2.1. Patient and control samples
Mononuclear cells were isolated from bone marrow samples from 74 patients with de novo AML at diagnosis and 30 lymphoma subjects without evidence of bone marrow involvement - the latter were used as healthy controls. The research was approved by the institutional review board of Attikon University Hospital (ΕΒΔ2421/26-05-2017) and all participants gave written informed consent in agreement with the Declaration of Helsinki. All AML patients had received one to two induction cycles of Cytarabine and Idarubicin and response to treatment was evaluated after the end of induction. Isolation was performed with Lymphoprep (STEM CELL Technologies) by density gradient centrifugation. Isolated cells in RPMI were stored in cryovials at – 80˚C. Mononuclear cells were homogenized using a QIA shredder spin column (Qiagen Ltd., Hilden, Germany).
2.2. Cell Culture
Four AML cell lines namely MV-4-11, MOLM-13 (MLL-AF9 fusion, FLT3-ITD mutated), KASUMI-1 (core binding factor AML), and TF-1 (erythroleukemia), were cultured based on ATCC® guidelines. The growth conditions were 5% CO2, 95% air, and a temperature of 37℃.
2.3. MTT assay
Cell lines KASUMI-1 and MV-4-11 were seeded in a 96-well plate at a concentration of 1x105 cells/mL, 16h after seeding they were treated based on bibliographic data with Idarubicin and Cytarabine in order to conduct the gene expression profiling. MOLM-13 and KASUMI-1 cells were seeded in a 96-well plate at a concentration of 1x105 cells/mL. Afterwards, they were treated with Idarubicin or Cytarabine at a concentration range of 1nM- 10µΜ (with a 10fold gradual increase) and were further incubated for 24, 48, and 72 hours. TF-1 cells were seeded in a 96-well plate at a concentration of 1x105 cells/mL. Afterward, they were treated with Idarubicin (0.01, 0.05, 0.1, 0.2, and 0.5µΜ) or Cytarabine (0.1, 0.5, 01, 2, 5µΜ) and were further incubated for 24, 48 and 72 hours. The colorimetric 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyl-tetrazolium bromide (MTT) assay was used for cell viability determination at each time-point and for each agent concentration. MTT (Sigma, USA) was dissolved in PBS at 5 mg/mL, the MTT solution was added to the 96-well plate at volume 20 µL, and the resulting solution was incubated in 5% CO2 for another 4 h at 37°C. Formazan crystals were dissolved in 200 µL of SDS-HCL. The plates were then analyzed in a plate reader at 570 nm. All experiments were performed in triplicate.
2.4. Trypan Blue assay
Trypan Blue assay was also used to determine the number of viable cells after treatment of both cell lines with the different concentrations of Idarubicin or Cytarabine in 24, 48, and 72 h. MOLM-13 and KASUMI-1 cells were seeded in a 6-well plate at a concentration of 1x105 cells/mL, then treated and incubated at three time points. Next, we mixed 1 part of 0.4% trypan blue (Sigma-Aldrich, Merck) and 1 part cell suspension and the total cells were counted within 3 to 5 minutes with a hemacytometer. All experiments were performed in triplicate.
2.5. The half-maximal inhibitory concentration (IC50) calculation
The IC50 values 24,48 and 72 hours after treatment with different concentrations of Idarubicin or Cytarabine in MOLM-13 and KASUMI-1 cell lines were determined by plotting the MTT assay results of % viability vs time for each drug concentration. Subsequently, cell viability was further assessed using the trypan blue assay to confirm the results.
2.6. Clonogenicity assay
TF-1 cells were counted and re-suspended at a density of 2000 cells/ml in methylcellulose-based media. After 10 to 14 days of incubation at 37°C in 5% CO2, the recovery of colony-forming units was determined by colony counting under bright-field microscopy. A cell aggregate composed of > 50 cells was defined as a colony.
2.7. siRNA transfection
In 6-well plates, MOLM-13 and KASUMI-1 cells were seeded at the specified concentrations. Following the designated incubation period, treatment with Idarubicin (10 nM) or Cytarabine (100 nM) was administered to MOLM-13, while KASUMI-1 received Idarubicin (1 nM) or Cytarabine (100 nM). Untreated wells were also incorporated. After 24 hours, 10 pmol of siRNA was transfected into each respective well. In both treated and untreated cells, wells containing 10 pmol of a scrambled sequence were included, as were wells comprising only the transfection reagents (mock control). Each reaction was conducted in triplicates using the Lipofectamine™ RNAiMAX (Invitrogen™, Thermo Fisher Scientific Inc.). The cells were incubated with the transfection reagents for 24 and 48 h. The principles of the designed sequences are shown in Supplemental Table S1.
2.8. Total RNA isolation and RNA quality control
Total RNA was extracted from patient samples utilizing the RNeasy Plus Mini Kit (Qiagen Ltd., Hilden, Germany). Additionally, total RNA was isolated from transfected cells employing NucleoZOL (MACHEREY-NAGEL GmbH & Co. KG, Düren, Germany). The concentration of total RNA was determined using the BioSpec-nano Micro-volume UV–vis Spectrophotometer (Shimadju, Kyoto, Japan), and their integrity was assessed via electrophoresis in 1.2% agarose gel.
2.9. Reverse transcription and real-time quantitative PCR (qPCR)
200 ng of each RNA extract from patient samples was used as a template for cDNA synthesis. First-strand synthesis was conducted using M-MLV reverse transcriptase (Life Technologies Ltd., Carlsbad, CA, USA) and oligo-dT primer. All reactions were performed according to the manufacturer’s instructions. 100 ng of cDNA of patient samples were diluted in QuantiNova Yellow Template Dilution Buffer were mixed with 10 µl of 2x QuantiNova SYBR Green PCR Master Mix (Qiagen Ltd., Hilden, Germany), 2 µl of 10x QuantiTect primer, and RNase free water. Real-time qPCR assays followed using KAPA™ SYBR® FAST qPCR master mix (2X) (Kapa Biosystems Inc., Woburn, MA, USA). Reactions were performed in a QuantStudio 5 Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific Inc.), according to the manufacturer’s protocol. Gene expression was normalized against GAPDH expression and relative gene expression was calculated by the ΔCt method. We studied gene expression in correlation with disease status, ELN2017 AML cytogenetic risk [10], presence of FMS like Tyrosine kinase 3 mutation Internal Tandem Duplication (FLT3-ITD) and nucleophosmine 1 (NPM1) mutations and patient survival.
To investigate the impact of Idarubicin and Cytarabine at their respective IC50 concentrations on PPP1R15A expression in AML cell lines, gene expression analysis was performed using qRT-PCR as described above. Melt curve analysis was also utilized to verify the specificity of each amplification product. For each pairing of cell line and inhibitor, the normalized RQU or fold change values were expressed as log2 fold change. To elucidate the functional significance of PPP1R15A in AML cell viability and chemotherapy response, experiments involving PPP1R15A silencing using siRNA in MOLM-13 and KASUMI-1 cell lines were conducted. Initially, the efficiency of PPP1R15A silencing by qPCR was assessed by comparing the expression levels to cells transfected with a scramble sequence. Furthermore, cell viability comparisons between PPP1R15A-silenced and mock control cells were made after treatment with Cytarabine and Idarubicin at IC50 concentrations for 24 and 48 hours. For this purpose, GADPH, HRPT1, and B2M were used as reference genes.
Gene expression profiling through PCR arrays analysis (Qiagen RT² Profiler PCR Array (96-Well Format and 384-Well [4 x 96] Format) Human DNA Damage Signaling Pathway) was performed in triplicate after RNA extraction from untreated, chemotherapy-treated, and live cells following chemotherapy exposure. Human DNA damage signaling pathway-related gene expression was evaluated and analyzed through the RT2 Profiler PCR Array data analysis tool (Rotor-Gene_2_3_5_1) and Fold Change values per condition were calculated using the respective untreated sample as control. All the primer sequences that were used from the above experiments are shown in Supplemental Tables S2 and S3.
2.10. CRISPR-Cas9 mediated PPP1R15A deletion
PLKO.1-puro lentiviral vectors expressing CRISPR-associated endonuclease 9 (Cas9) and two different single guide RNAs (sgRNAs) targeting PPP1R15A (sgRNA1: AGGTCCTGGGAGTATCGTTC, sgRNA2: GGACAACACTCCCGGTGTGA) or scramble RNA (GTGTAGTTCGACCATTCGTG) as control purchased from VectorBuilder were transfected into HEK-293FT cells [11]. TF-1 cells were transduced with lentiviruses and selected with puromycin (2µg/ml). Subsequently, single-cell cloning was done, and clones were screened by performing qPCR to select PPP1R15A deleted clones.
2.11. Flow cytometry
KASUMI-1 and MV-4-11 cell sorting was performed using a flow-cytometry-based approach with Annexin V staining. In brief, cultured cells after treatment with either Idarubicin or Cytarabine, washed with ice-cold phosphate-buffered saline (PBS) and resuspended in binding buffer (10 mM HEPES, 140 mM NaCl, 2.5 mM CaCl2, pH 7.4). Subsequently, cells were stained with Annexin V-FITC (fluorescein isothiocyanate) according to the manufacturer's instructions (BD Biosciences Annexin V-FITC Apoptosis Detection Kit). Sorting gates were established based on the Annexin V-FITC signal intensity and FSC/SSC characteristics to isolate the viable cell population. The entire sorting process was conducted at 4°C. TF-1 cells were fixed in 4% formaldehyde for 15 minutes and permeabilized in 100% methanol for 30 minutes. Subsequently, cells were labeled with the phycoerythrin (PE) conjugated PPP1R15A antibody purchased from Santa Cruz (sc-373815). Gating was based on clearly distinguishable populations, or in the absence of such, the negative antibody control. Median fluorescence intensity (MFI) was determined for each marker using FlowJo analysis software version 10.0.8 (FlowJo, Ashland, CO, USA).
2.12. Statistical Analysis
To visualize the relative response profile of each cell treatment in the KASUMI-1 and MV4-11 cells, Principal Component analysis (PCA) was performed using the gene expression (2−ΔCt) of all 84 DDR genes from the Qiagen’s RT2 Profiler PCR Array. For differential gene expression in patient and control samples, statistical analysis was performed using the Kruskal-Wallis test and Dunn’s test for pairwise multiple comparisons, with a significance level of p < 0.05. Correlation analysis was performed using Spearman’s Rho and survival analysis was performed using the Kaplan-Meier method and the log-rank test. Statistical analysis was performed using STATA 17 software.