the 2ary Ab(s) is/are raised), 0.1% BSA in 0.3% Triton X-100 in PBS (PBSTx) for 1 h at room temperature before they were incubated with primary antibodies in blocking solution overnight at 4 oC. The day after sections or cells were washed twice with PBS and incubated with Alexa Fluor chromophore-conjugated secondary antibody (1:1000, Invitrogen) in 0.1% PBSTx for 1 h at room temperature. Finally, sections or cultured primary cells were washed twice again with PBS and incubated with HOESCHT, washed again thrice with PBS and mounted onto slides using VECTASHIELD® Vibrance™ Antifade Mounting Medium (VECTOR). For detection of BrdU-labeled nuclei, specimens have been previously incubated in 2N HCl at 37 oC for 30 min, followed by a 10 min rinse in 0.1 M sodium tetraborate pH 8.5 and two rinses with PBS before blocking step. Maximum intensity projection images of confocal z-stacks were obtained with Leica SP8 confocal microscope.
qRT-PCR: Total RNA from postnatal day 7 hippocampal NSCs was extracted using Nucleospin RNA (#740955.50, Macherey Nagel) according to the manufacturer’s instructions and stored at − 20°C. RNA concentration and quality were determined using a Bioanalyzer (Agilent). PCR products were resolved on a 1.2% agarose gel. To generate cDNA, ≤ 5 µg of total RNA was used, utilizing the PrimeScript 1st strand cDNA synthesis kit (#61110A, TAKARA Clontech Cellartis). GAPDH was used as a normalization control. RT-PCR was performed for 40 cycles for all markers as follows: Holding Stage for 3 min at 95°C, Cycling Stage for 3 s at 95°C and 60°C for 30 s, Melt Curve Stage for 15 s at 95°C and 60°C for 1min and finally extending at 95°C for 15 s. Data collected from qRT-PCR were corrected for differences in RNA input using the reference gene GAPDH. All of the primers that were used had 90–105% efficiency. Primer sequences: mGAPDH (forward, 5' ATTGTCAGCAATGCATCCTG 3'; reverse, 5' ATGGACTGTGGTCATGAGCC 3'), mTrkA (forward, 5' AGAGTGGCCTCCGCTTTGT 3'; reverse, 5' CGCATTGGAGGACAGATTCA 3'), mTrkB (forward, 5' TGGACCACGCCAACTGACATT 3'; reverse, 5' GAATGTCTCGCCAACTTGAG 3'), mhTrkC (forward, 5' TGCAGTCCATCAACACTCACCAGA 3'; reverse, 5' TGTAGTGGGTGGGCTTGTTGAAGA 3'), mp75NTR (forward, 5' GACTAACCTAGGCCACCCAA 3'; reverse, 5'CAGACGTCGTTTCCAGATGT 3').
Total RNA from astrocytic cultures was extracted using TRIzol Reagent (Invitrogen) and cDNA synthesis was performed using the High-capacity cDNA Reverse Transcription kit (Thermo Scientific, 4368814). Quantitative RT-PCR was run using 1µl of cDNA and KAPA SYBR FAST (Roche, KK4601) following the instructions of the supplier and a cycling program of 20s at 950C followed by 40 cycles of 950C for 3s and 600C for 30s. After that, a melting curve of the amplified products was performed. Data collected from qRT-PCR were corrected for differences in RNA input using the reference gene Actin. All of the primers that were used had 90–105% efficiency. Primer sequences:
mActin (forward, GGAGATTACTGCTCTGGCTC; reverse, GGACTCATCGTACTCCTGCT), mGfap (forward, AGAAAGGTTGAATCGCTGGA; reverse, CGGCGATAGTCGTTAGCTTC), mSteap4 (forward, CCCGAATCGTGTCTTTCCTA; reverse, GGCCTGAGTAATGGTTGCAT), mSerpina3n (forward, CCTGGAGGATGTCCTTTCAA; reverse, TTATCAGGAAAGGCCGATTG), mAmigo2 (forward, GAGGCGACCATAATGTCGTT; reverse, GCATCCAACAGTCCGATTCT), mSrgn (forward, GCAAGGTTATCCTGCTCGGA; reverse, TGGGAGGGCCGATGTTATTG), mSerping1 (forward, ACAGCCCCCTCTGAATTCTT; reverse, GGATGCTCTCCAAGTTGCTC).
Western blot: Cells were harvested in PIERCE IP Lysis Buffer (87788, Thermo Fischer Scientific) and supplemented with protease (539131, Millipore) and phosphatase (524629, Millipore) inhibitors, after they were washed twice with PBS (1X) and stored in − 20°C. The protein concentration was estimated by the bicinchoninic acid method (BCA, 23227, Pierce) and 15 µg of total protein was loaded and run-on sodium dodecyl sulfate–PAGE (15-well, 8% Bis-Tris gel) at 120 V for 90 min, then transferred to a nitrocellulose membrane (0.45 µm, Amersham) at 300 mA for 180 min. The proteins were then transferred to a nitrocellulose membrane and blocked in a solution of 5% BSA and 0.1% Tween-20 in TBS (TBS-T) for 1 h followed by incubation with the primary antibody in blocking solution overnight at 4 oC. The next day, the membranes were washed three times in TBS-T and was subsequently incubated with the appropriate horseradish peroxidase-conjugated secondary antibody (1:5000, Millipore and Invitrogen) in blocking solution for 1 h. Finally, the membranes were washed again in TBS-T and incubated for detection with enhanced chemiluminescence substrate (34580, Pierce) and the immunoreactive bands were visualized by scanning with a Bio-Rad image analysis system. Then, relative protein expression was normalized to the control conditions in each experiment. Mean values were estimated from three different cultures.
Antibodies and reagents: The samples were incubated in the primary antibody diluted in phosphate buffer (PBS) with Triton X-100 0.1%. For immunohistochemistry and immunocytochemistry, the antibodies used were mouse anti- Aβ (6E10 clone, Covance, 1:500); rabbit anti-Doublecortin antibody (DCX, Abcam, 1:200); mouse anti-NeuN clone A60 (Sigma-Aldrich, 1:100); mouse anti- BrdU (MoBU-1. Clone, Thermo Fischer Scientific, 1:200); chicken anti-Glial Fibrillary Acidic protein (GFAP, Millipore, 1:1000); Synapsin I (1:200, Novus Biologicals); Synaptophysin (Sigma-Aldrich, 1:200); rabbit anti-Iba1 (Wako Chemicals, 1:500); rabbit anti-TrkA (Millipore, 1:500); rabbit anti-p75 (Promega, 1:500); mouse anti-Choline Acetyltransferase (CL3173) (ChAT, Novus Biologicals, 1:2000); rat Anti-Myelin Basic Protein antibody (MBP, clone 12, Millipore, 1:200; chicken anti-Nestin (Novus Biologicals, 1:1000); mouse anti –beta-tubulin III antibody (clone Tuj1, Biolegend, 1:1000); rabbit anti-cleaved caspase 3 (Cell Signalling, 1:300); rabbit anti-TrkB (Abcam 1:500); rabbit anti-TrkC (Cell Signaling 1:500). The secondary antibodies were all AlexaFluor labeled (Thermo Fischer Scientific) diluted 1:500. The nuclei were labelled with Hoechst (33342, Thermo Fischer Scientific, 1:10000). Samples were mounted in VECTASHIELD Antifade Mounting Medium (H-100-10, Vector laboratories). Cell culture images were acquired with a Leica DMLB equipped with a DC300 F camera (Leica Microsystems CMS, Mannheim, Germany). Tissue was imaged with a Leica SP8 Confocal Laser Microscope (Leica Microsystems CMS, Mannheim, Germany).
Proteomic analysis
Sample preparation: Samples were prepared in randomized order and handled all together (n = 25 male mice were used in this experiment, including WT mice treated with placebo (n = 7), 5xFAD mice treated with placebo (n = 8), and 5xFAD mice treated with BNN27 (n = 10)) to avoid batch effects. Individual hippocampi were homogenized in 1 mL 5 mM HEPES/NaOH pH 7.4, 0.32 M Sucrose and Protease Inhibitor cocktail (Roche), using a tissue homogenizer in 900 rpm, 12 strokes (Schuett biotec.de homgenplus). The extract was centrifuged at 1000 x g for 10 min, 4oC. Supernatants were transferred to new tubes, and centrifuged at 25000 x g for 40 min, 4oC. The pellet, P2 fraction, was resuspended in Hepes buffer. Protein concentration was determined by Bradford assay (Bio-rad, Eppendorf BioPhotometer). 25 µg of each sample were mixed with SDS loading buffer, boiled at 98oC for six min, and ran in the SurePAGE Bis-Tris gels (GenScript) for approximately 10 min at 120 V. The gels were fixed in 50% (v/v) ethanol and 3% (v/v) phosphoric acid and stained with Colloidal Coomassie Blue ((34% (v/v) methanol, 3% (v/v) phosphoric acid, 15% (w/v) ammonium Sulphate, and 0.1% (w/v) Coomassie brilliant blue G-250 (Thermo Scientific)) for 30 sec, while shaking. The gels were washed in water.
The in gel-digestion protocol was performed as previously described (van der Spek et al., 2020; Li, K.W et al., 2012). In brief, each gel lane was sliced and cut into blocks of approximately 1 mm3 and collected in a 96-well filter plate (MultiScreenHTS HV Filter Plate, 0.45 µm, clear, non-sterile, Millipore; Eppendorf White Deepwell plate 96/500, Eppendorf). Gel fragments were destained in 50 mM NH4HCO3 and 50% (v/v) acetonitrile, dehydrated using 100% acetonitrile, and rehydrated in 50 mM NH4HCO3 containing 10 µg/mL trypsin (sequence grade; Promega). After incubation overnight at 37°C, peptides were extracted twice from the gel pieces with a solution containing 0.1% (v/v) trifluoroacetic acid and 50% (v/v) acetonitrile for 30 min. The solutions were collected in new tubes, dried using a SpeedVac (Eppendorf), and stored at − 20°C until LC-MS analysis.
Peptides were dissolved in 0.1% acetic acid and were analyzed by micro LC MS/MS using an Ultimate 3000 LC system (Dionex, Thermo Scientific) coupled to the TripleTOF 5600 mass spectrometer (Sciex). Peptides were trapped on a 5 mm Pepmap 100 C18 column (300 µm i.d., 5 µm particle size, Dionex) and fractionated on a 200 mm Alltima C18 column (300 µm i.d., 3 µm particle size). The concentration of acetonitrile in 0.1 M formic acid was increased from 5 to 18% at 88 min, to 25% at 98 min, to 40% at 108 min and to 90% at 110 min. The flow rate was 5 µL/min. Peptides were electro-sprayed into the TripleTOF 5600 mass spectrometer (Sciex), with a micro-spray needle voltage of 5500 V and analyzed by data independent acquisition (SWATH). Each SWATH cycle consisted of a parent ion scan of 150 msec followed by 8 Da SWATH windows, with scan time of 80 msec, through 450–770 m/z mass range. The collision energy for each window was calculated for a 2 + ion appropriate collision energy, centered upon the window with 15 eV spread, as was previously described (Koopmans et al., 2018).
Data analysis and Statistical analysis for proteomics: Proteomics data analysis of the raw files was performed using Spectronaut 14 software (Biognosys). An internal spectral library was created by directDIA analysis on all the samples against the mouse databases (UP000000589_10090.fasta and UP000000589_10090_additional. fasta). The Mass Spectrometry Downstream Analysis Pipeline (MS-DAP) (version beta 0.2.5.1) (https://github.com/ftwkoopmans/msdap) (Koopmans, F. et al., 2022,) was used for quality control and candidate discovery. Differential abundance analysis between groups was performed on log transformed protein abundances. Empirical Bayes moderated t-statistics with multiple testing correction by False Discovery Rate (FDR), as implemented by the eBayes functions from the limma R package, was used as was previously described (Koopmans et al., 2018). Gene Ontology, Molecular Function and Biological process enrichment tests were performed using g:Profiler. The mass spectrometry proteomics data were deposited to the ProteomeXchange Consortium via the PRIDE (Perez-Riverol, Y. et al., 2022) partner repository with the dataset identifier PXD044699.
Cell counts and quantification
For in vitro experiments, the number of BrdU (+) or TUNEL (+) or Cleaved Caspase-3 (+) cells in each culture was counted using an objective (× 32) under an inverted fluorescent microscope (Leica DMLB equipped with a DC300 F camera, Leica Microsystems CMS, Mannheim, Germany) from 4–6 visual fields for every condition. The number of BrdU (+) or TUNEL (+) or Cleaved Caspase-3 (+) cells was then counted using the unbiased cell counter offered by ImageJ (Fiji). The average number of BrdU (+) or TUNEL (+) or Cleaved Caspase-3 (+) cells to the total cell number of Hoechst (+) - stained cells was estimated for each individual photo. Finally, the percentage of BrdU (+)/Nestin (+) or TUNEL (+)/ Tuj1 (+) or Cleaved Caspase-3 (+)/Tuj1 (+) cells was normalized to the control condition. Mean was estimated for each condition from three independent experiments. Percentage of total area was calculated by ImageJ analysis.
For in vivo co-localization experiments, confocal analysis under ×40 oil lenses was conducted. The percentage of double-labeled cells for each marker was estimated by counting the cells in the DG of 6 photos of 4 mice of each subgroup. Based on a modified unbiased stereology protocol, one out of every six adjacent sections were chosen and processed for BrdU and DCX immunohistochemistry. To measure the total volume of DG, the area of granular cell layer was outlined and computed using images in every 6th adjacent section for a total of 10 sections in photos taken by a confocal fluorescence microscope (Leica SP2 confocal microscope).
Data analysis
For behavioral experiments, data were analyzed using two-way analysis of variance (ANOVA) followed by Bonferronis’s post hoc test when appropriate. The difference in Aβ plaque load between study groups was determined by employing Student’s t-test. For further immunohistochemistry, immunocytochemistry and biochemical data, statistical significance was assessed by paired t-test, one or two- way ANOVA analysis of variance followed by Sidak’s or Bonferroni’s multiple comparisons test. Statistical analysis was performed using GraphPad Prism 8.0 (GraphPad Software Inc., LaJolla, CA, USA). Sample size required in each case was estimated based on the number of groups and the expected effect size with G*power statistics software (Düsseldorf, Germany). For all comparisons, P < 0.05 was considered as statistical significance level.