Bioinformatics analysis
The mRNA level of SHCBP1 between ovarian cancer and normal tissues was retrieved from the GEPIA database and three datasets (GSE10971, GSE12470, GSE36668) from the GEO database. The mRNA expression of SHCBP1 in cisplatin A2780 cells was analyzed from GSE15709. The Kaplan–Meier plotter database was used to analyze survival of ovarian cancer patients based on SHCBP1 expression.
Patients and tissue samples
All tissue samples used in the study were collected from Qilu Hospital, Shandong University. Written informed consent and ethical approval were obtained before the research. The HGSOC samples were from patients diagnosed with primary HGSOC and received surgery as initial treatment. The fallopian tube (FT) specimens were from patients with benign gynecologic tumors and were performed salpingo-oophorectomy.
Cell lines and cell culture
A2780 cell lines, a kind gift from Jianjun Wei's Laboratory were cultured in RPMI 1640 with 10% fetal bovine serum (FBS); HEK293T cells, purchased from the Chinese Academy of Sciences (Shanghai, China), were maintained in Dulbecco’s modified Eagle’s medium (DMEM) with 10% FBS. SKOV3 cells were obtained from American Type Culture Collection (ATCC, Manassas, VA, USA) and cultured in DMEM with 10% FBS. The environment used to culture cells was 37°C with 5% CO2.
Cell culture reagents
CDDP (PHR1624) and CQ (C6628) were obtained from Sigma-Aldrich (St. Louis, MO, USA).SC79 (S7863), MK2206(S1078) and Rapamycin (S1039) were purchased from Selleck Chemicals (Houston, TX, USA).
RNA isolation and RT-qPCR
We extracted total RNA from tissues and cells with TRIzol reagent (15596018, Invitrogen) and reversed to cDNA using the PrimeScript RT Reagent Kit (RR037A, TaKaRa, Kyoto, Japan). RT-qPCR was carried out with SYBR Premix Ex Taq (RR420A, TaKaRa) on the 7900HT Fast Real-Time PCR System (Applied Biosystems, Waltham, MA, USA). We used the comparative Ct method (2−ΔΔCt) to calculate the relative mRNA expression of SHCBP1 and β-actin was applied to be endogenous control. The primer sequences used in the study were as follows: SHCBP1 forward primer: TGGAGAAGGTCCTTGAGCCATC; reverse primer: CAGAGGTATGGTTCAGCAAGCC; and β-actin forward primer: CACCATTGGCAATGAGCGGTTC; reverse primer: AGGTCTTTGCGGATGTCCACGT.
Protein extraction and Western blotting
The procedure of total protein lysates preparation and western blot analysis were conducted as described previously(19). The primary antibodies used were as follows: SHCBP1 (1:1000, Proteintech, 12672-1-AP), tubulin (1:5000, Proteintech, 11224-1-AP), PARP (1:1000, Proteintech, 13371-1-AP), BAX (1:1000, Abcam, ab32503), p-Akt (1:1000, Abcam, ab81283), Akt (1:1000, Proteintech, 60203-2-Ig), p-mTOR (1:1000, CST, 5536T), mTOR (1:1000, Servicebio, GB11405), LC3B (1:1000, Abcam, ab192890).
IHC
The operating steps of Immunohistochemical (IHC) staining was performed as recorded before (19).
siRNA transfection
The specific siRNA sequences were synthesized by GenePharma (Shanghai, China) and transfected to cells with Lipofectamine 2000 (11668-019, Invitrogen) according to the operating instruction.
The sequences of specific siRNA were as follows:
siSHCBP1 1#: 5’- GAGCCUAUCAAGAUUACAUTT − 3’;
siSHCBP1 2#: 5’- ACCGUGAUAAACCAGGUUCTT-3’;
siNC: 5’-UUCUCCGAACGUGUCACGUTT-3’;
Stable cell lines establishment
SHCBP1 over-expression plasmid, knockdown plasmid and their corresponding control vectors were acquired from GeneChem (Shanghai, China). The lentivirus was produced by HEK293T cells co-transfected with psPAX2, pMD2.G and PLKO.1/shSHCBP1 or PCMV/SHCBP1. Then, the lentivirus was added to A2780 and SKOV3 cells at appropriate confluence for 24 h. Cells with SHCBP1 stable over-expression or knockdown were established following 2 µg/ml puromycin (Merck Millipore, USA) treatment for 7 days.
Cell viability assay
The cell proliferation between SHCBP1 over-expression and control group (or SHCBP1 knockdown and corresponding control group) was detected by MTT assay as described (19).
To determine relative cell viability under CDDP treatment, 3000 cells from each group were plated into each well of 96-well plates. Then, different concentrations of CDDP (0, 2, 4, 6 and 8 µg/ml) were added and incubated for 48 h. Finally, the relative cell viability was measured by MTT assay.
Colony formation assay
For proliferation, cells from SHCBP1 over-expression and control group (or SHCBP1 knockdown and corresponding control group) were seeded into 6-well plates at density of 1000 cells/well and cultured for 12 days. After fixing with methanol and staining with 0.5% crystal violet, colonies containing more than 50 cells were counted.
For cytotoxic effect assay, A2780 and SKOV3 cells were seeded into 6-well plates at density of 1200 cells/well. Different concentrations of CDDP (0, 1, 2 µg/ml for A2780 cells and 0, 2, 4 µg/ml for SKOV3 cells) were added when each clone contained about 50 cells. We captured images and counted clones of each well in the plate after 48 h incubation with CDDP.
Flow cytometry assay for apoptosis
A2780 and SKOV3 cells with SHCBP1 depletion or not were seeded in 6 cm culture dish and treated with 2 µg/ml CDDP alone or combined with CQ for 48 h. Then, cells were collected, stained with FITC Annexin V (25 min) and PI (15 min) in the dark at room temperature. A flow cytometer (FACSCalibur, BD, USA) and FlowJo X 10.0.7 R2 software was used to detect and analyze cells among different groups, respectively.
Immunofluorescence assay
A2780 and SKOV3 cells with SHCBP1 depletion or not were seeded on 24 coverslips. After 24 h, 4% paraformaldehyde and normal goat serum were used to fix cells and block heterogenetic antigen, respectively. Then, LC3B antibody (1:100; Abcam, ab192890) was added and incubated overnight at 4°C. The donkey anti-rabbit IgG Alexa Fluor-488 secondary antibody (1:150; Invitrogen, Waltham, MA, USA) was added for another 1 h incubation. Finally, DAPI antibody was applied to stain the nuclei and a Zeiss LSM 780 (Carl Zeiss, Jena, Germany) was employed to photograph cells.
Tumor formation assay in nude mice
The ethical committee of the Shandong University Animal Care and Use Committee approved all animal experiments. Female athymic BALB/c nude mice (5 weeks old), purchased from NBRI of Nanjing University, were fed in a pathogen-free facility. A2780 cells (about 5×106) transfected with PLKO.NC and shSHCBP1 were harvested, washed, and resuspended with 150 µl PBS and were subcutaneously injected into the left armpit of each mouse. The tumor volumes were measured every two days and when the tumor volume reached about 50 mm3, each group was randomly splited into two subgroups and treated with or without 2 mg/kg CDDP. Fourteen days posttreatment of CDDP, the tumors were separated and analyzed.
Statistical analysis
All experiments were repeated at least 3 times independently. The data are expressed as the means ± SEMs. GraphPad Prism 8.00 (GraphPad Software, La Jolla, CA, USA) and Adobe Photoshop CC 2019 (Adobe, San Jose, CA, USA) were used to process the data and images. Significance between two and more than two groups was performed by SPSS v22.0 (SPSS, Inc., Chicago, IL, USA) through Student’s t test and oneway ANOVA, respectively. P < 0.05 was considered statistically significant (#p > 0.05, *p < 0.05, **p < 0.01, ***p < 0.001).