Restoring Colon Motility in Parkinson's Disease: GDNF-Mediated CX43 Suppression in Reactive Enteric Glial Cells

doi:10.21203/rs.3.rs-3913140/v1

Download PDF

Research Article

Restoring Colon Motility in Parkinson's Disease: GDNF-Mediated CX43 Suppression in Reactive Enteric Glial Cells

https://doi.org/10.21203/rs.3.rs-3913140/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background:Constipation is most common in patients with Parkinson's disease (PD) and is usually caused by slow colon movement. Intestinal glial cells (EGCs) play a role in the regulation of intestinal inflammation and movement, and their activation can trigger the death of intestinal neurons, which may be mediated by the activation of the connexin 43 (CX43) semi-channel. GDNF plays an important role in maintaining intestinal movement and inhibiting inflammation. This study investigated whether GDNF plays an inhibitory role in the activation of EGCs by inflammation, and promotes neuronal survival and regulates intestinal motility through the EGCS-CX43 pathway.

Methods: PD model was established by unilateral stereotaxic injection of 6-hydroxydopamine. At the 5th week after injury, AAV5-GDNF (2~5×1011) was intraperitoneally injected into experimental and control rats. Fecal moisture percentage (FMP) and toner propulsion rate (CPPR) were used to evaluate colon motion. Colon-related markers were detected at 5 and 10 weeks after induction.

Results:Colonic motility and GDNF expression decreased, EGCs reactivity, IL-1, IL-6, TNF-α expression increased, CX43 up-regulated, PGP 9.5 decreased. Intraperitoneal injection of AAV-GDNF can protect colon neurons by inhibiting EGCs activation and down-regulating CX43.

Conclusion: GDNF may promote the survival of colonic neurons in PD rats by regulating CX43 activity.

Parkinson’s disease

Enteric glia cells

Enteric neurons

Reactive glia

CX43

gut motility

Parkinson's Disease (PD) is recognized as the second most prevalent neurodegenerative disorder, primarily characterized by significant degeneration of dopaminergic neurons within the nigrostriatal pathway, a hallmark event that gives rise to the distinctive motor symptoms associated with the condition.[1]. To date, the diagnosis of PD primarily relies on evaluating motor dysfunction. Nonetheless, PD is characterized by a spectrum of non-motor symptoms, with gastrointestinal (GI) motor issues emerging as a prominent concern. Notably, constipation stands out as the most common among these GI dysfunctions. Remarkably, constipation can manifest years before the onset of typical motor symptoms, with individuals experiencing it facing a significantly heightened risk of developing PD.[2]. As a result, the hypothesis suggesting the gastrointestinal system as a potential origin of PD has gained significant traction, leading to extensive discussions regarding the intricate interplay between the gut and the development of PD.[3, 4]. Impaired colonic motility stands as a key factor contributing to the chronic constipation frequently observed in individuals with PD. [5]. Gut motility is intricately regulated by the enteric nervous system (ENS), a complex network comprising enteric neurons (ENS) and glial cells (EGCs). Dysfunctions in motility often result from disruptions in neural communication within this system, stemming from neuronal damage or disturbances in glia-neuron interactions. In recent years, a growing body of evidence has emerged, supporting the idea that EGCs, a unique subgroup of peripheral astroglial cells surrounding ENS, may play a novel role in synucleinopathies associated with PD and contribute to the development of chronic constipation in PD by influencing neural networks and regulating gut motility.[6]. EGCs are pivotal in supporting neural signaling and promoting neuronal survival. In the past, their depletion was considered a potential mechanism underlying enteric neuropathy[7]. However, in the central nervous system (CNS), emerging data suggest that the primary driver of neurodegeneration during neuroinflammation is chronic astrocyte activation, a phenomenon known as reactive gliosis, rather than the loss of glial cells[8]. Similarly, in the ENS, recent research has highlighted the critical role of EGCs activation as a primary mechanism in the development of enteric neuropathy. Furthermore, studies have revealed that EGCs activation alone is sufficient to trigger enteric neuron death, a process mediated by the activation of connexin-43 (CX43) hemichannels, leading to subsequent release of ATP[9]. In this context, neurotoxic CX43 activity is necessary for active EGCs-mediated neuron demise.

EGCs activation was clearly found in colon mucosal and submucosal in patients with PD[10]. It is believed that pro-inflammatory stimuli in the gut can trigger this pathological process, leading to the release of pro-inflammatory cytokines (tumor necrosis factor-α (TNF), interleukin-1β (IL-1β), and interleukin-6(IL-6) in response to cellular threats [11]. However, the role of reactive EGCs in promoting neuronal damage through the potentially toxic activity of CX43 and its subsequent impact on constipation or sluggish colonic motility in the context of PD has not been thoroughly investigated. One key factor in the ENS is glial cell-derived neurotrophic factor (GDNF), which was initially thought to be primarily secreted by EGCs. GDNF plays a crucial role in maintaining gut motility, and its absence in experimental models can lead to aganglionosis, resulting in severe intestinal motility issues and obstruction [12]. Additionally, GDNF exhibits anti-inflammatory properties, suppressing mucosal inflammatory responses in colitis [13] and inhibiting the production of inflammatory cytokines in response to IL-17 in human corneal epithelium[14]. In inflamed environments, EGCs release GDNF to down-regulate pro-inflammatory cytokines like TNF-α and IL-1β[15]. Furthermore, our previous clinical investigation identified a significant reduction in serum GDNF levels as an associated risk factor for constipation in a cohort of 128 PD patients[16], However, the precise underlying mechanism behind this phenomenon remains to be elucidated.

In light of these observations, we hypothesized that in PD, reactive EGCs contribute to neuronal damage through the potentially harmful activity of CX43, resulting in constipation and slow colonic motility. Simultaneously, we postulated that GDNF may exert an inhibitory effect on EGCs activation during inflammation, thereby promoting the survival of enteric neurons and regulating gut motility via the EGCs-CX43 pathway.

To test our hypothesis, we employed a PD rat model created by stereotactic injection of 6-OHDA. Our data confirmed that PD rats exhibited reduced colon motility, decreased colon GDNF expression, and the presence of reactive EGCs. Additionally, we observed pronounced colon inflammation, up-regulated CX43 expression, and neuronal loss in these rats. Significantly, our findings demonstrated that intraperitoneal administration of AAV-GDNF could protect colon neurons, enhance colon motility, and achieve these effects by suppressing EGCs activation and downregulating CX43 activity.

In summary, our results suggest that GDNF may promote the survival of colon neurons in PD rats by modulating CX43 activity. This offers a promising therapeutic avenue for addressing PD-associated constipation.

Animals and groups

The experiments were performed in accordance with the Guidance Suggestions for the Care and Use of Laboratory Animals, formulated by the Ministry of Science and Technology of China, and the study was approved by the Ethical Committee of Shanghai 4th people’s hospital, Affiliated to Tongji University.

Male healthy Sprague-Dawley rats, with a body weight ranging from 200 to 250g, were maintained on a standard diet with 12-hour day and night cycles. Rats that underwent surgical treatment with 6-OHDA and exhibited a positive response in the apomorphine (APO) test were selected as the Parkinson's Disease (PD) rat model. Rats that received surgical treatment with an equivalent volume of 0.9% sodium chloride solution (0.9% NaCl) were designated as the control group or sham-operated rats. Five weeks after the surgical procedure, the PD rats were intraperitoneally administered with adenovirus overexpressing GDNF (AAV-GDNF), adenovirus without GDNF overexpression (AAV-0), or an equal volume of 0.9% normal saline (NS). Consequently, the PD rats subjected to these interventions were categorized into three groups: PD-AAV-GDNF group, PD-AAV-0 group, and PD-NS group. Sham-operated rats received an intervention involving 0.9% NaCl and were denoted as the Sham-0.9% NaCl group.

Establishment of PD rat models

Unilateral 6-hydroxydopamine injection

After one week of acclimatization to the feeding environment, male healthy Sprague-Dawley rats weighing between 200 and 250 grams were subjected to surgical procedures and pharmacological intervention to induce nigrostriatal denervation, following a previously reported method (Qin et al., 2012). Prior to treatment, the postural asymmetry test was conducted to exclude rats displaying unstable behavioral responses.

In brief, rats were anesthetized via intraperitoneal injection of 3.6% Pentobarbital sodium. They were then secured on a stereotaxic frame (KOPF Company, Hamburg, Germany) and unilaterally administered with either 6-OHDA or an equal volume of 0.9% NaCl at two distinct sites within the right medial forebrain bundle (MFB). The coordinates for these injections, relative to bregma, were as follows (in mm): right 2.5 mm; posterior 1.8 mm; depth 7.5 mm, and right 2.5 mm; posterior 1.8 mm; depth 8.0 mm, according to the Stereotaxic Atlas of Rat Brain. [38]. The injection was carried out at a rate of 1 µL per minute using a Hamilton 10 µL syringe equipped with a 26-gauge needle. Following the injection, the needle was left in place for 5 minutes to prevent any potential leakage. Subsequently, the wounds were closed, and the animals were allowed to regain consciousness and commence their recovery process.

Apomorphine (Apo)-induced rotational behavior test

Apomorphine (Apo)-induced rotational behavior tests (Apo-RBT) were conducted after a 4-week post-lesion period. The rats were situated in a tranquil setting and subsequently administered apomorphine (0.5 mg/kg, diluted in 0.9% saline) via injection. Rats exhibiting a minimum of 210 rotational turns within a 30-minute timeframe were considered to be successful PD models (PD-rats) and were subsequently chosen for further experimentation.

Brain Tyrosine hydroxylase expression

PD rats were euthanized. Midbrain specimens were dissected, weighed and homogenized in lysis buffer PMSF：RIPA (1:100). Homogenates were centrifugated at 12,000 rpm for 30 min at 4 °C, and the supernatants were stored at −80 °C. TH Protein concentration was determined by the Bicinchoninic Acid (BCA) method (Protein Assay Kit; Beyotime Biotechnology, Shanghai, China). Western blot analysis of TH was performed following the introduction below.

Brain Immunofluorescence

PD rats were euthanized. Being perfuse fixation, rats’ midbrain was dissected, immediately frozen and processed for serial cryostatic sections (20μm) (Histostar, Leica, German). 2 slices in every 3 slices of the target area were kept for immunohistochemical staining for tyrosine hydroxylase (TH).

Construction and Intraperitoneal injection of AAV-GDNF

Overexpression of GDNF using Recombinant Adenovirus encoding GDNF (AAV-GDNF) were designed and constructed by Shanghai Genechem Co., Ltd. The GDNF primer sequence was forward 5′-GGAGGTAGTGGAATGGATCCCGCCACCATGAAGTTATGGGATGTCGTG-3′ and reverse 5′-TCACCATGGTGGCGGGATCGATACATCCACACCGTTTAGCGG-3′. The viral titers of AAV5-Gdnf (60293-1) were 1.0×10¹² v.g./ml. AAV5-GDNF stocks were diluted immediately before use to equivalent titers of 2~5×10¹¹ vector genomes/ml in phosphate-buffered saline with 0.001% (vol/vol) Pluronic F-68.

PD rats were intraperitoneally injected with AAV5-GDNF (2~5×10¹¹) 5 weeks post 6-OHDA lesion. The injection site located on the left or right of the abdominal line alba. Further experimental data were collected 4weeks after intraperitoneal injection.

ID	Titer（v.g./ml）
AAV5-Gdnf(60293-1)	7.72E+13

Assessment of Colon motility

Fecal moisture percentage (FMP)

At noon on the 1st, 2nd, 3rd, 4th, and 5th weeks after injection, 6-OHDA-operrated rats (n=6) and sham-operated rats (n=6) were placed in clean cages separately, freely taking water and diet. Feces were collected 2 hours later. Wet weight was weighed in the electronic balance, and dry weight was weighed after baking in the oven at 60℃ for 6h, so as to calculate the fecal moisture percentage (FMP): FMP (%) = (wet weight of feces - dry weight of feces)/wet weight of feces ×100%.

At noon on the 1st, 2nd, 3rd, 4th, and 5th weeks after animals were intraperitoneally injected with AAV-GDNF, AAV-0-GDNF, or 0.9%NaCl, FMP was also detected according to the above process.

Carbon powder propulsion ratio (CPPR)

Carbon powder propulsion ratio (CPPR) was assessed five weeks following the APO test. A 5% activated carbon suspension was prepared for this purpose. After a 12-hour fasting period, PD rats (n=6) and sham-operated rats (n=6) received intragastric administration of the 5% carbon powder solution (1ml per rat). Two hours later, the rats were euthanized by neck dislocation, and the entire intestine, from the gastric pylorus to the anus, was rapidly excised. The total length of the intestine and the distance the carbon had traveled within the intestine were measured. The CPPR was then calculated using the formula: CPPR (%) = (carbon pulling length / intestine length) × 100%.

Five weeks after the animals had received intraperitoneal injections of equal volumes of AAV-GDNF, AAV-0, or 0.9%NaCl, CPPR was assessed following the same procedure.

Hematoxylin-Eosin（HE）staining

After rats were sacrificed, the target colon specimens (about 5-6 cm from 1cm at the posterior end of ileocecum) were quickly dissected, carefully cleaned in pre-cooled PBS, and fixed in 4% paraformaldehyde solution overnight for 48h. They were dehydrated with ethanol gradients and then embedded in paraffin and processed for serial cryostatic sections (3 μm) (Histostar, Leica, German). In particular, the paraffin sections were subjected to routine dewaxing, followed by staining with hematoxylin for 1 minute. They were then differentiated for 2 seconds in an ethanol hydrochloride solution and rinsed with running water to achieve a clear blue appearance. Following this, the sections were stained with eosin for 2 minutes, rinsed with running water, washed with ddH2O, and air-dried. Finally, the slides were mounted with neutral gum to facilitate microscopic examination.

Western Blot analysis

Colon specimens were quickly dissected (6 cm of length, 1 cm from the posterior end of the ileocecal junction), weighed and homogenized in lysis buffer PMSF:RIPA (1:100). Homogenates were centrifugated at 12,000 rpm for 30 min at 4 °C, and the supernatants were stored at −80 °C. Protein concentration of IL-1, IL-6, TNF-α, GDNF, Glial fibrillary acidic protein （GFAP，a marker for EGCs）, CX43, and Ubiquitin carboxyl-terminal hydrolase（PGP 9.5, a marker for ENS） was detected by Bicinchoninic Acid (BCA) method (Protein Assay Kit; Beyotime Biotechnology, Shanghai, China). To perform western blot analysis of GDNF, GFAP, CX43, and PGP 9.5, protein lysates were separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE loading buffer, Beyotime Biotechnology, Shanghai, China), and electrotransfered (Constant current: 300mA, Time: protein molecular weight+20min) to nitrocellulose(NC) membrane. The blots were then blocked 2h with 5% non-fat milk in PBS and incubated overnight with primary antibodies at 4°C in a Chromatography experiments freezer. After washings with washing buffer, horseradish peroxidase-conjugated secondary antibodies (see Table 1) were added for 2h on a slow shaker at room temperature in dark. After washings with washing buffer, Odyssey dual-color infrared laser imaging scanner was used to scan for imaging. The protein bands were analyzed by Image J software. To ensure equal sample loading, blots were stripped and reprobed for β-actin determination by a specific primary antibody (see Table 1). The relative amount of protein was measured by the ratio of target band to reference band, and the statistical analysis and mapping were performed in Graphpad software.

Table1. Primary and secondary antibodies and reagents employed in the study

Primary antibodies	species	source	Item No
anti-TH	mouse	Cell Signaling Technology, US	45648
anti-GDNF	mouse	Santa Cruz Biotechnology, US	sc-13147
anti-GFAP	rabbit	Abcam, Cambridge, UK	ab68428
anti-IL-1β	mouse	Santa Cruz Biotechnology, US	sc-12742
anti-IL-6	mouse	Santa Cruz Biotechnology, US	sc-57315
anti-TNF-α	mouse	Santa Cruz Biotechnology, US	sc-8436
anti-Cx43	mouse	Santa Cruz Biotechnology, US	sc-271837
anti-PGP 9.5	mouse	Santa Cruz Biotechnology, US	sc-271639
anti-β-actin	mouse	Proteintech, US	66009-1-Ig
Secondary antibodies and reagents
Alexa Fluor® 594 Goat anti-mouse fluorescent secondary antibody		Life Technologies, US	A-11032
Alexa Fluor® 488 Goat anti-rabbit fluorescent secondary antibody		Life Technologies, US	A-11008
HE staining kit		Beyotime Biotechnology, Shanghai, China	C0105S
Enhanced BCA Protein Assay Kit		Beyotime Biotechnology, Shanghai, China	P0010
Horseradish Peroxidase Color Development Kit (DAB kit)		Beyotime Biotechnology, Shanghai, China	P0203
Trizol		Invitrogen, US	16096020
HiScript® II Q RT SuperMix for real-time PCR		Vazyme Biotech, Nanjing, Jiangsu, China	R222-01
AceQ® qPCR SYBR Green Master Mix		Vazyme Biotech, Nanjing, Jiangsu, China	Q111-02/03

Real Time Polymerase Chain Reaction (RT-PCR)

Total mRNA was isolated from colons using Trizol reagent (Invitrogen, US) following the manufacturer’s protocol. The RNA was reverse-transcribed into cDNA using the Reverse Transcription System (HiScript^® II Q RT SuperMix for real-time PCR, Vazyme Biotech Co., Ltd., Nanjing, Jiangsu, China). Relative mRNA levels were measured using SYBR Green real-time quantitative reverse transcription-PCR (qRT-PCR) (AceQ^® qPCR SYBR Green Master Mix, Vazyme Biotech Co., Ltd., Nanjing, Jiangsu, China) and calculated using the 2-ΔΔCt method. The specific primers were designed by Sangon Biotech (Shanghai, China). All of the index primers are shown in Table 2. All of the RT-PCRs were performed in triplicate.

Table2. Gene-specific primers employed in RT-PCR

Name	species	Sequence（5’-3’）
GFAP	Rat	Forward primer AGAGGAAGGTTGAGTCGCTGGAG Reverse primer AGAGCCGCTGTGAGGTCTGG
GDNF	Rat	Forward primer CGCTGACCAGTGACTCCAATATGC Reverse primer AAGTGCCGCCGCTTGTTTATCTG
TNF-α	Rat	Forward primer ATGGGCTCCCTCTCATCAGTTCC Reverse primer CCTCCGCTTGGTGGTTTGCTAC
IL-6	Rat	Forward primer ACTTCCAGCCAGTTGCCTTCTTG Reverse primer TGGTCTGTTGTGGGTGGTATCCTC
IL-1β	Rat	Forward primer AATCTCACAGCAGCATCTCGACAAG Reverse primer TCCACGGGCAAGACATAGGTAGC
CX43	Rat	Forward primer CCTACTTCAATGGCTGCTCCTCAC Reverse primer GCTTGTTGTAATTGCGGCACGAG
PGP 9.5	Rat	Forward primer CATGAAGCAGACCATCGGGAACTC Reverse primer GGGACAACTTCTCCGTTTCAGACAG
β-actin	Rat	Forward primer GGAGATTACTGCCCTGGCTCCTA Reverse primer GACTCATCGTACTCCTGCTTGCTG

Immunofluorescence

After the rats were euthanized, the targeted colon specimens, approximately 5-6 cm in length, were swiftly dissected, meticulously cleaned using pre-cooled PBS, and subsequently fixed in a 4% paraformaldehyde solution at 4°C overnight. Following this fixation, they underwent a series of dehydration steps, involving immersion in 20%, 30%, and 30% sucrose solutions, and were then stored at -80°C before being embedded in OCT for processing into serial cryostatic sections with a thickness of 15 μm (Histostar, Leica, German). 2 slices in every 3 slices of the target area were kept at -20 ° C for immunohistochemical staining.

Immunofluorescence studies were conducted to identify cellular phenotypes and proliferating cells within the colonic wall. In summary, the sections were rinsed three times with PBS, incubated with a solution containing 0.1% Triton and 3% hydrogen peroxide for 10 minutes, blocked using 10% goat serum for 30 minutes, and then exposed to a diluted primary antibody (anti-TH, anti-GDNF, anti-GFAP, anti-CX43, and anti-PGP9.5, respectively) at 4°C overnight. Afterward, they were treated with the appropriate fluorophore-conjugated secondary antibodies for 2 hours at room temperature, followed by incubation with DAPI for nuclear counterstaining (for reagents, please refer to Table 1). Finally, the sections were examined using a Leica TCS SP8 confocal laser-scanning microscope (Leica Microsystems, Mannheim, Germany) with 40× and 63× oil lenses, enabling detailed analysis.

Statistcs

Data was expressed by Mean ± SE, and SPASS version 22.0 was used for statistical analysis. Two-sample t-test was used for the difference between Two groups, and One-way ANOVA was used for the difference between multiple groups. P < 0.05 was considered as the significance level.

Dopaminergic neurons loss in 6-OHDA lesioned rats

Rats subjected to 6-OHDA treatment displayed a significant reduction in dopaminergic neurons within the Substantia nigra pars compacta (SNc) of the injected hemisphere. Tyrosine hydroxylase (TH), a pivotal rate-limiting enzyme in dopamine (DA) synthesis, serves as a reliable indicator of DA neuron count. In our study, both the TH protein expression and the quantity of TH-positive cells in the lesioned hemisphere (right hemisphere) of PD rats exhibited a substantial decrease in comparison to Sham-operated rats (refer to Fig. 1, Panels A, B, and C). This marked reduction in TH expression and the count of TH-positive cells in the PD rat models affirm the successful construction of our PD rat model.

Colon motility in 6-OHDA PD Rats

The Fecal Moisture Percentage (FMP) in PD rats displayed a marked reduction (refer to Fig. 2, Panel A). Likewise, the carbon powder propulsion ratio exhibited a significant decrease (see Fig. 3, Panels B and C), with statistically significant differences (P < 0.001 and P < 0.01) noted. These results collectively highlight that the 6-OHDA-induced PD rats manifested distinct symptoms indicative of colon motility dysfunction.

Colon Inflammation in 6-OHDA PD Rats

Colon H&E staining

In the sham-operated rats, the colon wall maintained its normal structural integrity. Conversely, in PD rats, the colon wall exhibited a loss of its original integrity and continuity, accompanied by aberrant smooth muscle arrangement, shedding of local epithelial cells, gland atrophy, goblet cell necrosis, capillary hyperemia, and infiltration of inflammatory cells.

mRNA Expression of IL-1β, IL-6, and TNF-α in Colon of 6-OHDA PD Rats

GDNF expression was reduced in colon of 6-OHDA PD Rats

Real-time PCR and Western Blot analyses consistently demonstrated a significant decrease in both total colon GDNF mRNA and protein expression in PD rats (P < 0.01, Fig. 4C). Conversely, total colon CX43 mRNA and protein expression in PD rats were markedly up-regulated (P < 0.01, Fig. 4G), in comparison to the levels observed in sham-operated rats.

GFAP and CX43 expression was increased in colon of 6-OHDA PD Rats

Glial fibrillary acidic protein (GFAP) constitutes a prominent component of glial intermediary filaments, forming the cytoskeletal framework within mature astrocytes. In our study, real-time PCR and Western Blot analyses consistently revealed a significant increase in both colon GFAP mRNA and protein expression in PD rats (P < 0.01, Fig. 4A). This elevation indicates the activation of EGCs following 6-OHDA lesioning.

Immunofluorescence analysis further substantiated these findings, demonstrating a notable rise in the number of GFAP-positive cells in the myenteric plexus of PD rats, characterized by extensive cell branching (Fig. 4D). However, there was no significant difference in the number of GFAP-positive cells in the submucosal plexus between PD rats and sham-operated rats (Fig. 4D). This suggests that EGCs located in the colonic myenteric plexus might be primarily involved in the disease.

Real-time PCR and Western Blot analyses also displayed a substantial increase in both colon CX43 mRNA and protein expression in PD rats (P < 0.01, Fig. 5B&F). These findings strongly indicate the upregulation of CX43, which coincided with the presence of enteric gliosis. Immunofluorescence further revealed that CX43 expression appeared to be more pronounced in the colonic mucosa and submucosa.

(A-C) Total colon mRNA expression of GFAP and CX43 in PD rats was significantly increased compared to sham-operated rats, with **P < 0.01 for both. Meanwhile, mRNA expression of GDNF significantly decreased in PD rats, with ***P < 0.001. (D-G) Total colon protein expression of GFAP and CX43 in PD rats exhibited a significant increase compared to sham-operated rats, with *P < 0.05 for both. Additionally, protein expression of GDNF significantly decreased in PD rats, with **P < 0.01. (H) The number of GFAP-positive cells in PD rats was significantly increased, especially in the myenteric plexus. (I) The number of CX43-positive cells was significantly increased in PD rats (Bar = 200µm). n = 3.

PGP9.5 was Down-regulated in Colon of 6-OHDA PD Rats

PGP9.5 serves as a marker for enteric neurons. In the PD group, there was a significant reduction in both the mRNA level (Fig. 5A) and protein expression (Fig. 5B-C) of PGP9.5 compared to the sham-operated group. These results strongly indicate a considerable loss of enteric neurons in the colon of PD rats.

Identification of adenovirus overexpressing GDNF in colon of PD rats

The AAV-GDNF was meticulously constructed to overexpress GDNF, and it, along with the negative control virus (AAV-0), was administered via intraperitoneal injection to the experimental subjects. Four weeks post-injection, the collective results from real-time PCR, Western blot analyses, and virus infection fluorescence assessments revealed a significant increase in GDNF expression levels within the colon of the AAV-GDNF group. Remarkably, GDNF exhibited robust expression within the mucosal region, confirming the success of the viral infection process (refer to Fig. 6).

GDNF improve colon motility in PD Rats

After a four-week interval following intraperitoneal injection, it was noted that the Fecal Moisture Percentage (FMP) in the PD + AAV-GDNF group displayed a significant increase when compared to the PD + AAV-0 group (*P < 0.05), as illustrated in Fig. 7A. Similarly, the Carbon Powder Propulsion Ratio (CPPR) exhibited a statistically significant elevation (*P < 0.05), as depicted in Fig. 7B-C. In contrast, there were no significant statistical differences between the PD + NaCl group and the PD + AAV-0 group.

GDNF reduced Colon inflammation in PD-C Rats

H&E Staining

In PD + AAV-0 rats, several pathological changes were evident in the colonic mucosa, including partial discontinuity, mucosal abrasion, partial glandular atrophy, disorganization, and an expanded subepithelial space. Furthermore, signs of capillary hyperemia and inflammatory cell infiltration were apparent. In contrast, PD + AAV-GDNF rats exhibited a noticeable enhancement in the integrity and continuity of the colon wall compared to PD + AAV-0 rats. In this group, the mucosa displayed only mild damage, and the villi showed an organized arrangement with fewer infiltrated inflammatory cells. Consequently, based on colon morphological observations, it can be inferred that intraperitoneal injection of AAV-GDNF had a mitigating effect on colon inflammation in the PD group (Fig. 8A).

GDNF reduced IL-1β、IL-6 and TNF-α expression in colon of PD rats

In the PD + AAV-GDNF group, there was a significant reduction in the expression of colon IL-1β, IL-6, and TNF-α mRNA when compared to both the PD + AAV-0 group and the PD-NaCl group (P < 0.01). However, it remained statistically higher than the levels observed in the Sham-NaCl group (P < 0.01). No significant differences were noted between the PD-NS group and the PD + AAV-0 group (Fig. 8B). Furthermore, the protein levels of colon IL-1β and IL-6 exhibited a decrease in the PD + AAV-GDNF group compared to the PD + AAV-0 group (P < 0.05, P < 0.001) (Fig. 8C-D). These results collectively suggest that GDNF has the potential to alleviate colonic inflammation in PD rats (Fig. 8, B-D).

GDNF inhibit Colon EGC activation and CX43 Expression in PD-C Rats

GDNF expression was significantly higher in the PD + AAV-GDNF group compared to the PD + AAV-0 group and PD-NaCl group. However, there was no statistical difference between the PD + AAV-GDNF group and the Sham-NaCl group. Intraperitoneal injection of AAV-GDNF effectively restored colonic GDNF levels to near-normal levels in PD rats (Fig. 9).

GFAP and CX43 expressions in the PD + AAV-GDNF group simultaneously declined compared to the PD + AAV-0 group and PD + NaCl group. However, colon GFAP and CX43 expressions in the PD + AAV-GDNF group remained higher than in the Sham + NaCl group. This suggests that GDNF at normal levels inhibits gliosis and down-regulates CX43 expression but does not fully restore GFAP and CX43 to normal conditions (Fig. 9).

Immunofluorescence analysis revealed the distribution of colonic EGCs in each group. The fluorescence intensity of GFAP in the PD + AAV-GDNF group was significantly reduced compared to the PD + AAV-0 group (P < 0.05). The reduced reactive EGCs were primarily located in the colon muscle layer (Fig. 10A-B). Additionally, the fluorescence intensity of CX43 in the PD + AAV-GDNF group was significantly decreased (P < 0.01). The fluorescence intensity of GFAP in the AAV-GDNF group was still slightly higher than in the Sham-NaCl group, whereas that of CX43 in the AAV-GDNF group was significantly higher than in the Sham-NaCl group (P < 0.05) (Fig. 10C-D).

In summary, these results suggest that intraperitoneal injection of AAV-GDNF effectively inhibits gliosis and down-regulates CX43 expression. However, GFAP and CX43 levels do not fully return to normal levels.

GDNF upregulate PGP9.5 expression in colon of PD Rats

Both the mRNA levels and protein expression of Colon PGP 9.5 exhibited significant increases in the PD + AAV-GDNF group compared to the PD + AAV-0 group and PD-NaCl group. Although the PGP 9.5 mRNA level and protein expression in the PD + AAV-GDNF group were slightly higher than those in the PD + AAV-0 group, no statistically significant difference was observed between them (see Fig. 11).

Previously, we identified significantly lower serum GDNF levels in individuals with PD and constipation. This led us to formulate two hypotheses: first, that the reduced GDNF levels could be either a consequence of pathological changes in PD or an initial factor contributing to gut pathology in PD, ultimately resulting in decreased colonic motility and clinical constipation. Second, we speculated that supplementing GDNF might ameliorate colonic motility in PD.

In light of these hypotheses, our study aimed to investigate whether GDNF supplementation could enhance colon motility in 6-OHDA-induced PD rats and elucidate the underlying mechanisms. Our research reaffirmed the observation that PD rats displayed diminished colon motility and lower colon GDNF expression. This was marked by moderate to severe colon inflammation, reactive glial cells, increased CX43 expression, and neuronal loss. However, intraperitoneal injection of AAV-GDNF could counter these indicators and enhance colonic motility. Our conjecture was that GDNF plays a role in mitigating the activation of colonic EGCs and downregulating the number of CX43 hemichannels, thus safeguarding neurons from cell death and improving colonic motility in PD rats.

To achieve our goals, we initially established PD animal models to facilitate subsequent investigations. We induced central dopaminergic denervation by employing stereotaxic injection of 6-OHDA, a catecholaminergic neurotoxin that selectively affects dopaminergic neurons through the dopamine transporter. This process leads to the degeneration of the nigrostriatal system, making it the most widely utilized neurotoxin in PD modeling[17]. Rats exhibiting positive results in the Apomorphine (Apo) rotation test, characterized by circling behavior, were identified as PD rats and selected for further experimentation.

To assess colonic motility in PD rats, we employed measurements of fecal moisture percentage (FMP) and carbon powder propulsion rate (CPPR). The results demonstrated a progressive decline in both FMP and CPPR following 6-OHDA denervation, confirming that nigrostriatal denervation led to reduced colonic motility, in line with prior findings[18]. We observed a significant decrease in FMP starting at week 3 post-denervation in PD rats, with both FMP and CPPR declining by more than 20%, indicating a substantial impairment in colonic motility.

Gut motility is primarily governed by the ENS, a sophisticated network of neurons and glial cells within the intestinal wall. Among these, EGCs hold a pivotal role, as they envelop enteric neuronal cell bodies, foster neuronal communication, and provide crucial support for neural signaling and survival. Recent research has underscored the significant contribution of EGCs to gastrointestinal (GI) function regulation, encompassing aspects like gut motility and inflammation. It has become increasingly apparent that gut dysfunction, once solely attributed to enteric neurons (ENS), often arises from intricate interactions between EGCs and ENS. This emerging concept of EGCs as key regulators of gut motility has garnered substantial attention, partly due to studies indicating that the removal of glial cells can lead to neuronal loss [9] or disrupt intercellular signaling between EGCs and ENS [11].

EGCs inherently possess neuroprotective qualities and play a pivotal role in preserving enteric neuron populations. They actively contribute to neuroprotection by secreting essential compounds such as GDNF and reduced glutathione. Furthermore, they express receptors and enzymes capable of metabolizing neuroactive substances, thereby preventing abnormal neuronal activation. Essentially, EGCs function as proactive support cells in safeguarding the ENS[19, 20]. In response to gut infections, whether triggered by bacteria, viruses, or exposure to inflammatory mediators, EGCs undergo a pathophysiological transformation known as the "reactive glial phenotype."[21] The exact function of reactive EGCs remains uncertain. While the neuroprotective properties of glial cells might suggest that the loss of glial support could be a potential mechanism for neuron death, recent data indicate that, in the context of inflammation, it is glial activation, rather than glial cell loss, that drives neurodegeneration in the brain.

In the gastrointestinal context, it has been suggested that the activation of EGCs is partially implicated in enteric neuron death. A pioneering discovery by Thomas Clairebault et al. revealed that colonic EGCs in PD patients undergo pathological reactivity, characterized by an increase in GFAP expression. This underscores that colonic glial cell activation might represent another distinctive pathological feature in PD, in addition to synuclein deposition [10]. GFAP levels exhibited a strong correlation with the levels of various pro-inflammatory cytokines, including IL-6 and others.

Various terms like 'activated,' 'reactive,' and 'gliopathy' are used to describe different states of the EGCs in response to various challenges. Unfortunately, these terms are often used interchangeably, resulting in significant ambiguity in the existing literature. 'Reactive' is a term employed to depict the state of the EGCs when they respond to a pathophysiological disturbance of any degree. Currently, there are no well-defined criteria to characterize reactive EGCs, and experimental assessment typically relies on evaluating changes in morphology and/or the expression of markers such as GFAP or S100β [22].

This complexity in terminology and the need for standardized criteria to characterize different states of EGCs are crucial considerations for understanding EGCs biology, intercellular signaling, and their roles in gastrointestinal diseases.

In our study, we observed a significant increase in the colonic expression of GFAP in PD rats, and GFAP-positive cells exhibited morphological changes, including enlarged cell bodies and increased branching, indicative of reactive EGCs. Interestingly, these reactive EGCs were primarily observed in the submucosal plexus or myenteric plexus, aligning with Thomas Clairebault's observations. Typically, EGCs can be categorized into four subgroups based on their structure and location within the gut wall. Those found in the submucosal plexus or myenteric plexus belong to Type I and Type II cells, often referred to as "protoplasmic" or "fibrous" glial cells. These cells are situated within the ganglia or inter-ganglionic connectives and surround the neurons [23]. Therefore, it is reasonable to speculate that Type I and Type II glial cells play a more prominent role in glia-neuron communication, thereby regulating gut motility in the context of PD pathology. Further investigations are imperative to unravel the precise mechanisms underlying this interaction.

Moderate to severe colon inflammation was observed in PD rats, marked by the infiltration of inflammatory cells and the disruption of the colon wall's original integrity and continuity. Furthermore, there was a notable upsurge in the expression of inflammatory cytokines, including TNF-α, IL-1β, and IL-6, within the colon of PD rats. This inflammatory response coincided with the loss of enteric neurons, evident through the significant decrease in PGP9.5, a neuron-specific protein also known as ubiquitin carboxyterminal hydrolase L1 (UCHL1), within the colons of PD rats.

Gap junctions (GJs) represent a distinct mechanism of direct cell-to-cell communication, allowing neighboring cells to exchange various signaling molecules, including ions, nucleotides, metabolites, second messengers, microRNAs, and more. These exchanges play a pivotal role in supporting multicellular life. The fundamental constituents of GJ channels and hemichannels are connexin proteins, with CX43 being one of the most prevalent members within the connexin protein family. Interestingly, it is expressed predominantly by EGCs within the mouse myenteric plexus (MP) in the ENS, resembling its localization on astrocytes in the CNS[24].

Recent studies have unveiled the participation of CX43 in regulating the inflammatory process within the CNS [25]. In a neuroinflammatory model of PD, the expression of CX43 in astrocytes was found to be increased, and this increase dynamically correlated with the expression of GFAP [26]. Blocking CX43 in astrocytes has demonstrated the ability to modulate central nervous system (CNS) inflammation, thereby alleviating pathological reactions in various models of CNS damage[27]. In the ENS, CX43 is the most scrutinized subtype of the connexin family of gap junction proteins in the context of intestinal inflammation and motility. An increase in CX43 expression has been associated with an elevated occurrence of bacterial infection in colonocytes[28]. A study employing transgenic mice with conditional deletion of CX43 in intestinal smooth muscle reported a 29% reduction in gastrointestinal transit time [29] It was suggested that CX43 in EGCs blunts glial network activity and disrupts neuronal regulation of gastrointestinal transit[24].

Our study revealed an upswing in CX43 expression in reactive EGCs within the colon of PD rats, implying a potential connection between CX43, colonic inflammation, and colonic motility in PD. However, it's worth noting that there are reports indicating that CX43 in astrocytes can be down-regulated in inflamed white matter in a mouse model of multiple sclerosis. This highlights the complex and context-dependent nature of CX43 regulation in different cell types and under various disease conditions [30].

Thus, the responses of EGCs in PD rats, encompassing reactive EGCs, neuroinflammation, and enteric neuropathy, could potentially contribute to impaired colon motility. Within this sequence of events, the upregulation of CX43 opening seems to play a pivotal role in mediating neuronal death. These findings give rise to a new question: should protective mechanisms or interventions be explored to achieve less severe disease outcomes?

In the CNS, gliosis, particularly involving CX43, has been a target of therapeutic approaches in neurodegenerative diseases [31] [32]. However, there is currently no clear consensus regarding gliosis in the ENS. Gulbransen et al. have proposed that targeting EGCs in motility disorders could represent a novel and promising therapeutic approach[33]. In this context, our aim is to target reactive EGCs in the colon of PD patients, with a particular focus on CX43 in EGCs, in order to explore new therapeutic approaches.

Indeed, GDNF, a member of the GDNF family ligands (GFLs), is renowned for its crucial role in promoting the growth and survival of various nervous systems, including the central, sensory, enteric, and parasympathetic systems. Recent research has unveiled its additional anti-inflammatory properties, which involve the suppression of IL-17-induced inflammatory cytokines such as TNF-α, IL-1β, IL-6, and IL-8, while also bolstering the survival of epithelial cells[14]. In the context of inflammation, GDNF released from EGCs plays a significant role in down-regulating pro-inflammatory cytokines like TNF-α and IL-1β. This action of GDNF serves to inhibit mucosal inflammation, highlighting its potential as a modulator of the inflammatory response in the gut[15].

It was previously believed that EGCs were the primary source of GDNF. However, recent research has revealed that neurons and epithelial cells also produce and release GDNF[34]. In a previous clinical study, we reported that serum GDNF levels were significantly lower in PD patients with constipation, suggesting a potential link between GDNF levels and gastrointestinal symptoms in PD[16]. We observed a significant reduction in colonic GDNF levels in PD rats, which was accompanied by the activation of glial cells. This finding is consistent with a report by Michael and colleagues, which showed a decrease in GDNF in the entire intestinal tissue lytic fluid of patients with inflammatory bowel disease (IBD). Importantly, Michael's report highlighted that the decrease in GDNF was particularly prominent in the inflamed portions of the tissue samples, as opposed to the non-inflamed areas. This suggests that GDNF levels may be specifically affected by inflammation in the gastrointestinal tract[35].

The reason for the reduction in GDNF is not yet clear. On one hand, pathologically reactive EGCs may undergo functional alterations. Astrocytes, which are the most abundant glial cells in the CNS and equivalent to EGCs in the ENS, play crucial roles in brain homeostasis. Following pathological brain insults, astrocytes undergo a dynamic transformation known as reactive astrogliosis. This process can manifest in two distinct types: the harmful A1 and the protective A2 types. Their roles can either be neuroprotective or neurodegenerative, depending largely on the specific molecules they release into or take up from the extracellular space[36]. Neuroprotective functions are exerted by releasing a variety of trophic factors, such as GDNF[37]. Additionally, inhibition of microglia-mediated astrocyte transformation to the A1 phenotype has a neuroprotective effect[38]. Furthermore, Fujita’s study showed that striatal GDNF levels decreased with the reduction of A2 astrocytes in PD mice (MPTP-treated)[39].

At this point, the function of reactive EGCs, similar to astrocytes in the CNS, remains poorly understood. The potential for functional changes, such as an increase in "A1" and a decrease in "A2" characteristics in colonic EGCs of PD rats, which could consequently result in decreased GDNF production, warrants further investigation. On the contrary, while GDNF has long been attributed to EGCs as its primary source, recent insights have revealed that neurons and epithelial cells also contribute to its production and release [91].

The decline of GDNF in PD rats, be it in the colon or bloodstream, appears to be the result of a complex interplay of reactions and balances. The intricate and currently unclear mechanisms underlying PD development hinder a comprehensive understanding of the reduction in colon GDNF. Nevertheless, we must address whether the reduction in GDNF correlates with the inflammatory status and the upregulation of CX43, and whether GDNF supplementation can mitigate inflammation and downregulate CX43, ultimately rescuing neurons and enhancing colon motility.

To investigate these questions, we developed an adenovirus overexpressing GDNF (AAV-GDNF) and administered it via intraperitoneal injection to PD rats in experimental and control groups, aiming to boost colonic GDNF levels. Four weeks later, our findings revealed that GDNF supplementation effectively restrained colon inflammation and gliosis. This was evidenced by reduced expression levels of inflammatory factors (IL-1β, IL-6, and TNF-α) and GFAP. Notably, CX43 expression significantly decreased, while PGP9.5 expression increased. Simultaneously, the colonic motility of PD rats witnessed marked improvement, as reflected in the increased FMP and CPPR values. These results suggest that GDNF might rescue enteric neurons and ultimately enhance colonic motility by mitigating colon inflammation, dampening EGC activation, and downregulating CX43. Coincidentally, Isola et al. reported that the opening of CX43 hemichannels is a prerequisite for neuron death during inflammation and that selective removal of glial CX43 exerts a neuroprotective effect in gut pathology[9].

GDNF has been evaluated as a treatment for PD to improve central nervous function in clinical and experimental studies [40, 41], but there have been few reports of its effect on gut motility function in PD. Our findings have firmly established that GDNF holds the potential to enhance gut motility in PD rat models by effectively curbing EGC activation and suppressing CX43 expression. Nevertheless, the intricate downstream mechanisms governing this process warrant further elucidation.

Currently, existing studies have reported that inflammation-induced CX43 opening leads to the release of substantial amounts of ATP within the gastrointestinal system. Extracellular ATP can subsequently engage with purinergic receptors, notably the P2X7R, which is of particular significance. This interaction is known to contribute to neuron death, ultimately influencing gut motility. While the interplay between connexins and purinergic receptors has been explored in diseases such as inflammatory bowel disease (IBD), its investigation within the context of PD-related gut dysfunction remains relatively scarce.

In conclusion, our data strongly suggest that CX43, located within reactive EGCs of the colon, might play a pivotal role in the neuronal demise observed within the inflamed gut of PD. Moreover, our findings indicate that GDNF could act to down-regulate the activity of CX43, thereby preserving the integrity of colon neurons. Whether P2X7R and extracellular ATP are involved in the downstream mechanisms governing this process needs further investigation.

Limitation

Our study does have several limitations that should be taken into account. Firstly, there is potential to improve the objectivity of colon motility evaluation. Secondly, the interchangeability of terms like "activation," "reactivity," and "gliopathy" in the existing literature to describe different states of glial cells in the gut has led to substantial ambiguity. Seguella et al. have indeed proposed a set of guidelines aimed at providing a more precise definition of these terms[22]. However, in our study, we did not differentiate between EGCs in various states, nor did we investigate the status of EGCs under different degrees of 6-OHDA injury or at various time points following 6-OHDA injury. It is reasonable to assume that EGCs may exhibit varying levels of activation in response to different degrees of injury. Thirdly, we characterized the colon EGCs in 6-OHDA-induced PD rats as "reactive EGCs" by assessing changes in morphology and the expression of glial markers such as GFAP[42]. However, this approach may not be comprehensive, as a more precise characterization of reactive glial cells involves considering four primary characteristics. Reactive glia can manifest one or more of these changes, depending on the severity and nature of the insult, similar to the criteria used to define reactive astrocytes[22]. From this perspective, the experimental evaluation of reactive glial cells in our present study might be considered limited. Furthermore, our research lacks empirical evidence regarding the co-localization of CX43 and EGCs; instead, it relies solely on findings from other researchers. Therefore, it is imperative to isolate primary EGCs for subsequent analysis to enhance the comprehensiveness of our study.

Auuthor contributions Xue Ke, An Panpan, Guo Yurong and Du Yin-zhen performed the experiments. Tang Chuan-xi instructed the experiment. Li Xue and Liu Tingting exert the statistical analysis. Qin Xiaoling conceived the study and wrote the manuscript. Tang Chuanxi edited the manuscript.

Data availability All data generated and analyzed during this study are included in this published article

Acknowledgments

Funding The work was supported by grants No.SY-KYQD-02701 from No.4 Medicine hospital of Tongji University and No.220232 from Science and Technology Committee of Shanghai Hongkou District to Qin Xiao-ling, No.82101263 from National Natural Science Foundation of China to Tang Chuanxi.

Conflicts of Interest: The authors declare no conflict of interest.

Hayes, M.T., Parkinson's Disease and Parkinsonism. Am J Med, 2019. 132(7): p. 802-807.
Savica, R., et al., Medical records documentation of constipation preceding Parkinson disease: A case-control study. Neurology, 2009. 73(21): p. 1752-8.
Liddle, R.A., Parkinson's disease from the gut. Brain Res, 2018. 1693(Pt B): p. 201-206.
Sampson, T.R., et al., Gut Microbiota Regulate Motor Deficits and Neuroinflammation in a Model of Parkinson's Disease. Cell, 2016. 167(6): p. 1469-1480.e12.
Stirpe, P., et al., Constipation: an emerging risk factor for Parkinson's disease? Eur J Neurol, 2016. 23(11): p. 1606-1613.
Rao, M., et al., Enteric Glia Regulate Gastrointestinal Motility but Are Not Required for Maintenance of the Epithelium in Mice. Gastroenterology, 2017. 153(4): p. 1068-1081.e7.
Heng, Y., et al., Gastric Enteric Glial Cells: A New Contributor to the Synucleinopathies in the MPTP-Induced Parkinsonism Mouse. Molecules, 2022. 27(21).
Mayo, L., et al., Regulation of astrocyte activation by glycolipids drives chronic CNS inflammation. Nat Med, 2014. 20(10): p. 1147-56.
Brown, I.A., et al., Enteric glia mediate neuron death in colitis through purinergic pathways that require connexin-43 and nitric oxide. Cell Mol Gastroenterol Hepatol, 2016. 2(1): p. 77-91.
Clairembault, T., et al., Enteric GFAP expression and phosphorylation in Parkinson's disease. J Neurochem, 2014. 130(6): p. 805-15.
Delvalle, N.M., et al., Communication Between Enteric Neurons, Glia, and Nociceptors Underlies the Effects of Tachykinins on Neuroinflammation. Cell Mol Gastroenterol Hepatol, 2018. 6(3): p. 321-344.
Sánchez, M.P., et al., Renal agenesis and the absence of enteric neurons in mice lacking GDNF. Nature, 1996. 382(6586): p. 70-3.
Zhang, D.K., et al., Glial-derived neurotrophic factor regulates intestinal epithelial barrier function and inflammation and is therapeutic for murine colitis. J Pathol, 2010. 222(2): p. 213-22.
Bian, F., et al., An immunoprotective privilege of corneal epithelial stem cells against Th17 inflammatory stress by producing glial cell-derived neurotrophic factor. Stem Cells, 2010. 28(12): p. 2172-81.
Meir, M., et al., Glial cell line-derived neurotrophic factor promotes barrier maturation and wound healing in intestinal epithelial cells in vitro. Am J Physiol Gastrointest Liver Physiol, 2015. 309(8): p. G613-24.
Chen, G., et al., Lower GDNF Serum Level Is a Possible Risk Factor for Constipation in Patients With Parkinson Disease: A Case-Control Study. Front Neurol, 2021. 12: p. 777591.
Fornai, M., et al., Enteric Dysfunctions in Experimental Parkinson's Disease: Alterations of Excitatory Cholinergic Neurotransmission Regulating Colonic Motility in Rats. J Pharmacol Exp Ther, 2016. 356(2): p. 434-44.
Feng, X.Y., et al., Gastrointestinal non-motor dysfunction in Parkinson's disease model rats with 6-hydroxydopamine. Physiol Res, 2019. 68(2): p. 295-303.
Abdo, H., et al., Enteric glial cells protect neurons from oxidative stress in part via reduced glutathione. Faseb j, 2010. 24(4): p. 1082-94.
Wright, C.M., et al., scRNA-Seq Reveals New Enteric Nervous System Roles for GDNF, NRTN, and TBX3. Cell Mol Gastroenterol Hepatol, 2021. 11(5): p. 1548-1592.e1.
Coelho-Aguiar Jde, M., et al., The enteric glia: identity and functions. Glia, 2015. 63(6): p. 921-35.
Seguella, L. and B.D. Gulbransen, Enteric glial biology, intercellular signalling and roles in gastrointestinal disease. Nat Rev Gastroenterol Hepatol, 2021. 18(8): p. 571-587.
Boesmans, W., et al., Heterogeneity and phenotypic plasticity of glial cells in the mammalian enteric nervous system. Glia, 2015. 63(2): p. 229-41.
McClain, J., et al., Ca2+ responses in enteric glia are mediated by connexin-43 hemichannels and modulate colonic transit in mice. Gastroenterology, 2014. 146(2): p. 497-507.e1.
Kim, Y., et al., Role of Hemichannels in CNS Inflammation and the Inflammasome Pathway. Adv Protein Chem Struct Biol, 2016. 104: p. 1-37.
Voronkov, D.N., et al., Glial Reaction in a Neuroinflammatory Model of Parkinson's Disease. Bull Exp Biol Med, 2023. 174(5): p. 693-698.
Li, T., et al., Connexin 43 deletion in astrocytes promotes CNS remyelination by modulating local inflammation. Glia, 2020. 68(6): p. 1201-1212.
Vinken, M., T. Vanhaecke, and V. Rogiers, Emerging roles of connexin hemichannels in gastrointestinal and liver pathophysiology. World J Gastrointest Pathophysiol, 2010. 1(4): p. 115-7.
Döring, B., et al., Ablation of connexin43 in smooth muscle cells of the mouse intestine: functional insights into physiology and morphology. Cell Tissue Res, 2007. 327(2): p. 333-42.
Brand-Schieber, E., et al., Connexin43, the major gap junction protein of astrocytes, is down-regulated in inflamed white matter in an animal model of multiple sclerosis. J Neurosci Res, 2005. 80(6): p. 798-808.
Colangelo, A.M., L. Alberghina, and M. Papa, Astrogliosis as a therapeutic target for neurodegenerative diseases. Neurosci Lett, 2014. 565: p. 59-64.
Yu, H., et al., Targeting connexin 43 provides anti-inflammatory effects after intracerebral hemorrhage injury by regulating YAP signaling. J Neuroinflammation, 2020. 17(1): p. 322.
Gulbransen, B.D. and F.L. Christofi, Are We Close to Targeting Enteric Glia in Gastrointestinal Diseases and Motility Disorders? Gastroenterology, 2018. 155(2): p. 245-251.
Cintrón-Colón, A.F., et al., GDNF synthesis, signaling, and retrograde transport in motor neurons. Cell Tissue Res, 2020. 382(1): p. 47-56.
Meir, M., et al., Neurotrophic factor GDNF regulates intestinal barrier function in inflammatory bowel disease. J Clin Invest, 2019. 129(7): p. 2824-2840.
Liddelow, S.A., et al., Neurotoxic reactive astrocytes are induced by activated microglia. Nature, 2017. 541(7638): p. 481-487.
Cunningham, L.A. and C. Su, Astrocyte delivery of glial cell line-derived neurotrophic factor in a mouse model of Parkinson's disease. Exp Neurol, 2002. 174(2): p. 230-42.
Yun, S.P., et al., Block of A1 astrocyte conversion by microglia is neuroprotective in models of Parkinson's disease. Nat Med, 2018. 24(7): p. 931-938.
Fujita, A., et al., Connexin 30 deficiency attenuates A2 astrocyte responses and induces severe neurodegeneration in a 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine hydrochloride Parkinson's disease animal model. J Neuroinflammation, 2018. 15(1): p. 227.
Eberling, J.L., et al., Functional effects of AAV2-GDNF on the dopaminergic nigrostriatal pathway in parkinsonian rhesus monkeys. Hum Gene Ther, 2009. 20(5): p. 511-8.
Nutt, J.G., et al., Randomized, double-blind trial of glial cell line-derived neurotrophic factor (GDNF) in PD. Neurology, 2003. 60(1): p. 69-73.
Nogueira, L.T., et al., The involvement of mast cells in the irinotecan-induced enteric neurons loss and reactive gliosis. J Neuroinflammation, 2017. 14(1): p. 79.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Restoring Colon Motility in Parkinson's Disease: GDNF-Mediated CX43 Suppression in Reactive Enteric Glial Cells

Status:

Version 1

Abstract

Figures

Introduction

Methods

Abcam, Cambridge, UK

ab68428

Results

Dopaminergic neurons loss in 6-OHDA lesioned rats

Colon motility in 6-OHDA PD Rats

Colon Inflammation in 6-OHDA PD Rats

Colon H&E staining

mRNA Expression of IL-1β, IL-6, and TNF-α in Colon of 6-OHDA PD Rats

GDNF expression was reduced in colon of 6-OHDA PD Rats

GFAP and CX43 expression was increased in colon of 6-OHDA PD Rats

PGP9.5 was Down-regulated in Colon of 6-OHDA PD Rats

Identification of adenovirus overexpressing GDNF in colon of PD rats

GDNF improve colon motility in PD Rats

GDNF reduced Colon inflammation in PD-C Rats

H&E Staining

GDNF reduced IL-1β、IL-6 and TNF-α expression in colon of PD rats

GDNF inhibit Colon EGC activation and CX43 Expression in PD-C Rats

GDNF upregulate PGP9.5 expression in colon of PD Rats

Discussion

Limitation

Declarations

References

Additional Declarations

Status:

Version 1