Proof of stability of a RSV Controlled Human Infection Model challenge agent

doi:10.21203/rs.3.rs-3914194/v1

Download PDF

Research Article

Proof of stability of a RSV Controlled Human Infection Model challenge agent

https://doi.org/10.21203/rs.3.rs-3914194/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

In 2018, SGS Belgium NV developed RSV-NICA (Respiratory Syncytial Virus-Nasobronchial Infective Challenge Agent), a RSV type A challenge agent for use in RSV Controlled Human Infection Model (CHIM) studies.

It is known that the stability of RSV can be impacted by multiple environmental factors like temperature or pH. Therefore, we wanted to assess the stability of the viral titer of RSV-NICA after five years of controlled storage and determine the homogeneity of the viral titers across the different vials of a GMP-qualified batch of RSV-NICA. In addition, we assessed the potential of RSV-NICA to infect human primary airway epithelial cells (MucilAir™), the primary target cells of RSV, and we tested the impact of single and repeated freeze-thaw cycles on the infectious viral titer of the challenge agent.

The aliquoted RSV-NICA virus stock was analyzed with standard virological and molecular methods to obtain information on the titer and homogeneity of the viral titer present in 24 representative vials of the stock. Our results demonstrate that in a period of five years of cryo-storage, the infectious viral titer in 75% of the vials tested displayed a similar average infectious viral titer (4.75 ± 0.06 vs 4.99 ± 0.11; p-value = 0.14). Significant reduction down to an undetectable level of infectious virus was found in the other vials. RSV-NICA was shown to effectively infect differentiated human airway epithelial cells, and active virus replication was detected in these cells by demonstrating increasing RSV RNA titers over time. Virus tropism for ciliated cells was suggested by the inhibition of cilia beating frequency in conjunction with an increase in viral RNA titers while no clear impact on membrane barrier function of the epithelial lung tissues nor cytotoxicity was detected. Pooling of vials with infectious titers > 4.0 log₁₀ TCID₅₀/ml and freeze-thawing of these pooled vials, showed no deterioration of the infectious titer. Moreover, pooling and re-aliquoting of vials spanning the entire range of viral titers (including vials with undetectable infectious virus) in combination with subjecting the vials to three repeated freeze-thaw cycles, again did not result in a decrease of the infectious titers in the tested vials.

Collectively, our data indicate that long-term cryo-storage of vials containing RSV-NICA challenge agent may have an impact on the infectious viral titer of the virus, decreasing homogeneity of this titer throughout the challenge stock. However, we also demonstrate that when heterogeneity of the infectious titer of an RSV stock is observed, rounds of pooling, re-aliquoting and subsequent re-titration is a viable method not only to restore the homogeneity of the infectious titer of an RSV-A stock, but also to optimize patient-safety, scientific and operational aspects of viral inoculation of study participants during RSV CHIM. RSV-NICA is a stable, adequate CHIM challenge agent that can be used in efficacy trials for RSV vaccines and antiviral entities.

RSV-NICA

CHIM

TCID50

plaque

titration

MucilAir™

infectivity/attack rate

The COVID-19 pandemic catalyzed the feel of urgency to develop improved methods for vaccine and antivirals development. Over 200 vaccines for SARS-CoV-2 have been developed and tested in several stages of (pre-)clinical development in just a matter of a few years (Khan WH et al. 2021). Testing all these vaccines for safety and efficacy has taken a tremendous amount of time and resources, especially during late-stage clinical development. Therefore, the need for early proof-of-concept trials on newly developed entities has been named a priority, not only for SARS-CoV-2, but also for other respiratory viruses of pandemic or high medical concern. One example is RSV, for which a continued need for additional vaccines and therapeutics exists.

Although in most cases infection with RSV results in mild upper respiratory tract infections causing symptoms typical of the common cold, the virus is a major cause of serious respiratory illness, accompanied by bronchiolitis, pneumonia and mortality in patients of different age (Chatterjee et al, 2021; Li et al, 2022; Mazur et al, 2023; Nguyen-Van-Tam et al, 2022). The burden of RSV infection is highest in children younger than 5 years (Mazur et al, 2023). In this age group, it was estimated that in 2019 there were 33.0 million RSV-associated acute lower respiratory infection episodes, 3.6 million RSV-associated acute lower respiratory infection hospital admissions, 26,300 RSV-associated acute lower respiratory infection in-hospital deaths, and 101,400 RSV-attributable overall deaths (Li et al, 2022). Other people at high-risk to develop a serious lower respiratory tract infection are those with decreased immunity, underlying lung and heart defects and the elderly (Korsten et al, 2021; Nguyen-Van-Tam et al, 2022). In adult patients from industrialized countries aged ≥ 50 years, RSV caused an estimated 1.5 million episodes of illness, of whom an estimated 14.5% were hospitalised and 1.6% died (Shi et al, 2019). Although the recent approval of the first vaccines Arexvy and Abrysvo, together with the extended half-life human monoclonal antibody Nirsevimab, will help to alleviate the morbidity and mortality burden caused by RSV, additional preventive and therapeutic measures are necessary to lower the burden of disease across all patients at high-risk to develop serious disease.

While early phase pharmacological trials mainly assess the safety and pharmacokinetics of an investigational medicinal product (IMP), CHIM trials additionally allow to demonstrate the efficacy of IMPs like vaccines, monoclonal antibodies or small molecule antivirals, and may thus provide proof-of-concept early on in clinical development. CHIM studies are designed to simulate the progression of natural infective disease(s) and the effects of the disease-causing agent on the human body, as well as responses to drugs (e.g. antibiotics, vaccines, antivirals) and other interventions. In a CHIM study, a well-characterized strain of pathogen (in this case RSV) is administered at a controlled dose (before or after administration of IMP) and by a specific route to carefully selected, healthy volunteers under highly controlled quarantine conditions within a Human Challenge Unit. As such they provide developers a faster understanding of the mechanism-of-action and potential efficacy of the IMP at an early stage of development. In addition, this method can also be used as a replacement for large-scale phase 3 studies, which can be very difficult or not possible in some circumstances. This is e.g. the case for new 2nd and 3rd generation COVID vaccines and for other infections, such as Bordetella pertussis, where there is already a high vaccination coverage in the population.

For RSV, one challenge agent is commercially available and has now been used for many years. The Memphis 37 wild type RSV-A strain was isolated from a 4 month old infant in 2001 (Kim YI et al. 2014) and used in numerous CHIM trials since, proving its capabilities in determining efficacy of new entities. The most recent example is the approval of Pfizer´s RSV vaccin Abrysvo for adults over 60 years old, for which a phase 2a CHIM trial was performed (Schmoele-Thoma B et al. 2022). Although this strain is still viable, the symptomology rate is estimated to be approximately 41% based on Pfizer´s CHIM trial. The need to have a more recent agent with an increased infection rate to the mutations of the wild-type RSV is present.

The objectives of the experiments reported here was to first determine the viral (infectious) titer currently present in representative vials of a RSV-NICA challenge agent and to determine the homogeneity of the viral titer present in the different vials of the RSV-NICA batch, allowing to assess the stability of the viral titer of RSV-NICA over a period of five years of cryo-storage. Second, we also wanted to investigate the potential of RSV-NICA to infect human airway epithelial cells as the primary target cells of the virus, and to assess the capacity of the virus to replicate in these cells. Finally, we wanted to investigate the impact of a single or repeated freeze-thaw cycles on the infectious viral titer of pooled and resuspended vials of RSV-NICA stock and determine if it was possible to restore and maintain homogeneous infectious titers.

Isolation and preparation of RSV-NICA challenge agent

This RSV type A virus was originally isolated from a nasopharyngeal (NP) swab, collected from an otherwise healthy 15-month female infant in November 2015. The infant was enrolled into a Community Surveillance (non-IMP) trial, sponsored by SGS and approved by the Ethics Committee of both Ziekenhuis Network Antwerpen (ZNA) and Universitair Ziekenhuis (UZ) Leuven, to collect samples of subjects with RSV-like symptoms. Typical RSV-like illness symptoms were observed at the time of enrolment. The presence of RSV was confirmed via a Biofire™ polymerase chain reaction. No other respiratory pathogens were identified as present at the time. All symptoms had resolved, and the subject had made a full recovery after 2 months.

From this isolate, a seed stock was prepared via culture on a commercial MRC-5 cell line (ATCC CCL-171). The seed stock was then inoculated again on MRC-5 cells to create the final product under Good Manufacturing Processes (GMP) conditions compliant with current US and EU regulations. Two batches of RSV-NICA stock have been produced and viral titers from individual vials were determined by TCID₅₀ measurement (see Table 1).

Table 1

TCID₅₀ titer determination of randomly selected RSV-NICA vials.
Box ID	Sample ID	TCID₅₀/ml (log₁₀)	Average TCID₅₀/ml ± SEM	Box ID	Sample ID	TCID₅₀/ml (log₁₀)	Average TCID₅₀/ml ± SEM
I	I1	4,80	4.93 ± 0.26	VII	VII1	2,35	3.22 ± 0.76
	I2	5,67			VII2	2,52
	I3	4,45			VII3	2,52
	I4	4,80			VII4	5,49
II	II1	4,80	5.23 ± 0.15	VIII	VIII1	2,35	2.35 ± 0.00
	II2	5,32			VIII2	2,35
	II3	5,32			VIII3	2,35
	II4	5,49			VIII4	2,35
III	III1	3,57	4.45 ± 0.34	IX	IX1	2,52	3.05 ± 0.64
	III2	4,27			IX2	2,35
	III3	5,15			IX3	4,97
	III4	4,80			IX4	2,35
IV	IV1	5,49	5.41 ± 0.21	X	X1	5,49	5.67 ± 0.07
	IV2	4,80			X2	5,67
	IV3	5,67			X3	5,67
	IV4	5,67			X4	5,84
V	V1	2,52	2.44 ± 0.05	XI	XI1	3,40	2.83 ± 0.24
	V2	2,35			XI2	2,35
	V3	2,52			XI3	2,52
	V4	2,35			XI4	3,05
VI	VI1	2,35	2.35 ± 0.00	XII	XII1	5,15	4.23 ± 0.64
	VI2	2,35			XII2	4,80
	VI3	2,35			XII3	2,35
	VI4	2,35			XII4	4,62

In 2018, the virus was shown to be appropriately infective in vitro and in vivo and demonstrated a profile typical of contemporary wild-type RSV A viruses, including absence of overt pathogenesis or excessive virulence in cotton rats infected with RSV-NICA during a GLP-certified animal challenge study (unpublished data).

Freeze-thawing cycles were performed by snap freezing vials on dry ice and then stored in a -80°C freezer. Thawing of vials was performed by keeping the vials on ice.

TCID₅₀ determination

The assay was performed as described in Sun and Lopez, 2016. Briefly, HEp2 cells (ATCC CCL-23) grown in Dulbecco’s Minimum Essential Medium (DMEM; Gibco/Thermo Fisher Scientific, Waltham, USA) supplemented with 10% fetal bovine serum (FBS, Tico Europe, Amstelveen, The Netherlands), 2 mM L-glutamine (Gibco/Thermo Fisher Scientific) and 1% Non-Essential Amino Acids (NEAA; Gibco/Thermo Fisher Scientific) were seeded (5x10³ cells/well in HEp2 medium in 96-well plates (Greiner Bio-One, Vilvoorde, Belgium) and grown until 80–90% confluence. In one plate, three samples and one positive control virus of a known titer (RSV long Strain, ATCC VR-26) were grown. In a separate 96-well plate, 1:10 serial dilutions of different RSV-NICA samples or positive control virus were prepared in triplicates in HEp2 infection medium (DMEM supplemented with 2% FBS, 2 mM L-glutamine and 1% NEAA). HEp2 cells were then infected with 25 µL/well of the virus dilutions by a 2 hour (h) incubation at 37°C and 5% CO₂. After incubation, 75 µl of HEp2 infection media was added per well and the plates were again incubated for 4–5 days in the incubator. Finally, the culture medium was discarded and cells stained with a 1% crystal violet solution for 15–30 minutes (min). After washing, plates were scored independently by 2 lab technicians. TCID₅₀/ml was calculated using the Spearman and Kärber method (Lei et al. 2021). Titration of the infectious virus in 2018 of individual vials of RSV-NICA were determined by TCID₅₀ measurement as referred to in de Waal et al (2018) at Viroclinics Biosciences (Schaijk, The Netherlands).

Plaque titration assay

The assay was performed as described in Van den Berg et al, 2013. Briefly, Vero cells grown in Minimum Essential Medium (MEM; Gibco/Thermo Fisher Scientific) supplemented with 10% FBS and 2 mM L-glutamine were seeded (3.4x10⁵ cells/well) in 6-well plates and grown until 80–90% confluence. Then, cells were infected with 500 µL of the 10-fold serially diluted RSV-NICA virus stocks in phosphate buffered saline (PBS; Thermo Fisher Scientific) by a 1h incubation at room temperature under gentle rocking of the plates. The viral inoculum was aspirated and followed by addition of 2 mL/well of plaque-agarose growth medium (DMEM/1.5% agarose containing 4% sodium bicarbonate 1% penicillin-streptomycin 12 mL 2 mM L-glutamine, 5% of FBS, adjusted to pH 7.4 with 1M NaOH maintained at 42°C). Plates were placed for 15 min at 4°C to solidify the agarose layer and then incubated inverted at 37°C in an incubator containing 5% CO₂. After seven days, 2 mL of 4% paraformaldehyde (Avantor, Radnor, USA) in PBS was added to the wells for fixation and again incubated at room temperature for 120 min. Paraformaldehyde solution was then removed, the agarose overlay removed by using a water flow and then cells were stained with 200 µL/well of 0.4% methylene blue solution (Thermo Fisher Scientific) for a few seconds. Finally, wells were gently rinsed with water, dried by inverting the plates on towels, and plaques counted.

Infection of human primary airway cells (MucilAir™) with RSV-NICA

3D human nasal epithelial pooled donor MucilAir™ tissues (Batch Number: MP0010; Certificate of Analysis in Additional file 1) were sourced from Epithelix Sàrl (Geneva, Switserland). The tissues were maintained as per the manufacturer’s instruction until the day of infection and treatment. At day 0 of the experimental protocol, the tissues were washed with 0.5 ml MucilAir™ medium and trans-epithelial electrical resistance (TEER) and cilia beating were evaluated. In a separate 24-well plate, 1:10 dilutions of different analysis samples were prepared in MucilAir™ medium by mixing 320 µl/well of MucilAir™ medium with 40 µl of each vial/condition to all relevant wells. Tissues were then infected apically with 100 µl/well RSV-NICA or RSV-A-Long virus and incubated with the virus at 37°C in 5% CO₂ for 1.5 h. Non-infected tissues were included as negative controls. The virus was aspirated, the tissues were washed with PBS and apical wash fluid was collected and stored at -80°C. The tissues were further incubated for 9 days at 37°C in 5% CO₂. Cilia beating was evaluated and the tissues were washed with PBS and the apical wash fluids were collected and stored at -80°C for qRT-PCR analysis. On days 1, 2, 4, and 9 of cell culturing, membrane integrity (TEER) and lactate dehydrogenase (LDH) release was measured to analyze the health status of the tissues. At the end of the experiment, cell viability of tissues was checked with an MTT assay according to manufacturer’s instructions. Epithelix’ protocols were used for evaluation of TEER and LDH.

Measurement of viral load using qRT-PCR

For qRT-PCR, 5 µl of the apical wash was added to 45 µl of lysis buffer (Cells-to-cDNA II Cell Lysis buffer, Thermo Fisher Scientific). Viral RNA from 150 µl of the RSV-NICA stocks was extracted with the NucleoSpin RNA Virus kit (Macherey-Nagel, Allentown, USA) as per the manufacturer’s instruction.Viral loads were determined by qRT-PCR assay as described below. qRT-PCR was performed using the iTaq™ Universal Probes One-Step Kit (Bio-Rad). Briefly, 2 µl of the extracted viral RNA was mixed with 5 µl of the buffer from the kit, 0,25 µl of the RT enzyme, 60 µM of the forward (CTGTGATAGARTTCCAACAAAAGAACA) and reverse (AGTTACACCTGCATTAACACTAAATTCC) primer for RSV (IDT), 2.5 µM of the probe (FAM-CAGACTACTAGAGATTACC) for RSV (IDT) and 1.55 µl of water to a final volume of 10 µl. Each reaction was performed in duplicate. PCR plates (Roche) were sealed with Lightcycler sealing tape (Roche) and centrifuged for 1 min at 750 rpm. The one-step PCR reaction and subsequent amplification analysis were carried out using the Roche Lightcycler 480 Real Time PCR System using the following conditions: 50°C for 10 min, 95°C for 3 min, followed by 40 cycles of qPCR for 15 sec at 95°C and at 60°C for 1 min. A standard curve was generated using a Gblock (IDT) against which the RSV RNA content measured from test samples was quantified.

Cilia beating frequency analysis

Analysis of cilia beating frequency was performed using the Sisson-Ammons Video Analysis (SAVA) software (Ammons Engineering, Michigan, USA). On each insert two microscopic fields were measured with a 10x objective on a Zeiss Axiovert microscope (Zeiss, Jena, Germany) with a Basler acA1300-200 µm USB3 video camera. A 5-second video, 100 frames per second, 512 frames was taken and further analyzed with the software. Results are provided as percentage average active area (AAA).

Determination of barrier integrity

To determine the integrity of the tissue barrier, warm MucilAir™ medium (200 µl) was added on the apical surface of human nasal MucilAir™ tissues and the electrical resistance of the tissues measured with a Millicell ERS-2 (Merck/Millipore, Darmstadt, Germany) voltohmmeter. After measuring all tissues, medium was gently aspirated from the apical surface of the MucilAir™ inserts.

Measurement of membrane integrity using LDH assay

The LDH Assay Kit-WST according to Dojindo’s protocol (Tebu Bio, Boechout, Belgium) was used to assess cytotoxicity in MucilAir™ tissues, per manufacturer’s instructions. Briefly, 100 µl of the basolateral medium was used for the LDH assay and replaced by fresh medium. The collected medium was incubated for 30 min with 100 µl LDH substrate mix in a 96-well plate. The reaction was stopped by the subsequent addition of 50 µl stop solution. Fresh MucilAir™ medium incubated with the quantification reagents was used as a background control. Absorbance measurements were done using a multi-mode microplate reader (490 nmBMG Labtech, Ortenberg, Germany).

Measurement of mitochondrial activity to determine cell viability

Cell viability was analyzed on day 9 of cell culturing using the MTT assay (Merck, USA). Briefly, the conversion of MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) tetrazolium salt into its reduced formazan form was assessed. A MTT stock was prepared in Dulbecco’s PBS at a concentration of 5 mg/ml. The MTT substrate was prepared in MucilAir™ medium and added to the basolateral medium at a final concentration of 1 mg/ml, and incubated for 2–3 h at 37°C and 5% CO₂. The quantity of formazan was measured by recording changes using a multi-mode microplate reader in absorbance mode (570 nm; Clariostar, BMG Labtech). Cell viability was expressed as the percentage of relative absorbance of treated cells relative to the control cells.

Determining the stability and homogeneity of RSV-NICA viral titer

Two batches of RSV-NICA stock were produced in 2018. From one of the two batches containing 12 boxes of 96 vials each, 48 vials were randomly selected (4 vials per box) and kept on ice for a variable time before determining the infectious viral titer of RSV-NICA in each of the vials (Table 1). A large variation of the infectious viral titer was observed among the selected vials from the separate boxes, with no observable infectious virus left in vials from boxes VI and VIII (all vials TCID₅₀ < 2.35 log₁₀) and up to an average TCID₅₀ = 5.67 ± 0.07 log₁₀ in vials from box X.

From this result, we decided to re-analyze the viral titers of 4 randomly selected vials from each box displaying an average initial TCID₅₀ > 4.0 log₁₀ in 2018. A total of 24 different vials (4 from each of boxes I, II, III, IV, X and XII) were titered via traditional TCID₅₀ determination and plaque assay protocols as well as with qRT-PCR to fully characterize the 5-year stability and homogeneity of the viral titer in the selected RSV-NICA vials. In general, infectious viral titers of the vials re-analyzed either via TCID₅₀ or plaque titration correlated well (Additional file 2). In those vials in which infectious virus could be found, the measured infectious titer was between 4.17 and 5.83 log₁₀ TCID₅₀/ml and 2.64 and 5.11 log₁₀ PFU/ml, respectively (Table 2). The average infectious titer of RSV-NICA as determined over all 24 vials was 4.17 ± 0.16 log₁₀ TCID₅₀/ml. Compared to the historical analysis 5 years ago, an approximately overall 0.8 log₁₀ TCID₅₀/ml reduction was observed, from 4.99 ± 0.11 log₁₀ to 4.17 ± 0.16 log₁₀ TCID₅₀/ml. Although statistically significant, the reduction of infectious viral titer was not observed throughout all vials, but contained to reductions in only a limited number of vials. The infectious viral titers measured in vials A3, C2, J1, J3, L2 and L3, were significantly reduced or completely abolished (Table 2). Vial C4 was removed from the study because of contamination during the analysis. When these vials were excluded from the analysis, the average infectious titer today was essentially identical to the historical titer analyzed five years ago, i.e. 4.75 ± 0.06 log₁₀ TCID₅₀/ml.

In contrast to lower the infectious viral titers measured in vials A3, C2, J1, J3, L2 and L3, titration via the quantification of viral RNA did not reveal any significant differences as the titer in all the vials was in between 8.16 and 8.47 log₁₀ vRNA copies/ml (Table 2).

Table 2

(Infectious) viral titers from selected RSV-NICA vials.
Sample ID	TCID₅₀/ml (log₁₀)	Average TCID₅₀/ml ± SEM	PFU/ml (log₁₀)	Average PFU/ml ± SEM	vRNA copies/ml (log₁₀)	Average vRNA copies/ml ± SEM
A1	4.50	4.17 ± 0.56	4.52	3.97 ± 0.45	8.22	8.28 ± 0.05
A2	4.83		4.56		8.26
A3	2.50		2.64		8.33
A4	4.83		4.18		8.31
B1	4.17	4.67 ± 0.17	3.88	4.75 ± 0.29	8.32	8.30 ± 0.02
B2	4.83		5.05		8.27
B3	4.83		5.11		8.29
B4	4.83		4.95		8.30
C1	4.17	3.72 ± 0.62	3.96	2.68 ± 1.14	8.26	8.23 ± 0.08
C2	2.50		1.00		8.18
C3	4.50		4.76		8.33
C4			1.00		8.16
D1	4.83	4.75 ± 0.16	4.49	4.41 ± 0.18	8.31	8.32 ± 0.03
D2	4.50		4.88		8.31
D3	4.50		4.04		8.37
D4	5.17		4.24		8.29
J1	2.50	3.92 ± 0.84	1.00	3.21 ± 1.02	8.27	8.29 ± 0.09
J2	4.83		4.94		8.37
J3	2.50		1.95		8.17
J4	5.83		4.95		8.35
L1	4.50	3.67 ± 0.69	4.48	2.79 ± 1.04	8.31	8.29 ± 0.05
L2	2.50		1.00		8.22
L3	2.50		1.00		8.28
L4	5.17		4.70		8.34

Viral infectious titers that are shown. Lower limit of detection was set at 2.5 log ₁₀ for TCID50 and at 1 log₁₀ for PFU.

Following these initial virus titration results, we wanted to investigate if the homogeneity of a RSV virus stock could be restored via a pooling, re-aliquoting and re-titration procedure. Since such a procedure is inherently associated to introducing an extra freeze-thaw cycle, the effect of such a single or multiple cycle(s) of freeze-thawing on the infectious viral titers was assessed. Aliquots from the first three vials from boxes J and L, respectively, were pooled and the virus titers from the pools were determined before and after a single freeze-thaw cycle. Despite a lower infectious titer detected in 2/3 of the selected vials (see Table 2), infectious titers in both pooled samples were found at least 50-fold above the lower limit of detection as measured via TCID₅₀ and plaque assay methods. The average infectious titer of RSV-NICA in pool J before freeze-thawing was 4.50 log₁₀ TCID₅₀/ml and 4.46 log₁₀ PFU/ml, respectively. While the average infectious titer of pool L as measured via TCID₅₀ determination was 4.17 log₁₀ TCID₅₀/ml, the measured plaque titer was only 3.04 PFU/ml, approximately 1 log₁₀ lower than the measured TCID₅₀ titer and correlating less well. Importantly, a freeze-thaw cycle did not seem to have a negative impact on the infectious virus titers, since the viral titer of pooled samples J and L were approximately equal to the viral titer determined for the corresponding sample that underwent a freeze-thawing cycle (Table 3).

Table 3

Effect of a single freeze-thaw cycle on the infectious viral titer from RSV-NICA.
Sample ID	Pool J		Pool L
Freeze thaw	Before	After	Before	After
TCID₅₀/ml	4.50	4.50	4.17	4.17
PFU/ml	4.46	4.58	3.04	2.95

Viral infectious titers that are shown. Lower limit of detection was set at 2.5 log ₁₀ for TCID₅₀ and at 1 log₁₀ for PFU.

To further investigate this, we wanted to assess if the infectious viral titer of the RSV-NICA virus could be retained after multiple freeze-thaw cycles. Therefore, 30 extra vials of RSV-NICA with varying infectious viral titer (as determined in 2018) were pooled, thoroughly mixed and re-aliquoted in separate vials. On 3 separate days, all aliquots were thawed and snap frozen again and infectious virus titers in each of the vials were determined before and after each freeze-thaw cycle. The TCID₅₀ of the pooled virus before the first freeze-thaw cycle was determined to be 5.19 log₁₀ TCID₅₀/ml. Five replicate sets of vials were then subjected to multiple separate freeze-thaw cycles and the infectious viral titer of RSV-NICA in the replicate vials measured. We did not see any impact on the infectious viral titer of RSV-NICA as a consequence of re-aliquoting (Table 4). Similarly, no clear negative impact on the infectious viral titer could be observed after up to three rounds of freeze-thawing as the average TCID₅₀ measured was 5.23 ± 0.64 log₁₀, 5.09 ± 0.35 log₁₀ and 5.12 ± 0.45 log₁₀, after a first, second and third round of freeze-thawing, respectively.

Table 4

Effect of multiple freeze-thaw cycles on the infectious viral titer from RSV-NICA .
Sample ID	Procedure	TCID₅₀/ml (log₁₀)
Pooled stock	Before aliquoting No freeze-thaw	5,19
Pooled stock	After aliquoting No freeze-thaw	5,19
Aliquot 1	First freeze-thaw	5,02
	Second freeze-thaw	5,02
	Third freeze-thaw	4,84
Aliquot 2	First freeze-thaw	5,19
	Second freeze-thaw	5,02
	Third freeze-thaw	5,02
Aliquot 3	First freeze-thaw	5,19
	Second freeze-thaw	5,02
	Third freeze-thaw	5,19
Aliquot 4	First freeze-thaw	5,02
	Second freeze-thaw	5,02
	Third freeze-thaw	5,37
Aliquot 5	First freeze-thaw	5,72
	Second freeze-thaw	5,37
	Third freeze-thaw	5,19

Infection and replication potential of RSV-NICA in human primary airway cells.

To determine the ability of RSV-NICA to infect its human target cells (Carvajal et al, 2019; Zhang et al, 2002), virus from each of 3 vials from boxes A, B, C, D, J and L were used to infect pooled MucilAir™ nasal epithelial tissues. Furthermore, aliquots of 3 vials from boxes J and L, respectively, were pooled and the virus titers from the pools were determined using qRT-PCR before and after a freeze-thaw cycle.

Infection of nasal epithelial cells was observed with RSV-NICA present in each of the selected vials (Fig. 1). Moreover, RSV-NICA replicated in each of the infected cells. In cells infected with virus from vials A3, C2, J1, J3, L2 and L3, lower copy number of vRNA was observed as compared to the copy number in the other vials, fully corresponding with the lower infectious viral titers observed in these vials. Again, the freeze-thaw cycle did not seem to impact the infectivity and capacity of RSV-NICA to replicate in human primary nasal epithelial cells as similar infection and viral replication was observed in the pooled vials from boxes J and L before and after the freeze-thaw cycle.

Functional effect of RSV-NICA infection on human primary airway cells.

Before infection with RSV-NICA, the barrier integrity of Mucilair™ tissues was measured (Additional file 3). All tissues were found in a healthy status with TEER values > 200 Ohm.cm². TEER values were measured again on day 9 post-infection and found equal to those measured before infection. These results indicate that infection with RSV-NICA did not impact barrier integrity of the cell tissues. Concomitant with a maintained barrier integrity, no decrease in mean cell viability (% viability > 85%) or LDH detected in the supernatant up to day 9 post-infection was observed when Mucilair™ tissues were infected with RSV-NICA (Additional file 4).

To evaluate if infection and replication of RSV-NICA has a negative effect on the function of its ciliated epithelial target cells, the beating frequency of these cells was measured. A clear reduction of cilia beating frequency was found in function of time after infection, with little to no effect on cilia beating frequency on day 1 and 2 after infection, but with clear increasing reduction of beating frequency as from day 4 post-infection (Fig. 2). A delayed reduction of cilia beating frequency was observed when cells were infected with virus from vials A3, C2, J1, J3, L2, and L3, again correlating with the lower infectious titer found in these vials as well as with the delayed viral replication in cells infected with virus from these wells (Fig. 1). Cilia beating frequency was also reduced as from day 4 post-infection in the pooled vials from boxes J and L, concomitant with the reduction observed with RSV-NICA from the individual vials. No additional impact of a freeze-thaw cycle on cilia beating frequency could be observed as the reduction in beating frequency was equal in time and extent when virus from pooled RSV-NICA before and after the freeze-thaw cycle was used to infect human airway epithelial cells.

CHIM studies may provide developers with an understanding of the mechanism-of-action and potential efficacy of new anti-infective preventive or treatment strategies at an early stage of development, thereby facilitating decision making which biopharmaceutical modalities to prioritize. An essential component to conduct CHIM studies is the availability of GMP-qualified challenge agents with preferably a long-term stability and homogeneity of its (infectious) viral titer. In 2018, SGS Belgium NV developed RSV-NICA, a RSV type A challenge agent for use in RSV CHIM studies. Since RSV infectivity is known to be impacted by several environmental factors like temperature and pH (Ausar et al, 2005; Gupta et al, 1996; DeFord et al, 2019; Heumann et al, 2021; Kitai et al, 2022), we wanted to re-analyse the (infectious) viral titers and infectivity of RSV-NICA. Here, the outcome of a study investigating the 5-year stability and homogeneity of RSV-NICA is reported and options for long-term use of this RSV challenge agent discussed.

In a first series of experiments, the (infectious) viral titer of RSV-NICA challenge agent was determined by different methods of titration. Therefore, a set of 24 different vials (4 randomly selected vials of each of 6 boxes containing 96 vials) with infectious viral titers of > 4.0 log₁₀ TCID50/ml as assessed in 2018, was subjected to viral re-titration. Determination of the infectious viral titer of the selected vials via two independent methods, i.e. TCID₅₀ and plaque assay analyses, revealed the presence of infectious virus in most of the vials with titers ranging in between 4.17 and 5.83 log₁₀ TCID₅₀/ml and 2.64 and 5.11 log₁₀ PFU/mL. A good correlation (r = 0.94) was found between the viral infectious titers as measured by the two different methods, indicating the robustness of the analysis. Compared with the infectious titer of RSV-NICA as determined five years ago, the average titer across the 24 vials measured in this study was reduced significantly, approximately 0.8 log₁₀ TCID₅₀/ml. However, the titer reduction was not due to a general decrease across all vials, but was attributable to a significant decrease in a limited number of vials. Titers in vials A3, C2, J1, J3, L2 and L3, all displayed a significantly reduced infectious viral titer or a titer below lower limit of detection. When these vials were removed from the calculation, a comparable infectious viral titer was obtained between the recent and the historical analysis (4.75 ± 0.06 vs 4.99 ± 0.11 log₁₀ TCID₅₀/ml; p-value = 0.14).

qRT-PCR analysis of RSV-NICA RNA demonstrated a consistent presence in all samples (8.16–8.47 log₁₀ vRNA copies/ml), including vials A3, C2, J1, J3, L2 and L3. These data indicate that equal amounts of virus were likely aliquoted after the fresh GMP-production of the RSV-NICA stock, but that the infectivity of the virus in some of the individual vials may have been negatively impacted during five year storage and/or by variable incubation time on ice upon thawing.

Consistency in infectious viral titer across all vials of a batch of challenge agent is essential when conducting CHIM studies, and occasional variations in these titers across vials potentially poses challenges in terms of patient safety as well as scientific and operational aspects. With occasional inconsistencies found in the infectious viral titer of virus present in individual vials, we were wondering if pooling - together with the inherent introduction of extra freeze-thaw cycle(s) – and re-titration could be a viable strategy to better control consistency in infectious viral titer across vials of a challenge agent batch over time. A first experiment, introducing a single cycle of freeze-thawing, did not lead to a loss of infectious virus, providing a first indication that pooling, re-titration and subsequent freezing could present a means to maintain sufficiently high infectious viral titer while restoring the homogeneity of the titer and thus shelf-life of a RSV challenge agent. Second, we investigated the stability of the infectious viral titer of the RSV-NICA challenge agent after subjecting the virus to multiple freeze-thaw cycles. Again, we did not observe any noticeable impact on the infectious titer of the virus, further confirming the potential of pooling as a means to extend the shelf-life of RSV challenge virus and its flexible application in CHIM studies. When the infectious viral titer of the virus in a vial remains stable after multiple freeze-thaw cycles, single vials can be used for instance in smaller size CHIM trials in which participants need to be inoculated over several days.

In a second series of experiments, we wanted to investigate the potential of RSV-NICA virus in a set of selected vials to infect its primary human target cells and its capacity to replicate in these cells. MucilAir™ cells were used to infect with RSV-NICA and infection and replication was assessed on different days post-infection by quantifying the amount of vRNA in the cells. In addition, the effect of the virus on cell viability and functionality was assessed. The nasal epithelial cells were infected with RSV-NICA present in all tested vials and approximately equal levels of vRNA were detected, except when cells were infected with virus from vials A3, C2, J1, J3, L2 and L3. For these vials, replication in ciliated epithelial cells was delayed as compared to the other vials and consistent with a lower titer of infectious virus found in these vials.

Infection of MucilAir™ cells with RSV-NICA did not seem to significantly reduce cell viability/cytotoxicity nor the integrity of the membrane barrier function of the nasal epithelial tissues. This is possibly due to the fact that RSV displays tropism for only the ciliated cells, a subset of cells in the nasal epithelial tissues (Carvajal et al, 2019; Zhang et al, 2002). However, infection with RSV-NICA did result in a reduction of cilia beating frequency correlating with time post-infection. Analyzed on days 3, 4 and 7 post-infection, an equal reduction of cilia beating frequency was induced in the cells when infected with virus from all vials, even with virus present in vials A3, C2, J1, J3, L2 and L3, although again delayed and again consistent with the lower infectious viral titer of these vials.

Our findings are interesting and highlight the high potential of RSV-NICA as a CHIM challenge agent. With infectious viral titers of RSV-NICA in between 4.17 and 5.83 log₁₀ TCID₅₀/ml or 2.64 and 5.11 log₁₀ PFU/mL across different vials of the virus batch, and with a stable infectious viral titer in an estimated 75% of the vials (18/24 vials in our analysis), it can be expected that most of the vials in the virus batches could be used in consequent CHIM studies over a period of at least 5 years. In a recent human challenge study, in which the efficacy of EDP-938, a small-molcule RSV N-protein inhibitor, was tested, study participants were inoculated with 0.8 ml of viral inoculate, corresponding to approximately 4.0 log₁₀ PFU/ml (Ahmad et al, 2022). In part 1 of the study, 115 participants were enrolled, while in part 2, 63 subjects were quarantained, inoculated and randomly assigned to a trial group. Of these, 86 and 38 participants, respectively were included in the intention-to-treat-infected analysis, demonstrating the high inoculation efficiency across the study groups. Since we also demonstrated that subsequent cycles of pooling and re-aliquoting including freeze-thawing of RSV-NICA do not seem to influence its infectious titer, such procedure can be used to maintain a stable and homogeneous infectious viral titer across the stock of challenge agent, thereby further extending its shelf-life and minimizing patient safety, scientific and operational challenges associated to study participant inoculation during RSV CHIM studies.

Taken together, our data demonstrate that the infectious viral titer of our RSV-NICA challenge agent can be maintained over a multi-year time period, although occasional loss of infectivity in individual vials may appear. The data reported here further suggest that pooling and re-titration is a viable strategy to further extend the shelf-life of the challenge agent. Consequently, operational aspects of viral inoculation of the trial participants is optimized, improving the safety of the participants. This further shows that RSV-NICA is a stable, adequate CHIM agent that can be used in efficacy trials for RSV vaccines and antiviral entities. A human titration study will be performed to finalize this RSV CA model.

Competing interest

The authors declare that they have no competing interests.

Funding

The funding to conduct studies included in this publication was provided by SGS Belgium NV, Clinical Pharmacology Unit.

Author Contribution

Sandra Verstraelen, Dirk Roymans, Jelle Klein, and Tini Grauwet wrote the main manuscript text.Dirk Jochmans was involved in the discussion of the study design together with Sandra Verstraelen, Dirk Roymans, and Tini Grauwet.An Jacobs and Karen Hollanders performed the experiments described in the paper and were involved in the writing of the Materials & Methods section.Sylvie Remy performed the statistical analysis and prepared the figures.All authors reviewed the manuscript.

Acknowledgement

The authors are grateful to Joke Van Den Berg from Janssen Infection Diseases (Beerse, Belgium) for kindly providing technical support in performing the plaque assay and Viroclinics-DLL (now part of Cerba Research) for their support in the freeze-thaw cycle assessments.

Ahmad A, Eze K, Noulin N, Horvathova V, Murray B, Baillet M, Grey L, Mori J, Adda N. 2022. EDP-938, a respiratory syncytial virus inhibitor, in a human virus challenge. N Engl J Med 386: 655–666.
Ausar SF, Rexroad J, Frolov VG, Look JL, Konar N, Middaugh CR. 2005 Analysis of the thermal and pH stability of human respiratory syncytial virus. Mol Pharm. Nov-Dec(6): 491-9.
Carvajal JJ, Avellaneda AM, Salazar-Ardiles C, Maya JE, Kalergis AM, Lay MK. Host Components Contributing to Respiratory Syncytial Virus Pathogenesis. Front Immunol. 2019;10:2152. doi: 10.3389/fimmu.2019.02152. PMID: 31572372; PMCID: PMC6753334.
Chatterjee A, Mavunda K, Krilov LR. Current State of Respiratory Syncytial Virus Disease and Management. Infect Dis Ther. 2021;10(Suppl 1):5–16. doi: 10.1007/s40121-020-00387-2. Epub 2021 Mar 3. PMID: 33660239; PMCID: PMC7928170.
DeFord DM, Nosek JM, Castiglia KR, Hasik EF, Franke ME, Nick BC, Abdelnour AM, Haas CE, Junod NA, Latsko KN, Moore ML, Berthrong ST, Rostad CA, Stobart CC. Evaluation of the role of respiratory syncytial virus surface glycoproteins F and G on viral stability and replication: implications for future vaccine design. J Gen Virol. 2019;100(7):1112–22.
Gupta CK, Leszczynski J, Gupta RK, Siber GR. Stabilization of respiratory syncytial virus (RSV) against thermal inactivation and freeze-thaw cycles for development and control of RSV vaccines and immune globulin. Vaccine. 1996;14(15):1417-20.
Heumann R, Duncan C, Stobart CC, Kaschner S. Dynamical Differences in Respiratory Syncytial Virus. Bull Math Biol. 2021;84(1):11.
Khan WH, Hashmi Z, Goel A, Ahmad R, Gupta K, Khan N, Alam I, Ahmed F, Ansari MA. COVID-19 Pandemic and Vaccines Update on Challenges and Resolutions. Front Cell Infect Microbiol. 2021;11:690621.
Kim YI, DeVincenzo JP, Jones BG, Rudraraju R, Harrison L, Meyers R, Cehelsky J, Alvarez R, Hurwitz JL. Respiratory syncytial virus human experimental infection model: provenance, production, and sequence of low-passaged memphis-37 challenge virus. PLoS ONE. 2014;9(11):e113100.
Kitai Y, Sato K, Shirato K, Ohmiya S, Watanabe O, Kisu T, Ota R, Takeda M, Kawakami K, Nishimura H. Variation in Thermal Stability among Respiratory Syncytial Virus Clinical Isolates under. Non-Freezing Conditions Viruses. 2022;14(4):679.
Korsten K, Adriaenssens N, Coenen S, Butler C, Ravanfar B, Rutter H, Allen J, Falsey A, Pirçon JY, Gruselle O, Pavot V, Vernhes C, Balla-Jhagjhoorsingh S, Öner D, Ispas G, Aerssens J, Shinde V, Verheij T, Bont L, Wildenbeest J. RESCEU investigators. Burden of respiratory syncytial virus infection in community-dwelling older adults in Europe (RESCEU): an international prospective cohort study. Eur Respir J. 2021;57(4):2002688.
Li Y, Wang X, Blau DM, Caballero MT, Feikin DR, Gill CJ, Madhi SA, Omer SB, Simões EAF, Campbell H, Pariente AB, Bardach D, Bassat Q, Casalegno JS, Chakhunashvili G, Crawford N, Danilenko D, Do LAH, Echavarria M, Gentile A, Gordon A, Heikkinen T, Huang QS, Jullien S, Krishnan A, Lopez EL, Markić J, Mira-Iglesias A, Moore HC, Moyes J, Mwananyanda L, Nokes DJ, Noordeen F, Obodai E, Palani N, Romero C, Salimi V, Satav A, Seo E, Shchomak Z, Singleton R, Stolyarov K, Stoszek SK, von Gottberg A, Wurzel D, Yoshida LM, Yung CF, Zar HJ. ; Respiratory Virus Global Epidemiology Network; Nair H; RESCEU investigators. Global, regional, and national disease burden estimates of acute lower respiratory infections due to respiratory syncytial virus in children younger than 5 years in 2019: a systematic analysis. Lancet. 2022;399(10340):2047–2064.
Lei C, Yang J, Hu J, Sun X. On the Calculation of TCID50 for Quantitation of Virus Infectivity. Virol Sin. 2021;36(1):141–144. doi: 10.1007/s12250-020-00230-5. Epub 2020 May 26. PMID: 32458296; PMCID: PMC7973348.
Mazur NI, Terstappen J, Baral R, Bardají A, Beutels P, Buchholz UJ, Cohen C, Crowe JE Jr, Cutland CL, Eckert L, Feikin D, Fitzpatrick T, Fong Y, Graham BS, Heikkinen T, Higgins D, Hirve S, Klugman KP, Kragten-Tabatabaie L, Lemey P, Libster R, Löwensteyn Y, Mejias A, Munoz FM, Munywoki PK, Mwananyanda L, Nair H, Nunes MC, Ramilo O, Richmond P, Ruckwardt TJ, Sande C, Srikantiah P, Thacker N, Waldstein KA, Weinberger D, Wildenbeest J, Wiseman D, Zar HJ, Zambon M, Bont L. Respiratory syncytial virus prevention within reach: the vaccine and monoclonal antibody landscape. Lancet Infect Dis. 2023;23(1):e2-e21. doi: 10.1016/S1473-3099(22)00291-2. Epub 2022 Aug 8. PMID: 35952703; PMCID: PMC9896921.
Nguyen-Van-Tam JS, O'Leary M, Martin ET, Heijnen E, Callendret B, Fleischhackl R, Comeaux C, Tran TMP, Weber K. Burden of respiratory syncytial virus infection in older and high-risk adults: a systematic review and meta-analysis of the evidence from developed countries. Eur Respir Rev. 2022;31(166):220105. doi: 10.1183/16000617.0105-2022. PMID: 36384703; PMCID: PMC9724807.
Shi T, Denouel A, Tietjen AK, Campbell I, Moran E, Li X, Campbell H, Demont C, Nyawanda BO, Chu HY, Stoszek SK, Krishnan A, Openshaw P, Falsey AR, Nair H. ; RESCEU Investigators. Global Disease Burden Estimates of Respiratory Syncytial Virus-Associated Acute Respiratory Infection in Older Adults in 2015: A Systematic Review and Meta-Analysis. J Infect Dis. 2020;222(Suppl 7):S577-S583. doi: 10.1093/infdis/jiz059. PMID: 30880339.
Schmoele-Thoma B, Zareba AM, Jiang Q, Maddur MS, Danaf R, Mann A, Eze K, Fok-Seang J, Kabir G, Catchpole A, Scott DA, Gurtman AC, Jansen KU, Gruber WC, Dormitzer PR, Swanson KA. Vaccine Efficacy in Adults in a Respiratory Syncytial Virus Challenge Study. N Engl J Med. 2022;38625:2377–86.
Sun Y, López CB. Preparation of respiratory syncytial virus with high or low content of defective viral particles and their purification from viral stocks. Bio Protoc. 2016;6(10):e1820.
Van den Berg J, Kwanten L, Roymans D. Evaluation of antiviral efficacy against human respiratory syncytial virus using cotton rat and mouse models. Methods Mol Biol. 2013;1030:365–72.
Zhang L, Peeples ME, Boucher RC, Collins PL, Pickles RJ. Respiratory syncytial virus infection of human airway epithelial cells is polarized, specific to ciliated cells, and without obvious cytopathology. J Virol. 2002;76(11):5654-66. doi: i>10.1128/jvi.76.11.5654-5666.2002. PMID: 11991994; PMCID: PMC137037.

No competing interests reported.

Download PDF

Reviewers invited by journal
07 Feb, 2024
Editor assigned by journal
07 Feb, 2024
Submission checks completed at journal
07 Feb, 2024
First submitted to journal
31 Jan, 2024

You are reading this latest preprint version

Proof of stability of a RSV Controlled Human Infection Model challenge agent

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Isolation and preparation of RSV-NICA challenge agent

TCID₅₀ determination

Plaque titration assay

Infection of human primary airway cells (MucilAir™) with RSV-NICA

Measurement of viral load using qRT-PCR

Cilia beating frequency analysis

Determination of barrier integrity

Measurement of membrane integrity using LDH assay

Measurement of mitochondrial activity to determine cell viability

Results

Determining the stability and homogeneity of RSV-NICA viral titer

Discussion

Conclusion

Declarations

Competing interest

Funding

Author Contribution

Acknowledgement

References

Additional Declarations

Supplementary Files

Status:

Version 1

Proof of stability of a RSV Controlled Human Infection Model challenge agent

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Isolation and preparation of RSV-NICA challenge agent

TCID50 determination

Plaque titration assay

Infection of human primary airway cells (MucilAir™) with RSV-NICA

Measurement of viral load using qRT-PCR

Cilia beating frequency analysis

Determination of barrier integrity

Measurement of membrane integrity using LDH assay

Measurement of mitochondrial activity to determine cell viability

Results

Determining the stability and homogeneity of RSV-NICA viral titer

Discussion

Conclusion

Declarations

Competing interest

Funding

Author Contribution

Acknowledgement

References

Additional Declarations

Supplementary Files

Status:

Version 1

TCID₅₀ determination