Sample collection
The specimens of P. ferruginea used to test the methodology were collected from different deposits in Gibraltar that were ascribed (based on excavation stratigraphy and typology of associated artefacts) to the following periods: Medieval, Punic and Middle Palaeolithic. Table 1provides details of the three samples, collected and curated by the team from the Gibraltar National Museum.
Table 1
Details of the samples collected from archaeological sites.
Specimen Identifier | Location | Period | Approximate Date |
PG' 05/C1/UE/13 | Puerta de Granada, Old Town | Medieval | 14th Century AC |
GOR'03/A13/ N1 | Gorham’s Cave, East Side | Punic | 8th -3rd Century BC |
VAN'98 941 | Vanguard Cave, East Side | Middle Palaeolithic | > 35kya |
Additionally, two specimens were collected from the shore to compare both sources of genetic material (archaeological vs. actual).
DNA Extraction and PCR
Approximately 1–2 g of Patella ferruginea shell was powdered using a Braun Mikrodismembrator U (B.Braun Biotech International, Germany) in a sterile steel canister using tungsten ball bearings. The powder was then transferred to a 15 ml tube (Eppendorf, U.S.A) containing 12 ml of extraction buffer (Bulat et al. 2000). The extraction buffer consists of Tris-HCl (20 mM pH8.0), sodium dodecyl sulphate (SDS, 1%w/v), dithiothreitol (DTT, 10 mM), proteinase K (2% w/v), and 0.5 M ethylene diaminetetraacetic acid (EDTA, Sigma, UK). Samples were then rotated for 72 h at 55°C.
The samples were then centrifuged (5 min at 6000rpm) and the supernatant decanted into an Amicon Ultra-30 centrifugal filter (Millipore) in order to reduce the volume to approximately 1 ml. 5 ml of PB Buffer (Qiagen) is then added to the extract, which is then placed in a QIAquick tube, and the extract cleaned following the Qiagen QIAquick PCR purification protocol.
Two primers (Table 2) were designed based on published data (Espinosa and Ozawa. 2006) to amplify short sequences that contain diagnostic polymorphisms, allowing the discrimination of amplicons pairs into haplotypes. PCR amplifications (25 µl total volume) used Platinum Taq High-Fidelity polymerase (1.25 U, Invitrogen, UK), 1x buffer (Invitrogen), bovine serum albumin (BSA, 1mg/ml, Sigma), MgSO4 (2 mM) 2'-deoxynucleotide 5'-triphosphate mix (25 mM), extract (1–5 µl), and forward (F) and reverse primers (R) (1 µM) (Table 2). PCR was carried out using an MJ Research PTC 225 Tetrad thermal cycler (Bio-Rad, U.S.A) with an annealing temperature of 55°C and for 50 cycles. Experiments also incorporated negative controls.
PCR products (5 µl) were electrophoresed on agarose gel (2%, Sigma-Aldrich, UK), stained with ethidium bromide and viewed under shortwave UV light (BioRad Gel Doc 2000). As a comparative standard φX174 DNA/HaeIII ladder (Promega, UK) was also loaded alongside PCRs. Following successful amplification, the products were then purified for sequencing and cloning.
PCR products were cloned using the TOPO TA Cloning kit (Invitrogen) with TOP10F´ competent Escherichia coli cells and cloned product sequenced using ABI BigDye terminator v3.1 cycle sequencing kit (Applied Biosystems, U.S.A).
All sequences obtained were aligned against COI sequences previously described in other studies for the species available in GenBank (Sá-Pinto et al. 2008; Espinosa and Ozawa 2006; Casu et al. 2011) using the software CLUSTAL W multiple alignment tool in BIOEDIT 7.0.5.2 (Hall 1999).
Table 2
Sequence of the primers used for amplifying the DNA obtained from shells.
Primer | Sequence (5´-3´) | Annealing Temp (°C) | Amplicon Length (base pairs) |
Patella COI F1 | TTCTCCTAGCCAGAAGAGCT | 55 | 109 |
Patella COI R1 | GCTCCTAGAATTGAAGAGGCA | | |
Patella COI F2 | TACTCTTATCTTTGCCTGTTCT | 55 | 62 |
Patella COI R2 | GACAGGATCACCTCCTCCT | | |