Mice
C57BL6/J mice were used as transplant recipients. All mice were aged 6–16 weeks, and were bred and maintained in the animal care facilities at the National Cancer Center. All animal experiments were performed in accordance with protocols approved by the National Cancer Center Animal Ethics Committee.
Cell culture
KLS cells and mouse leukemia cells were cultured in StemPro-34 SFM medium (Gibco, Grand Island, NY, USA) supplemented with 10 ng/ml IL3, 50 ng/ml SCF, 10 ng/ml Oncostatin M, 2.5% nutrients, 0.1% tylosin, and 1% L-glutamine-penicillin-streptomycin. 293FT cells, U2OS cells and Plat-E cells were cultured as described previously [12]. Home-made medium without serine and glycine was comprised as shown in Table 1.
Cell isolation
Bone marrow cells were suspended in PBS. Red blood cells were lysed using RBC lysis buffer (eBioscience, Carlsbad, CA, USA) before staining. C-kit-positive cells were enriched by staining whole bone marrow with anti-CD117/c-kit microbeads and isolating positively-labeled cells on a MACS column (Miltenyi Biotec, Bergisch Gladbach, Germany). Antibodies specific for the following were used to identify c-kit-positive, Lineage-negative, and Sca-1-positive cells as KLS cells: CD3ε, Gr1, CD11b/Mac1, Ter119, and B220 (all for Lineage), CD117/c-kit, and Sca1. All antibodies were purchased from BD Pharmingen or eBioscience. Cell sorting and analysis were done on a JSAN cytometer, and the data were analyzed using FlowJo software. Murine NUP98-DDX10 leukemia cells were sorted from whole bone marrow using an anti-CD2 antibody (eBioscience).
Retroviral constructs and production
Deletion mutants of NUP98-DDX10 were generated by PCR and inserted into the MSCVneo plasmid. pMYs-ires-CD2 was generated from pMYs-ires-GFP. NUP98-DDX10 or NUP98-DDX10 ID, cut from the MSCVneo backbone plasmid, was inserted into pMYs-ires-CD2. shRNAs targeting Aatf, Ngdn, Nol10, and Phgdh, as well as the shCtrl control, were designed and cloned into pMKO.1-GFP (a gift from William Hahn; Addgene plasmid # 10676) using the DNA oligomers as shown in Table 2. Plat-E cells were transfected with the viral constructs, and supernatants containing the retrovirus were collected 48 h later. shRNA specific for human NOL10 was designed and cloned into the pLV-hU6-EF1a-green backbone (Biosettia, San Diego, CA, USA) using the following DNA oligomer; AAAAGGTGTTCCTTCTTAGACAATTGGATCCAATTGTCTAAGAAGGAACACC, according to the manufacturer’s protocol. shCtrl was cloned using the following DNA oligomer; AAAAAAATCGCTGATTTGTGTAGTCTTGGATCCAAGACTACACAAATCAGCGATTT.
Serial replating assay
C-kit + cells were transduced with retroviruses using RetroNectin (Takara, Shiga, Japan), as described previously [8]. The cells were cultured and replated every 4 days in methylcellulose medium containing G418 (for the first and second rounds of selection). Colony numbers were counted for the second to fifth rounds.
Transplantation
KLS cells were retrovirally transduced with NUP98-DDX10-ires-CD2 or NUP98-DDX10 ID-ires-CD2. CD2-positive cells were sorted 48 h after infection. The sorted cells were transplanted into sub-lethally irradiated (6 Gy) C57BL/6 mice. Primary mouse NUP98-DDX10 leukemia cells were retrovirally infected with shCtrl or shNol10. GFP-positive and CD2-positive cells were sorted 24 h after infection. Sorted cells were transplanted into sub-lethally irradiated (6 Gy) C57BL/6 mice.
LC/MS/MS
293FT cells were transfected with MSCV-FLAG-NUP98-DDX10, or MSCV-FLAG-NUP98-DDX10 ID, each in duplicate, and lysed as described previously [12]. Immunoprecipitates were trypsinized. Tryptic peptides were labeled with TMT isobaric mass tags (Thermo Fisher Scientific, Rockford, IL, USA) according to the manufacturer’s instructions. Peptides from NUP98-DDX10 transfectants were labeled with TMT-126 and − 129, and those from NUP98-DDX10 ID with TMT-127 and − 130, followed by tandem mass spectrometry identification. Tandem mass spectrometry (MS/MS) analysis was performed on an Orbitrap Fusion mass spectrometry (Thermo Fisher Scientific). To identify differentially binding proteins, we used the reporter ion signal intensity of peptide sequence. First, the reporter ion signal intensity value of each DDX10 peptide from each preparation was divided by the corresponding value from the TMT-126 preparation, followed by calculating the average of quotients. Then, intensity values of all the identified peptides were divided by the mean value calculated above to normalize sample-to-sample valuations. A protein was selected as the potential partner of NUP98-DDX10 which interacts with NUP98-DDX10 via the ID region if the average normalized value of peptide derived from the protein in two NUP98-DDX10 ID preparations was less than half of that in two NUP98-DDX10 preparation.
Immunoprecipitation and Western blot analysis
Immunoprecipitation and Western blot analysis were performed as described previously [12]. Anti-FLAG antibody (SIGMA, St. Louis, MO, USA), anti-HA antibody (Roche, Mannheim, Germany), anti-NGDN antibody (Proteintech, Rosemont, IL, USA), or anti-NOL10 (Bethyl, Montgomery, TX, USA) was used as the primary antibody.
Immunofluorescence analysis
Transfected U2OS cells were fixed in 4% formaldehyde/PBS, and incubated for 1 h in blocking buffer (10% FCS, 5% BSA, and 0.1% Triton X-100 in PBS). Cells were then incubated for 12 h at 4°C with an anti-FLAG antibody (SIGMA) and an anti-NOL10 antibody (Invitrogen, Rockford, IL, USA), followed by appropriate secondary antibodies. The slides were mounted using ProLong Gold antifade reagent containing DAPI (Invitrogen) and images were captured under a BZ-9000 microscope (KEYENCE, Osaka, Japan).
RNA-seq analysis
Primary mouse NUP98-DDX10 leukemia cells were retrovirally infected with shCtrl or shNol10, and GFP-positive and CD2-positive cells were sorted 48 h later. RNA was purified from the sorted cells using a RNeasy Plus Micro Kit (Qiagen, Hilden, Germany). Library preparation and sequencing was conducted by Azenta (Burlington, MA, USA). RNA-seq data were analyzed by DEseq2 using Galaxy. Metascape and STRING were used for network analysis of genes regulated by NOL10.
RT-PCR
Isolated RNA was reverse transcribed to cDNA using Superscript IV VILO (Invitrogen). Quantitative real-time PCR was performed using TaqMan Gene Expression Assays or FastStart Universal SYBR Green Master Mix (Roche), along with gene-specific primers (see Table 3). All real-time expression data were normalized to expression of Tbp or B2m.
RIP assay
Transfected 293FT cells were harvested and suspended in PBS. One volume of nuclear isolation buffer (40 mM Tris-HCl (pH 7.5), 1.28 M sucrose, 20 mM MgCl2, and 4% Triton X-100), and three volumes of water, were added to the cell suspension to make a nuclear extract. The extract was resuspended in RIP buffer (25 mM Tris-HCl (pH 7.5), 150 mM KCl, 5 mM EDTA, 0.5 mM DTT, 0.5% NP40, 100 U/ml SUPERase In RNase inhibitor (Invitrogen), and protease inhibitor cocktail (cOmplete, Roche)) and sheared using an S220 apparatus (Covaris, Woburn, MA, USA). The NUP98-DDX10 complex or NUP98-DDX10 ID complex was immunoprecipitated using anti-FLAG antibody. RNA was purified from the immunoprecipitates using Isogen (Nippon gene, Tokyo, Japan) and the RNA Clean & Concentrator-5 with DNase kit (Zymo Research, Irvine, CA, USA). Finally, purified RNA was reverse transcribed to cDNA as described above.
Statistical analysis
Statistical analyses were carried out using GraphPad Prism software version 9 (GraphPad Software Inc., Boston, MA, USA) or Microsoft Excel for Mac version 16 (Microsoft, Redmond, WA, USA). Data are shown as the mean ± SEM. Two-tailed unpaired Student’s t tests were used to statistical significance (*p < 0.05, **p < 0.01, ***p < 0.001).