A simple and efficient Agrobacterium tumefaciens mediated transgenic system for tetraploid potato cultivar Desiree

doi:10.21203/rs.3.rs-3890360/v1

As the fourth staple food crop in the world, potatoes can provide enough energy, protein, and nutrients necessary for humans. However, the population growth and negative effects of climate change call for improved potato yields and resilience. Genetic engineering is a convenient way to improve potato varieties and create new germplasm resources. Agrobacterium tumefaciens mediated transformation is a stable and widely used method for genetic improvement. In this study, a simple and efficient transgenic system was built by testing different potato materials, explants type, selection medium, selection agent, A. tumefaciens EHA105 strain carried different vectors. The results shown this simple system produced positive transformed seedlings in about 40 days. The lower ploidy change ratio for tetraploid variety Desiree compared to diploid recipient. Both SEG and SE could function as a single regeneration medium. Leaf discs explants is eligible. The concentration of 20μg/L is suitable for chlorsulfuron selection. The positive transgenic efficiency of tetraploid recipient Desiree is up to 68.79%, This simple and fast transgenic system provides a powerful tool for supporting basic research on potato functional genes and creating new potato materials for genetic engineering breeding.

Biological sciences/Plant sciences/Plant biotechnology/Molecular engineering in plants

Biological sciences/Biological techniques/Genetic engineering

Biological sciences/Biological techniques/Gene delivery/Transfection/Bacterial transformation

Potato (Solanum tuberosum L.) is an important staple crop for human food security, ranking fourth in the world, after rice, wheat and maize ¹. As the largest non-cereal food worldwide, potato is a perfect food, with the potential to provide humanity’s needs for energy, protein and nutrition. To secure sustainable harvests, the best economic solution is to increase a staple crop’s resilience, yield and quality through breeding. One way is conventional breeding, which utilizes genetic resources from natural variation; another method is transgenic breeding, introducing functional genes to the target genotype, precisely improves the target traits. Compared to traditional breeding, transgenic breeding is much more direct and precise, and time efficient ^2,3. Some successful transgenics approaches in potato have used protoplasts: the target vectors were delivered into the plant cell, after selection the plant cell contains target vectors regenerated into new transgenic plant ⁴. However, the protoplasts are very weak without a cell wall. The process is complex, and the efficiency of positive transgenic events is low. Another method is using propelled particle bombardment gene fragment deliver system, ‘gene gun,’ into the plant ⁵. However, this method produces high numbers of insert events at random sites and the creation of chimeras. The most stable and widely used method is transgenics via Agrobacterium tumefaciens. The first study about successfully genetical modification of potato plants by A. tumefaciens was done in 1983⁶. Many research groups that paid close attention to the improvement of the technology system through many different factors, such as different potato recipients, explants, mediums etc.

There are many successful cases in breeding companies that use Agrobacterium-based transgenics to create new varieties. In 1995 Monsanto released the first biotech potato varieties developed from transformation via A. tumefaciens. The Russet Burbank variety contained crylIIA gene encoding the insect control protein of Bacillus thuringiensis var. tenebrionis, named NewLeaf™ ^7,8. The Monsanto have developed NewLeaf Plus™, a Russet Burbank variety with resistance to both Colorado Potato Beetle (CPB) and Potato Leafroll Virus (PLRV)⁹. J.R. Simplot Company successfully developed lower portion for the formation of acrylamide potatoes with black spot bruise resistance traits, named Innate™ 1.0. Innate™ 2.0 potatoes that have the same 1.0 traits and added late blight resistance and cold storage capability. CIP’s research group increases the classical varieties’ late blight resistance, by stacking three resistant genes via A. tumefaciens. BASF developed Amflora, a high-starch potato which was approved in Europe, Modena, Fortuna (with late blight resistance¹⁰. Russian Academy of Sciences developed Elizaveta Plus and Lugovskoi Plus ¹¹.

Even though there are many successful transgenic systems for potato, but a simple and efficiently protocol will provide strongly support for gene function research, especially for traditional tetraploid receipt Desiree. Several critical factors, such as vector, A. tumefaciens strain, pre-culture period, explant type, culture mediums and selection markers will influence the time-cost and efficient of potato transgenic ¹².

The A. tumefaciens strain and the vitality of the bacteria influence the transient transgenic efficiency. Many different strains have been used to establish successful transgenic systems. According to Vinterhalter et al. (2008), LBA4404 is the most frequent, which has been used for the introduction of binary vectors ¹³. In the last published protocol, EHA105 was applied more frequently^14–16.

For different purposes, different plant expression vectors were used for potato, such as pCAMBIA2301 was used to identify candidate gene’s expression pattern ¹⁷, pBI121 was used to candidate gene function study ^18,19, pK402 for gene editing²⁰. So different vectors should be tested in a stable transgenic system.

The type of explant also influences the transgenic efficiency. For instance, different explants have been used for transformation, such as leaves ^21–26, internodes ^24–32, tubers ^33–35 and petioles ³¹.

NPT-II worked as a selection gene which is present in the bacterial vector’s T-DNA. Kanamycin is the most popular selective agent in published protocols ^{21,27,28,30,33–39}. Herbicide resistance genes, phosphinothricin (bar) ²⁵, glyphosate [N- (phosphonomethyl)glycine] (epsps) ²⁶. The herbicide resistance genes have more merits, which would work as selectable markers and introduced herbicides resistance trait into the transgenic plants as valuable traits.

This study introduced a simple and efficient potato transgenic protocol via A. tumefaciens for cultivar Desiree based on the published protocol and removed some unnecessary process. Different explants from cultivar Desiree were compared, the system also tested with two diploid materials, different type explants, vectors and selective agent. The GUS histochemical assay and PCR method proved that positive transgenic plants from tetraploid Desiree and two diploid materials. The optimization of different factors would develop a simple and efficient potato transgenic system for Desiree.

1.1 Mediums components information

The components of media, used in this research were listed as Table 1.

Table 1

Medium components used in different stages of genetic transformation
Reagents	Brand	Product ID	Mediums
Reagents	Brand	Product ID	LB	YEP	INF	COA	SE	SEG	MS30T	MS30
Yeast Extract	OXOID	LP0021	5g/L	10g/L	-	-	-	-	-	-
Tryptone	OXOID	LP0042	10g/L	-	-	-	-	-	-	-
NaCl	Solarbio	S8210	10g/L	5g/L	-	-	-	-	-	-
Bacteriological Peptone	OXOID	LP0137	-	10g/L	-	-	-	-	-	-
Agar	Sigma-Aldrich	A1296	15g/L	15g/L	9g/L	9g/L	9g/L	9g/L	7g/L	7g/L
Murashige & Skoog Basal Medium with Vitamins	PhytoTech Labs	M519	-	-	4.43g/L	4.43g/L	4.43g/L	4.43g/L	4.43g/L	4.43g/L
Sucrose	SINOPHARM	10021418	-	-	20g/L	20g/L	20g/L	20g/L	30g/L	30g/L
Acetosyringone	Solarbio	A8110	-	-	80mg/L	80mg/L	-	-	-	-
trans-Zeatin-riboside	Solarbio	Z8040	-	-	-	1mg/L	2mg/L	2mg/L	-	-
1-Naphthaleneacetic acid	Sigma-Aldrich	N0640	-	-	-	2mg/L	0.01mg/L	0.02mg/L	-	-
Timentin	Solarbio	T8660	-	-	-	-	200mg/L	200mg/L	100mg/L	-
Kanamycin	Solarbio	K8020	-	-	-	-	50mg/L	100mg/L	100mg/L	-
Gibberellic Acid (GA3)	Solarbio	G8040	-	-	-	-	-	0.02mg/L	-	-
pH (Adjusted by KOH)			7.0	7.0	5.8	5.8	5.8	5.8	5.8	5.8

1.2 Plant materials and growth condition.

The plantlets of a tetraploid variety, Solanum tuberosum L. cv. Desiree, and two diploid lines CIP703541, CIP705079 were maintained in the MS30 medium in the growth incubator LT-CDX1000 (LEAD-TECH Shanghai Scientific Instrument Co., Ltd.). The growth condition is as follow, light period: 16 hours light with intensity about 16000LX, 8 hours dark. The temperature is 21 ℃ with light exposed and 20 ℃ in dark. The LED light spectrum information shown at Supplementary figure S1b. All potato materials (Desiree, CIP703541, CIP705079) used in this study were distributed from Breeding Resources Center in China Center for Asia-Pacific.

1.3 A. tumefaciens strains and vectors

A. tumefaciens strain EHA105 carried vector pCAMBIA2301, pBI121, CBE and PE respectively, were stored in glycerol at -80℃ frozen. All vectors are binary vectors for plant transformation, pCAMBIA2301 and pBI121 containing GUS and NPT-II genes. CBE and PE contain CAS9 and NPT-II gene. The maps of vectors were shown at Supplementary figure S2.

1.4 A. tumefaciens mediated genetic transformation

The A. tumefaciens was revived in a shaker with 28 ℃, 150 rpm for 1 day in YEP lipid medium. About 10 mL overnight of A. tumefaciens was centrifuged at 3500 rpm in a 50 ml tube for 10 min, the supernatant was discarded, and the pellet was re-suspended in about 30 mL volume INF medium containing of 100mg/L Acetosyringone, which made the A. tumefaciens suspension concentration OD₅₅₀ about 0.5. About 30 explants, such as internodes, petioles, or leaf discs were cut from 3–4 weeks-old healthy plants, the internodes did not contain any buds, and leaves samples were sliced into squares. All explants were soaked in an A. tumefaciens suspension for 20 min with gently shaken. The soaked explants were transferred to a COA medium by tweezers. Explants were tiled on the surface of COA medium. Residual bacterial suspension on the surface of explants, was removed through using a pipette and air drying in an ultra-clean bench for 30 minutes. The plates were sealed by parafilm, and cultures were maintained in the dark at 21 ℃ for two days. The explants were then transferred to SE or SEG medium with kanamycin or chlorsulfuron under weak light (Light parameter shown at Supplementary figure S1a). These were left to grow in the incubator, under same growth condition descripted as 1.2 section. The explants were transferred to fresh medium every two weeks to maintain selection pressure. After about four weeks, the shoots regenerated on the callus at the border of the explants. The large shoots, about 2 cm length, were dissected and transferred to MS30T medium for rooting.

1.5 GUS histochemical assay

The leaf samples (about 4 mm²) from seedlings were dipped in GUS staining solution Kit (Biosharp, BL622A). All samples with staining solution were incubated at 37°C overnight. The greed color was faded by 80% acetone multiple times at room temperature, and stored in 75% ethanol ⁴⁰.

1.6 DNA amplification identified the positive transgenic plantlets.

The leaf samples of regeneration seedlings which were produced by transformation of PE and CBE were collected in 2 ml Eppendorf tubes under lipid nitrogen and grind into powder. The genome DNA was extracted by CTAB method fellow Porebski’s protocol with modified⁴¹. The regenerate seedlings’ DNA, positive control sample, two negative control samples (double distilled water and receipt material) were identified by amplification marker gene NPT-II -relative special segment. The reaction program was shown as fellow: denaturation at 94°C for 4 min, followed by 35 cycles of denaturation at 94°C for 30s, annealing at 55°C for 30 s, extension at 72°C for 30 s, a final extension at 72°C for 5 min. The primers’ sequence for PE transgenic seedlings is forward primer MMLV-06F: tgaggagggcctgcagcataactgc, reverse primer 26pR: gcctaatcattctaatcctgggaca; for CBE vector, forward primer 35S: gacgcacaatcccactatcc, reverse primer NPTⅡ-R: gatgtttcgcttggtggtcg.

1.7 Ploidy analysis

The ploidy level of regenerated plants was determined by flow cytometric methods. Crude samples of nuclei were prepared from the leaves of plantlets chopped in 1 ml phosphate-buffered saline (pH7.5) containing 0.5% Triton X-100 with DAPI and filtered by 75 µm filter. The ploidy of cells was examined using a flow cytometer (Sysmex Shanghai Ltd. CyFlow Cube8). The isolated plant nuclear groups had characteristic fluorescence emission peaks. The DNA content of plantlets regenerated by diploid receptors were compared to potato material PL4 ⁴², which worked as diploid control, the lowest peak corresponding to 2C nuclei, and the remaining peaks representing 4C and 8C nuclei, respectively. And the plantlets regenerated from Desiree were compared to their recipient, the lowest peak corresponding to 4C nuclei. Noise signals generated by subcellular debris were eliminated by gating ⁴³.

2.1 Tetraploid material Desiree produced higher transgenic efficiency and lower ploidy change ratio compared to diploid materials.

Table 2

The different transgenic efficiency between potato receipts
Recipients	Vectors	Explants number	Regeneration seedlings number	Regeneration ratio	Positive seedlings number	Positive efficiency
CIP703541	pCAMBIA2301, pBI121	80	53	66.25%	3	3.75%
CIP705079	pCAMBIA2301, pBI121	71	19	26.76%	6	8.45%
Desiree	pCAMBIA2301, pBI121	154	103	66.88%	37	24.03%

For diploid material CIP703541, 80 internodal and petiole sections (about 5 mm length) were inoculated by EHA105 with plant binary expression vector pCAMBIA2301 or pBI121. About half of the explants regenerated shoots, after stained in the GUS staining buffer, three shoots appeared blue. So, the positive transformation efficiency for CIP703541 is 3.75%. For diploid CIP705079, 71 internodal or petiole sections (about 5 mm length) were used for transgenesis, and 19 shoots were regenerated. After the GUS staining assay, 6 shoots acquired blue color, indicating that 6 shoots were positively transformed, with a positive transformation efficiency up to 8.45%. Finally, for the tetraploid cultivar Desiree, 154 internodes (about 5 mm length) were used as explants, producing 103 shoots. GUS staining indicated that 29 shoots turned to blue, so the positive transformation rate is 24.03% (Table 2). The transformation efficiency results shown that tetraploid material Desiree provide higher positive transgenic efficiency. The ploidy of regeneration seedings, including positive and negative transgenic materials, was analyzed by flow cytometric. Among the 91 regenerated plants, 71 were derived from tetraploid material Desiree, and 20 of them were from diploid materials, CIP705079 and CIP703541. For the diploid materials, 9 plants remained diploid after regeneration, giving a ploidy change rate 55% after regeneration by tissue culture, and 45% for unchanged plants. For tetraploid material Desiree, the rate of ploidy stable was 96%, and the ploidy change was 4% (Fig. 1). Thus, the results indicated that the frequency of ploidy change in diploid materials is much higher than tetraploid material during the callus-induction and regeneration process, nearly half of the diploid receipt will change their ploidy. Tetraploid material was much more stable for ploidy after tissue culture.

2.2 SEG or SE regeneration medium provided high positive transgenic efficiency, above 17%.

Table 3

The different transgenic efficiency between selection media
Medium	Explants number	Regeneration seedlings number	Regeneration ratio	Positive seedlings number	Positive efficiency
SE	77	66	85.71%	19	24.68%
SEG	105	45	42.86%	18	17.14%

When SE medium was used as the regeneration medium. Total 77 Desiree explants were infected by A. tumefaciens, 66 shoots were regenerated, and 19 leaf samples of them appeared blue after staining in GUS stain buffer, giving an efficiency of 24.68%. In another protocol with single regeneration SEG medium, 105 explants were infected by A. tumefaciens, 45 shoots were regenerated. After GUS testing, 18 shoots appeared blue giving an efficiency of 17.14%. These preliminary results indicated when SE or SEG medium worked as single generation medium, both had produced a high transformation efficiency, above 17%, which is similar with another similar protocol ⁴⁴. And SE medium made a better performance than SEG medium (Table 3).

2.3 The leaf explants are more suitable than internodal explants in this transgenic system for Desiree

It is easier for leaf discs to regenerate shoots than internodes. Shoots regenerated from leaf discs at 28 days after transfer to SEG medium (Fig. 2a1, 2b1). However, only calli appeared on the internodal sections. After 45 days, nearly 85% leaf discs generated vigorous shoots (Fig. 2a2). At the same time, for the internodes, almost 50% developed calli (Fig. 2b2). After investigating the positive efficiency through GUS protein analysis. These results shown that, for potato Desiree variety, the leaf discs were more suitable explants for transgenesis using SEG medium via A. tumefaciens. There were 9 separately transgenic operations with PE and CBE for leaf discs, totally 760 leaf discs were used as explants, the regenerative rate from 6.25–200%, 53.14% averagely. Meanwhile, 72 internodes were used as explants with 3 different operations, the regenerative rate was from 0 to 79.41% (Fig. 2c). These results indicated that compare to internodes, leaf discs are more stable as explants.

2.4 20 µg/L chlorsulfuron is more suitable for selection than 40 µg/L.

To find the suitable selection concentration for chlorsulfuron, there are 294 Desiree explants transferred on SEG medium for callus induction with 20 µg/L chlorsulfuron (without kanamycin). After 20 days culture, 136 were kept green (Fig. 3a), so the survival ratio is 52.5%. At the same time, 67 Desiree explants were transferred to SEG with 40 µg/L chlorsulfuron and without kanamycin, 20 days later, nearly all explants were turn black and died (Fig. 3a), the survival ratio is 3.36% (Fig. 3b, Supplementary figure S3). So, when chlorsulfuron work as selection herbicide, 20 µg/L in the SEG medium is more suitable than 40 µg/L for Desiree. It is too high for 40 µg/L worked as selection agent for Desiree in this system.

2.5 This transgenic system is stable and highly efficient for Desiree under different vectors.

There are four different binary vectors were tested in this system. The lowest regeneration ratio is CBE vector, 31.22%. And the highest regeneration ratio is 83.33%, under pBI121 used as introduction vector. Some seedlings were selected to identify the positive plantlets by GUS staining or PCR method (Fig. 4a, 4b ). The results shown that averagely positive ratio is 72.36%. The lowest ratio comes from pBI121 (50%), and the highest ratio came from PE, up to 96.00%. The result of for different backbone vectors indicated that shoot regeneration ratio is dependent on the vectors, but all regeneration ratio is above 30%, and the averagely positive transgenic ratio is above 70%, is higher than common protocols ^44,45, so this system is stable and high transgenic efficiency.

2.6 This potato transgenic system via A. tumefaciens for Desiree is simple and time saved.

With eliminated the explants preculture process, combination of the easier regeneration explants, leaf discs, this system took about 31 days for shoots (about 0.5 cm length) emerged from callus after inoculation for Desiree with A. tumefaciens, which is much quicker than some traditional methods ^37,46. Preparation of A. tumefaciens within target vector and explants need 1 day, then 2 days for co-culture on COA medium. It took 28 days for first shoots (about 0.5cm length) appeared on callus with SEG medium. So, the totally days for regeneration shoots was 31 days. Roots normally appeared 10 days after transferred to rooting medium (Fig. 5). It always took 58 days to complete full process, for 45 days were needed for all calluses to regenerate shoots. In conclusion, this system eliminated preculture process, used single-regeneration medium, leaf discs as suitable explants, made operation simple and time saved.

The Agrobacterium mediated transgenesis method creates new materials transformed with desirable functional genes. It is a robust tool for gene functional analysis, which can provide genetically modified materials to support basic research, and it can be used to create new varieties with modified genes function for traits improvement. For instance, drought tolerant, rapid tuber bulking for increase yield and many traits for tuber quality. So, the transgenic method via A. tumefaciens is a very important technology for molecular research and breeding. Globally, many research groups pay close attention to the successful establishment of an A. tumefaciens derived potato transgenic system.

In this study, the transgenic system is highly efficient and time saving for Desiree. However, despite being successful for the diploid materials, it has low efficiency. In this methodology, we did not apply the pre-culture procedures that are normally applied in some protocols ^18,20. These pre-culture procedures always require about one week to implement. The explants were used to inoculate the A. tumefaciens directly in this protocol. After co-cultivation for 2 days, the explants were transferred to selection and regeneration medium. So, this protocol is simple, about 4 weeks after inoculation, some positive transgenic plant can be produced.

There are four most important factors that influence transgenic efficiency, including the A. tumefaciens strain, the potato recipients, the culture medium, and growing environment.

In this study, A. tumefaciens strain EHA105 containing plant binary expression vectors was used for inoculating with the recipients. The transgenic efficiency for Desiree’s square leaves is up to 68.80% (Table in Fig. 4), indicating that the EHA105 can introduce the T-DNA in the Desiree with high efficiency.

The vitality of A. tumefaciens was found to be influenced by the bacterium culture medium, growth period, and environmental conditions. In this study, we utilized YEP medium for culturing A. tumefaciens, as it is known to be particularly suitable for A. tumefaciens cultivation ⁴⁷. After an overnight recovery in the shaker, the EHA105 strain demonstrated robust vitality with rapid multiplication rates. Bacteria were then suspended in INF liquid medium to make bacterial suspensions. For this research, the OD₅₅₀ of the bacterial suspension was approximately 0.5, ensuring an adequate amount of A. tumefaciens for inoculating the explants. Moreover, this specific concentration was optimized to mitigate the effects of antibiosis during the callus induction and shoot regeneration stages. The chosen concentration parameter strikes a balance between high inoculation efficiency and minimizing the impact of antibiotic during the process.

The recipient genotypes influence potato transgenic potato efficiency. The successful transgenic system used cultivars included Russet Burbank ^21,27,48, Bintje ^22,49, Desiree ^{22,23,30,31,38,48,50,51}, Berolina ²², Shepody ²⁴, King Edward ³⁸, and also including some diploid and haploid materials ⁵², and wild species ³⁵. According to a review of paper statistics by Vinterhalter et al. 2008, Desiree is the most frequently recipient ¹³. Indeed, in our study, we also used Desiree as the recipient cultivar, which gave a transformation efficiency up to 68.80%, indicating that the system is stable for Desiree. However, for the diploid used in this study, the transformation efficiency is close to 5.6%. A possible reason for the lower efficiency, could be that the new recipient needs a more suitable medium for culture. Existing medium could not support a higher rate of transgenic efficiency. A study by Ye et al. 2018, demonstrated that the transgenic efficiencies of three diploid materials, namely CIP703308, CIP703312 and CIP703541, were 2.8%, 4.2% and 5.3% ⁵³. Ye’s study applied a two-step regeneration media protocol using for callus induction, and shoot formation, but in our research the one-step regeneration medium (SEG medium) was used, maybe this is the reason the diploid material’s transgenic efficiency is lower in our system.

In this study, leaves were cut into irregular pattern (5 mm²) and internodes were cut into of about 5 mm in length, which were used to study the positive transgene efficiency. The positive transgenic efficiency indicated that cultivar Desiree’s leaf discs have a higher efficiency than internodes fellow this protocol. We hypothesize that the reason may be due to different phytohormones in internal organs, the internal phytohormones matched with the utilized plant growth regulators in the medium, which is suitable to induce callus and regenerate shoots. The internodes and petioles were tested as the recipient in this system, both successfully produced positive transgenic plants, re-affirming the use of these parts of the plant for successful transformation. All explants were cut from 3–4 weeks old potato plants. Old plants have a reduced regeneration ability, especially for internode sections.

The type and constituent parts of the media are important. This includes the inoculation lipid medium, co-cultivation medium, callus-induction medium and shoot-induce medium. The most important medium is callus-induction medium, for the explants will stay on the medium the longest amount of time and the explants will produce callus and complete the regeneration process. The medium also contains antibiotic for selection of transformants carrying the marker genes and suppress the growth of the A. tumefaciens. The most important reagents are the phytohormones and their concentration ratio. The two important types of phytohormones are auxin and cytokinin. The high auxin concentration always induces the callus, and cytokinin encourages shoot regeneration. According to review paper, 2,4-D, IAA, NAA usually were used as auxin, and 6-BA, kinetin and zeatin always were used as cytokinin to regulate the callus and shoot induction ¹³. In this study, we used NAA as the auxin and zeatin worked as the cytokinin. SEG medium is the SE medium with addition 0.02mg/L GA₃ and increase the NAA concentration. GA₃ can stimulate rapid stem and root growth and increase seed germination rate ⁵⁴. GA₃ may help for both somatic embryogenesis and organogenesis during regeneration. For the callus and regeneration process, there are two different protocols, direct regeneration - single stage technique, and indirect regeneration - two stages technique. Maybe because potato is a vegetatively propagated plant, it is very easy to regenerate shoot during plant tissue culture, so the single stage technique was effective to complete the callus and shoot regeneration process. For some monocotyledon crops, such as rice ⁵⁵, maize ⁵⁶, wheat ⁵⁷, a two-stages technique is normally utilized. Firstly, a callus-induction process, then shoot regeneration method with different media used at each stage. In this study we followed the successful protocols with slight modified, to make the process simple. We apply the direct regeneration-single stage technique, for cultivar Desiree, which is very simple and efficient. However, for diploid materials, this protocol works, but the transgenic efficiency is lower.

When exploring the suitability of each method for new potato genotypes, the better strategy is the application of the indirect regeneration two-stages technique. Then, modified the medium using suitable phytohormones and concentration, which can be used as direct regeneration single-stage technique. Our group try to build transgenic system for a homogenous diploid material with single-stage technique. The edges of explants can produce calli after one week, and thereafter produce many adventitious roots. After 5 weeks, the explants just produce green and solid callus (unpublished data), which is difficult to support shoot regeneration. So, it is better to apply the indirect regeneration-two stages technique, removing the auxin component to induce the shoots.

For the NPT-II biosafety problem, the European food safety authority stated that use of NPT-II as a selectable marker in potato, does not pose a risk to the environment or human and animal health ⁵⁸. There are many transgenic crops, with about 50 commercialized, that have used the NPT-II gene (Personal communication with CIP’ scientist Dr. Ghislain Marc)⁵⁹. There are some other types of selectable markers, such as hygromycin that could be used as a selective agent when the vector carries the hpt gene ³¹. Another approach of adding the trait of herbicide resistance helps with weeds management. In this study, chlorsulfuron was used as selective agent, which is a member of sulfonylurea family, acts as an inhibitor of acetolactate synthase (ALS), thereby preventing the biosynthesis of branched chain amino acids, resulting in plant death⁶⁰. Relative study shown that 20µg/L ⁶¹, 110 nM (~ 40 µg/L) ^62,63 were used by potato transgenic system. The reason 20µg/L is more suitable for selection in this result may be due to the concentration matched to other reagents in SEG medium.

Some processes, like preculture of explants are not necessary for a successful transgenic system, ^53,64. Further, preculture may unwittingly damage the explants, so the protocol of this study did not contain this process. In this study, fresh leaves from the plants, cut into squares, were directly inoculated with the A. tumefaciens suspension, giving a positive transgenic efficiency up to 68.80% for Desiree. Hence, the precultural process is not necessary.

After inoculation, an important treatment was reducing the concentration of A. tumefaciens to avoid contamination during proceeding steps. Different processes were applied in previous studies, such as blot-drying of explants on sterile filter paper ^29,37,65,66, and washing with a lipid-based, medium with or without an antibiotic ^25,65,67. But above operations are complex and time-cost, so in this study after the explants were transferred to the co-cultivation medium, external medium was syphoned-off using a pipette, and dried the explants under the ultra-clean bench. This method effectively decreased the concentration of Agrobacterium preventing overgrowth during the co-culturing stage. The explants were transferred to the regeneration medium, where bacterium concentration was suppressed by antibiotics, such as Timentin ⁶⁶, Augmentin ⁵⁰, Cefotaxime ³⁸, Duocid ²⁶. The elimination of wash step process made the operation more convenient and reduced the potential contamination risks presented during more operations.

The instability of in vitro cultures may cause genetic and epigenetic changes in crops called somaclonal variations. Sometimes, these changes produce beneficial effects: for example, they can be used in breeding programs to generate new cultivars with desirable characteristics ⁶⁸. In many cases, most of the recovered transgenic plants had somaclonal variation, especially ploidy changes or morphogenetic altered characteristics ⁶⁹. Autopolyploidization after regeneration will change the gene expression pattern and phenotype ⁷⁰. In this study, diploid materials have a very high ploidy change ratio, up to about 55%. So, the purpose of gene function study, more selection will be needed when diploid materials as receipt.

For the utilization of the transgenic system, one purpose is to support the basic research of functional gene analysis. The successful transgenic system via A. tumefaciens is more convenient and stable compared with other systems, such as systems of transient transformation via protoplast or particle bombardment ⁷¹. Although transgenic crops remain controversial, banned, or subject to long-term safety trials and regulation in many regions ⁷², after the development of CRISPR/Cas9 technology, gene editing could successfully be completed with or without the insertion of foreign-DNA. Some foreign-DNA free gene edited plants were considered as non-transgenic crops in some countries, crops without foreign genetic material are more readily accepted by the public and less costly to regulate ⁷³. This has been the case, even when the transformation system used A. tumefaciens, the inserted fragment, which includes the vector fragment, cas9 protein expression cassette, and guide RNA part could be removed from plant genome through recombination in the progeny. For some homozygous crops, removing the inserted fragments and keeping the edited target genes is easy accomplished with backcrossing with the recipient via genome recombination and segregation. However, for the dominant economic potato varieties as heterozygous tetraploid, it is impossible to remove the inserted fragments and does not change the genome via recombination. So, when using the potato transgenic method via A. tumefaciens, it is low possible to remove the foreign-DNA and maintain the genotype. There are many other methods that could be used to create foreign-DNA free gene editing in heterozygous tetraploid potato varieties, which maintain the recipient background, such as in planta particle bombardment ⁷⁴, transient transformation via potato protoplasts ^75,76, and induced callus the regeneration system, and some new technologies, transformation via modified virus ⁷⁷, and gene editing through grafting technology via mobile transcripts passed through the co-joined phloem of the stock to the scion ⁷⁸.

In conclusion, there are many factors will influence the potato transgenic efficiency via A. tumefaciens. This study advances operations, media, cultural environments and recipient organ and materials, provides a simple and efficient potato transformation system via A. tumefaciens for Desiree, which supports gene functional research and biotechnology breeding.

2,4-D: 2,4-Dichlorophenoxyacetic acid

IAA: Indole acetic acid

NAA: 1-Naphthaleneacetic acid

6-BA: 6-Benzylaminopurine

Author contributions

JL and CX prepared the manuscript and completed all trials. YL provided background information support with manuscript preparation. ME and PK proofread this manuscript for content and format and gave quite professional revision comments. QL, YJ and YF provided scientific suggestions. PY, ZZ, SC and YS support analyzed the data, provided key potato materials. JL and LW led the progress of this project, designed the experiments.

Acknowledgement

Thanks for Dr. Hui Du from Yunnan Normal University kindly shared vectors for this study, and NovoCrops Biotechnology Limited completed the plantlets identification experiments.

Conflict of interest

Authors declare no conflict of interest.

Additional information

The data supporting the findings of this study are available in the article and supplementary materials. All data are available from the corresponding author.

Statement on Compliance of Plant Experiments

We solemnly declare that all work related to plant experiments and protocols has been conducted in accordance with the pertinent institutional, national, and international guidelines and legislation.

FAO. Climate change and food security: risks and responses, http://www.fao.org/3/a-i5188e.pdf (2016).
Shewry, P. R., Jones, H. D. & Halford, N. G. Plant biotechnology: transgenic crops. Advances in Biochemical Engineering Biotechnology 111, 149-186, doi:10.1007/10_2008_095 (2008).
Sharma, S. et al. Speed breeding opportunities and challenges for crop improvement. Journal of Plant Growth Regulation 42, 46-59, doi:10.1007/s00344-021-10551-8 (2022).
Fehér, A., Felföldi, K., Preiszner, J. & Dudits, D. Peg-mediated transformation of leaf protoplasts of Solanum tuberosum L. Cultivars. Plant Cell, Tissue and Organ Culture 27, 105-114, doi:10.1007/BF00048214 (1991).
Romano, P., Fiore, C., Paraggio, M., Caruso, M. & Capece, A. Function of yeast species and strains in wine flavour. International Journal of Food Microbiology 86, 169-180, doi:10.1016/s0168-1605(03)00290-3 (2003).
Ooms, G., Karp, A. & Roberts, J. From tumour to tuber; tumour cell characteristics and chromosome numbers of crown gall-derived tetraploid potato plants (Solanum tuberosum cv. ‘Maris bard’). Theoretical and Applied Genetics 66, 169-172, doi:10.1007/BF00265193 (1983).
Perlak, F. J. et al. Genetically improved potatoes: protection from damage by colorado potato beetles. Plant Molecular Biology 22, 313-321, doi:10.1007/BF00014938 (1993).
USDA-APHIS. Petitions for determination of nonregulated status, http://www.aphis.usda.gov/biotechnology/petitions_table_pending.shtml (2015).
Kaniewski, W. K. & Thomas, P. E. The potato story. AgBioForum 7, 41-46 (2004).
Hofvander, P. Production of amylopectin and high-amylose starch in separate potato genotypes. (Department of Plant Biology and Forest Genetics, Swedish University of Agricultural Sciences, 2004).
Meier, A. & Halterman, D. Structural variation within the potato gene locus and correlation with molecular marker analysis. Crop Science 56, doi:10.2135/cropsci2016.02.0137 (2016).
Kaur, R. & Devi, D. S. In planta transformation in plants: a review. Agricultural Reviews 40, doi:10.18805/ag.R-1597 (2019).
Vinterhalter, D. et al. Protocols for Agrobacterium mediated transformation of potato. Fruit, Vegetable and Cereal Science and Biotechnology Potato (2008).
Ho, P. T. et al. Construction of an agroinfectious clone of a korean isolate of sweet potato symptomless virus 1 and comparison of its infectivity according to Agrobacterium tumefaciens strains in Nicotiana benthamiana. The Plant Pathology Journal 39, 255-264, doi:10.5423/ppj.Oa.12.2022.0168 (2023).
Elnahal, A. S. M. et al. Identification of natural resistance mediated by recognition of phytophthora infestans effector gene Avr3a(EM) in potato. Frontiers in Plant Science 11, 919, doi:10.3389/fpls.2020.00919 (2020).
Ho, P. et al. First agroinoculation system development of Sweet potato symptomless virus on Nicotiana benthamiana. Preprint at https://www.researchsquare.com/article/rs-1377300/v1 (2022).
Rahamkulov, I. & Bakhsh, A. Tissue-specific and stress-inducible promoters establish their suitability for containment of foreign gene(s) expression in transgenic potatoes. 3 Biotech 10, 426, doi:10.1007/s13205-020-02350-x (2020).
Kaur, A., Guleria, S., Reddy, M. S. & Kumar, A. A robust genetic transformation protocol to obtain transgenic shoots of Solanum tuberosum L. Cultivar 'kufri chipsona 1'. Physiology and Molecular Biology of Plants 26, 367-377, doi:10.1007/s12298-019-00747-4 (2020).
Wang, K. et al. StTCP15 regulates potato tuber sprouting by modulating the dynamic balance between abscisic acid and gibberellic acid. Frontiers in Plant Science 13, doi:10.3389/fpls.2022.1009552 (2022).
Ye, M. et al. Generation of self-compatible diploid potato by knockout of S-RNase. Nature Plants 4, 651-654, doi:10.1038/s41477-018-0218-6 (2018).
Shahin, E. A. & Simpson, R. B. Gene transfer system for potato. HortScience 21, 1199-1201, doi:10.21273/hortsci.21.5.1199 (1986).
De Block, M. Genotype-independent leaf disc transformation of potato (Solanum tuberosum) using Agrobacterium tumefaciens. Monographs on Theoretical and Applied Genetics 76, 767-774, doi:10.1007/BF00303524 (1988).
Rocha-Sosa, M. et al. Both developmental and metabolic signals activate the promoter of a class I patatin gene. The EMBO journal 8, 23-29, doi:10.1002/j.1460-2075.1989.tb03344.x (1989).
Gustafson, V. et al. Transformation and plant regeneration from leaf explants of Solanum tuberosum L. Cv. ‘Shepody’. Plant Cell, Tissue and Organ Culture 85, 361-366, doi:10.1007/s11240-006-9085-3 (2006).
Amiri, A. N. & Bakhsh, A. An effective pest management approach in potato to combat insect pests and herbicide. 3 Biotech 9, 16, doi:10.1007/s13205-018-1536-0 (2019).
Bakhsh, A., Hussain, T., Rahamkulov, I., Demirel, U. & Çalışkan, M. E. Transgenic potato lines expressing CP4-EPSP synthase exhibit resistance against glyphosate. Plant Cell, Tissue and Organ Culture 140, 23-34, doi:10.1007/s11240-019-01708-1 (2019).
Newell, C. et al. Agrobacterium-mediated transformation of Solanum tuberosum L. Cv.‘Russet burbank’. Plant Cell Reports 10, 30-34, doi:10.1007/BF00233028 (1991).
Antony, B., Sangwan, R., Lecardnnel, A. & Sangwan-Norreel, B. S. Agrobacterium-mediated transformation of three economically important potato cultivars using sliced internodal explants: an efficient protocol of transformation. Journal of Experimental Botany 49, doi:10.1093/jexbot/49.326.1589 (1998).
Ducreux, L. J. M. et al. Metabolic engineering of high carotenoid potato tubers containing enhanced levels of β-carotene and lutein. Journal of Experimental Botany 56, 81-89, doi:10.1093/jxb/eri016 (2005).
Roman, M. L. et al. R/Avr gene expression study of Rpi-vnt1.1 transgenic potato resistant to the Phytophthora infestans clonal lineage EC-1. Plant Cell, Tissue and Organ Culture 131, 259-268, doi:10.1007/s11240-017-1281-9 (2017).
Orbegozo, J. et al. Rpi-blb2 gene from Solanum bulbocastanum confers extreme resistance to late blight disease in potato. Plant Cell, Tissue and Organ Culture 125, 269-281, doi:10.1007/s11240-016-0947-z (2016).
Heeres, P., Schippers-Rozenboom, M., Jacobsen, E. & Visser, R. G. F. Transformation of a large number of potato varieties: genotype-dependent variation in efficiency and somaclonal variability. Euphytica 124, 13-22, doi:10.1023/A:1015689112703 (2002).
Stiekema, W. J., Heidekamp, F., Louwerse, J. D., Verhoeven, H. A. & Dijkhuis, P. Introduction of foreign genes into potato cultivars bintje and désirée using an Agrobacterium tumefaciens binary vector. Plant Cell Reports 7, 47-50, doi:10.1007/bf00272976 (1988).
Sheerman, S. & Bevan, M. W. A rapid transformation method for Solanum tuberosum using binary Agrobacterium tumefaciens vectors. Plant Cell Reports 7, 13-16, doi:10.1007/bf00272967 (1988).
Kumar, A., Miller, M., Whitty, P., Lyon, J. & Davie, P. Agrobacterium -mediated transformation of five wild Solanum species using in vitro microtubers. Plant Cell Reports 14, 324-328, doi:10.1007/BF00232037 (1995).
Tavazza, R., Ordas, R. J., Tavazza, M., Ancora, G. & Benvenuto, E. Genetic transformation of nicotiana clevelandii using a ti plasmid derived vector. Journal of Plant Physiology 133, 640-644, doi:10.1016/S0176-1617(88)80022-1 (1988).
Trujillo, C. et al. One-step transformation of two andean potato cultivars (Solanum tuberosum L. subsp. andigena). Plant Cell Reports 20, 637-641, doi:10.1007/s002990100381 (2001).
Kieu, N. P., Lenman, M., Wang, E. S., Petersen, B. L. & Andreasson, E. Mutations introduced in susceptibility genes through CRISPR/Cas9 genome editing confer increased late blight resistance in potatoes. Scientific Reports 11, 4487, doi:10.1038/s41598-021-83972-w (2021).
An, G., Watson, B. D. & Chiang, C. C. Transformation of tobacco, tomato, potato, and Arabidopsis thaliana using a binary Ti vector system. Plant Physiology 81, 301-305, doi:10.1104/pp.81.1.301 (1986).
Lee, J. H. & Schöffl, F. GUS activity staining — a powerful tool in plant molecular biology.in Plant Molecular Biology Manual (eds Stanton B. Gelvin & Robbert A. Schilperoort) 23-32 (Springer Netherlands, 1997).
Porebski, S., Bailey, L. G. & Baum, B. R. Modification of a CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components. Plant Molecular Biology Reporter 15, 8-15, doi:10.1007/BF02772108 (1997).
Ordoñez, B. et al. Pl-4 (cip596131.4): an improved potato haploid inducer. American Journal of Potato Research 98, 255-262, doi:10.1007/s12230-021-09839-y (2021).
Galbraith, D. W., Harkins, K. R. & Knapp, S. Systemic endopolyploidy in Arabidopsis thaliana. Plant Physiology 96, 985-989, doi:10.1104/pp.96.3.985 (1990).
Bakhsh, A. Development of efficient, reproducible and stable Agrobacterium-mediated genetic transformation of five potato cultivars. Food Technology and Biotechnology 58, 57-63, doi:10.17113/ftb.58.01.20.6187 (2020).
Ghislain, M. et al. Stacking three late blight resistance genes from wild species directly into African highland potato varieties confers complete field resistance to local blight races. Plant Biotechnology Journal 17, 1119-1129, doi:10.1111/pbi.13042 (2019).
Craze, M., Bates, R., Bowden, S. & Wallington, E. J. Highly efficient Agrobacterium-mediated transformation of potato (Solanum tuberosum) and production of transgenic microtubers. Current Protocols in Plant Biology 3, 33-41, doi:10.1002/cppb.20065 (2018).
Leth, I. K. & McDonald, K. A. Media development for large scale Agrobacterium tumefaciens culture. Biotechnology Progress 33, 1218-1225, doi:10.1002/btpr.2504 (2017).
Wenzler, H., Mignery, G., May, G. & Park, W. A rapid and efficient transformation method for the production of large numbers of transgenic potato plants. Plant Science 63, 79-85, doi:10.1016/0168-9452(89)90103-9 (1989).
Ottaviani, M., Schel, J. & Hänisch ten Cate, C. H. Variation in structure and plant regeneration of Agrobacterium rhizogenes transformed and control roots of the potato cv. Bintje. Plant Cell, Tissue and Organ Culture 20, 25-34, doi:10.1007/BF00034753 (1990).
Edwards, G. A., Hepher, A., Clerk, S. P. & Boulter, D. Pea lectin is correctly processed, stable and active in leaves of transgenic potato plants. Plant Molecular Biology 17, 89-100, doi:10.1007/BF00036809 (1991).
Dietze, J., Blau, A. & Willmitzer, L. in Gene Transfer to Plants (eds Ingo Potrykus & German Spangenberg) 24-29 (Springer Berlin Heidelberg, 1995).
de Vries-Uijtewaal, E., Gilissen, L. J. W., Flipse, E., Ramulu, K. S. & De Groot, B. Characterization of root clones obtained after transformation of monohaploid and diploid potato genotypes with hairy root inducing strains of Agrobacterium. Plant Science 58, 193-202, doi:10.1016/0168-9452(88)90009-X (1988).
YE MingWang, Z. C., HUANG SanWen. Construction of high efficient genetic transformation system for diploid potatoes. Scientia Agricultura Sinica, 51(17): 3249-3257, doi:10.3864/j.issn.0578-1752.2018.17.002 (2018).
Edwards, M. Dormancy in seeds of charlock (Sinapis arvensis L.): early effects of gibberellic acid on the synthesis of amino acids and proteins. Plant Physiology 58, 626-630, doi:10.1104/pp.58.5.626 (1976).
Zhang, Y., Li, J. & Gao, C. Generation of stable transgenic rice (Oryza sativa L.) by Agrobacterium-mediated transformation. Current Protocols in Plant Biology 1, 235-246, doi:10.1002/cppb.20004 (2016).
Ishida, Y., Hiei, Y. & Komari, T. Agrobacterium-mediated transformation of maize. Nature Protocols 2, 1614-1621, doi:10.1038/nprot.2007.241 (2007).
Ishida, Y., Hiei, Y. & Komari, T. High efficiency wheat transformation mediated by Agrobacterium tumefaciens. In: Ogihara, Y., Takumi, S., Handa, H. (eds) Advances in Wheat Genetics: From Genome to Field. 167-173, doi:10.1007/978-4-431-55675-6_18 (2015).
European Food Safety, A. Statement on the safe use of the NPT-II antibiotic resistance marker gene in genetically modified plants by the scientific panel on genetically modified organisms (GMO). European Food Safety Authority 5, 742, doi:10.2903/j.efsa.2007.742 (2007).
University, M. S. Marc ghislain, https://www.canr.msu.edu/people/marc-ghislain (2022).
Yu, Q. & Powles, S. B. Resistance to ahas inhibitor herbicides: current understanding. Pest Management Science 70, 1340-1350, doi:10.1002/ps.3710 (2014).
Barrell, P. J. et al. Somatic cell selection for chlorsulfuron-resistant mutants in potato: identification of point mutations in the acetohydroxyacid synthase gene. BMC Biotechnology 17, 49, doi:10.1186/s12896-017-0371-4 (2017).
Huang, X. et al. Transgene-free genome editing of vegetatively propagated and perennial plant species in the T0 generation via a co-editing strategy. Nature Plants 9, 1591-1597, doi:10.1038/s41477-023-01520-y (2023).
Veillet, F. et al. Transgene-free genome editing in tomato and potato plants using Agrobacterium-mediated delivery of a CRISPR/Cas9 cytidine base editor. International Journal of Molecular Sciences 20 (2019).
Ch. H. ten Cate Hänisch et al. Regeneration and characterization of plants from potato root lines transformed by Agrobacterium rhizogenes. Theoretical and Applied Genetics 75, 452-459, doi:10.1007/BF00276749 (1988).
Visser, R. G., Jacobsen, E., Witholt, B. & Feenstra, W. J. Efficient transformation of potato (Solanum tuberosum L.) using a binary vector in Agrobacterium rhizogenes. Theoretical and Applied Genetics 78, 594-600, doi:10.1007/BF00290847 (1989).
Barrell, P. J., Yongjin, S., Cooper, P. A. & Conner, A. J. Alternative selectable markers for potato transformation using minimal T-DNA vectors. Plant Cell, Tissue and Organ Culture 70, 61-68, doi:10.1023/A:1016013426923 (2002).
Banerjee, A. K., Prat, S. & Hannapel, D. J. Efficient production of transgenic potato (S. tuberosum L. ssp. andigena) plants via Agrobacterium tumefaciens-mediated transformation. Plant Science 170, 732-738, doi:10.1016/j.plantsci.2005.11.007 (2006).
Ferreira, M. D. et al. The role of somaclonal variation in plant genetic improvement: a systematic review. Agronomy 13 (2023).
Gonsalves, C. et al. Transferring cucumber mosaic virus-white leaf strain coat protein gene into Cucumis melo L. And evaluating transgenic plants for protection against infections. Journal of the American Society for Horticultural Science jashs 119, 345-355, doi:10.21273/JASHS.119.2.345 (1994).
Stupar, R. M. et al. Phenotypic and transcriptomic changes associated with potato autopolyploidization. Genetics 176, 2055-2067, doi:10.1534/genetics.107.074286 (2007).
Craig, W. et al. Direct gene transfer in potato: a comparison of particle bombardment of leaf explants and PEG-mediated transformation of protoplasts. Plant Cell Reports 24, 603-611, doi:10.1007/s00299-005-0018-0 (2005).
GLP. Where are gmo crops and animals approved and banned?, https://geneticliteracyproject.org/gmo-faq/where-are-gmo-crops-and-animals-approved-and-banned/ (2020).
Kang, Y., Deng, H., Pray, C. & Hu, R. Managers' attitudes toward gene-editing technology and companies' R&D investment in gene-editing: the case of Chinese seed companies. GM Crops Food 13, 309-326, doi:10.1080/21645698.2022.2140567 (2022).
Imai, R. et al. In planta particle bombardment (iPB): a new method for plant transformation and genome editing. Plant Biotechnology (Tokyo) 37, 171-176, doi:10.5511/plantbiotechnology.20.0206a (2020).
Chauvin, L. et al. Gene editing in potato using CRISPR-Cas9 technology. Methods in Molecular Biology 2354, 331-351, doi:10.1007/978-1-0716-1609-3_16 (2021).
Andreasson, E. et al. Invited mini-review research topic: utilization of protoplasts to facilitate gene editing in plants: schemes for in vitro shoot regeneration from tissues and protoplasts of potato and rapeseed: implications of bioengineering such as gene editing of broad-leaved plants. Frontiers in Genome Editing 4, 780004, doi:10.3389/fgeed.2022.780004 (2022).
Ma, X., Zhang, X., Liu, H. & Li, Z. Highly efficient DNA-free plant genome editing using virally delivered CRISPR-Cas9. Nature Plants 6, 773-779, doi:10.1038/s41477-020-0704-5 (2020).
Yang, L., Machin, F., Wang, S., Saplaoura, E. & Kragler, F. Heritable transgene-free genome editing in plants by grafting of wild-type shoots to transgenic donor rootstocks. Nature Biotechnology, doi:10.1038/s41587-022-01585-8 (2023).

No competing interests reported.

A simple and efficient Agrobacterium tumefaciens mediated transgenic system for tetraploid potato cultivar Desiree

Status:

Version 1

Abstract

Figures

Introduction

1. Materials and methods

1.1 Mediums components information

1.5 GUS histochemical assay

1.7 Ploidy analysis

2. Results

3. Discussion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1