Cell lines: The patient-derived glioblastoma cell lines S24, T269, T325 and P3xx and BT088 oligodendroglioma cells were kept under stem-like neurosphere conditions (37 °C, 5.0% CO2): DMEM F-12 medium (31330-038, Invitrogen), B27 supplement (12587-010, Invitrogen), 5 µg ml − 1 insulin (I9278, Sigma-Aldrich), 5 µg ml − 1 heparin (H4784, Sigma-Aldrich), 20 ng ml − 1 epidermal growth factor (rhEGF; 236-EG, R&D Systems), and 20 ng ml − 1 basic fibroblast growth factor (bFGF; PHG0021, Thermo Fisher Scientific). S24 (human, female), T269 (human, male), T325 (human, male) and P3xx (human) were authentificated (Multiplexion GmbH, Germany). S24, T269 and T325 were further authenticated as glioblastoma by Illumina 850 k methylation array. BT088 cells were obtained from ATCC (ATCC CRL-3417, RRID:CVCL_N708) (human, male).
Lentiviral Transductions: For transduction, cells were incubated with lentiviral particles and 10 µg ml − 1 polybrene (TR-1003-G, Merck Millipore) for 24 h. Cell lines were stably transduced with the LeGO-T2 vector (cytoplasmatic tdTomato, Addgene 27342, RRID:Addgene_27342), pLKO.1-LV-GFP (H2B-GFP, Addgene #25999, RRID:Addgene_25999), pLenti6.2 hygro/V5-Lifeact-YFP, plKO.1-puro-CMV-TurboGFP_shnon-target (cytoplasmatic GFP, SHC016, Sigma-Aldrich), plKO.1-puro-CMV-TurboGFP_shCX43 (CX43 knockdown, sequence: GCCCAAACTGATGGTGTCAA, Sigma-Aldrich), and plKO.1-puro-CMV-TurboGFP_shNOTCH1 (NOTCH1 knockdown, sequence: CCGGGACATCACGGATCATAT, Sigma-Aldrich). NOTCH1 and CX43 knockdown were confirmed by western blot analysis (45% (S24 GBMSCs); 92% (BT088) (NOTCH1) / 80% (S24 GBMSCs) (CX43) reduction in protein expression). Anti-Notch1 (#4380, Cell Signaling Technology, RRID:AB_10691684) and anti-GAPDH antibody (LAH1064, Linaris) were used for western blot analyses.
Animal Procedures: 8-to-10-week-old male NMRI nude mice (Charles River) were used for studying the intracranial tumor growth and dynamics. All animal procedures were performed in accordance with the institutional laboratory animal research guidelines after approval of the Regierungspräsidium Karlsruhe, Germany. A chronic cranial window and a titan ring that allows pain-free fixation of the animals during two photon microscopy were implanted as described before 15, 17. Two weeks after window implantation 30,000 patient-derived and fluorescently labeled glioblastoma stem-like cells suspended in PBS were intracranially implanted in a depth of 500 µm. For survival and MRI studies, 50,000 cells (S24 shControl and shNotch1) were implanted without preparation of a chronic cranial window. T2-weighted rapid acquisition with refocused echoes sequence MRI images were acquired on a 9.4 T horizontal bore MR scanner (BioSpec 94/20 USR, Bruker BioSpin) with a four-channel phased-array surface coil (parameters: TE = 33 ms, TR = 2500 ms, flip angle = 90°, acquisition matrix: 200 × 150, number of averages = 2, slice thickness = 700 µm duration = 2 min 53 s). For radiotherapy experiments, whole brain irradiation with fractions of 7 Gy at a dose rate of 3 Gy min − 1 were performed on 3 consecutive days at D60 (± 10 days) using a 6 MV linear accelerator (Artiste, Siemens) with a 6 mm collimator adjusted to the window size. As control no radiation was applied (sham radiation). For chemotherapy experiments, mice were treated with 100 mg/kg body weight temozolomide for 3 consecutive days on D85 ± 3 after tumor implantation by oral gavage. For two photon microscopy and MRI imaging mice were anesthetized with isoflurane. Mice were scored clinically and rapidly killed if they showed neurological symptoms or a weight loss of > 20%.
In Vivo Multiphoton Laser Scanning Microscopy: Intravital 2-photon microscopy (2-PM) was performed with a Zeiss 7MP microscope (Zeiss) equipped with a Coherent Chameleon UltraII laser (Coherent) on anesthetized mice (4% isoflurane for initiation, 0.5-2% for maintenance of anesthesia). A custom-made aperture allowed painless fixation of the head for imaging. Body temperature was permanently controlled by a rectal thermometer and was kept constant by a heating pad. Angiograms allowed identification of the same tumor regions over time. For angiograms, fluorescent dextranes (10 mg ml-1, TRITC-dextrane (500 kDa; 52194, Sigma Aldrich) or FITC-dextrane (2,000 kDa, FD2000S, Sigma Aldrich)) were applied by tail vein injection. The following wavelengths were used for excitation of different fluorophores: 750 nm (FITC-dextrane, tdTomato), 850 nm (GFP, TRITC-dextrane) and 950 nm (tdTomato, YFP). Appropriate filter sets (band pass 500–550 nm/band pass 575–610 nm) were used. For ablation of single glioma cells, the laser beam was focused on the GFP-labeled nucleus (H2B-GFP) and continuous scanning was performed until disintegration of the cell. For damage of a larger tumor area, repetitive scanning (950 nm wavelength) for approximately 8 minutes with high laser power was performed. For the evaluation of therapeutic responses, the same tumor regions were imaged repetitively over one to three weeks. For invasion speed measurements and identification of invading tumor cells, single glioma cells were followed with repetitive imaging over 24 hours. Short-term residency of individual glioma cells was determined by repetitive imaging over 4 (S24) and 5 days (P3xx), long-term residency by repetitive imaging between D41 and D62.
SR101 staining and separation of connected and unconnected tumor cells
For separation of connected and unconnected tumor cells, mice bearing S24 and T269 GFP tumors were injected with sterilized saline solution dissolving SR101 (S359, Invitrogen) i.p. at a dose of 0.12 mg per gram body weight, which is taken up by tumor cells within 5–8 hours. Mice were then perfused with PBS and the brains were harvested. Whole brain single cell suspensions were prepared with brain tumor dissociation kit (130-095-942, Miltenyi Biotec) and gentleMACSTM Dissociator (Miltenyi Biotec). After dissociation the suspension was resuspended in FACS buffer (PBS + 1% FCS, 10500064, ThermoFisher). FACS was performed on a FACSAria cell sorter (BD Biosystems). Cells were stained with Calcein Violet 450 AM (65-0854-39, Invitrogen) and TO-PRO®-3 Iodide (T3605, Invitrogen) for 10 min on ice before sorting for the viable cell population (Calcein Violet 450high and TO-PRO-3neg). Within the viable cell population SR101high, GFP+ (connected tumor cells) and SR101low, GFP+ (unconnected tumor cells) were separated. The YG586/15 channel was used to visualize SR101 signal.
Bulk RNA sequencing of connected and unconnected tumor cells
After cell sorting, cell populations were lysed (lysis buffer, RNeasy Micro Kit, 74004, Qiagen). mRNA was isolated and purified in accordance with the manufacturer’s instruction. The conversion of RNA to dsDNA was done with the SMARTer Ultra Low Input RNA for Illumina Sequencing (Clontech), the libraries were then prepared using NEBNext® ChIP-Seq Library Prep Master Mix Set for Illumina (E6240, New England Biolabs) and sequenced on HiSeq2000 v4 (Illumina) in 50 bp single-end mode by our core facility. The quality of bases was evaluated using the FASTX Toolkit. Homertools 4.7 were applied for PolyA-tail trimming 55; reads with a length of < 17 were removed. The filtered reads were mapped with STAR 2.3 56 against the human reference genome (GRCh38) and PicardTools 1.78 with CollectRNASeqMetrics were used for quality checking. Count data were generated by htseq-count using the gencode.v26.annotation.gtf file for annotation 57. DESeq2 1.4.1 was run with default parameters for the group-wise comparison 58. The expression levels were transformed to logarithmic space using log2. The RNA sEq. data of connected and unconnected S24 and T269 glioblastoma cells will be deposited in the Gene Expression Omnibus under accession no.(tbd) and is available upon request.
Analysis of differential mRNA expression of human gliomas
RNA sequencing data of molecular (1p/19q-codeleted, IDH mutant) oligodendroglioma (n = 56) and molecular (1p/19q non-codeleted, IDH wildtype) glioblastoma (n = 70) was downloaded from TCGA and analyzed as described previously 15. The full list of differentially expressed genes can be found in Osswald et al., 2015 15.
Immunofluorescence and confocal microscopy: For immunofluorescence of mouse tissue, tumor bearing mice were cardially perfused with PBS, followed by 4.5% phosphate-buffered formaldehyde solution (Roti-Histofix 4.5%, 2213, Carl Roth). Brain tissue was incubated in 30% sucrose solution overnight for cryoprotection and snap frozen afterwards. Heat-induced epitope retrieval with 0.01 M citrate buffer, pH 6.0, was performed. The following primary antibodies were used: anti-nestin (1:400, ab6320, Abcam, RRID:AB_308832), anti-CD31 (1:100, AF3628, R&D Systems, RRID:AB_2161028), anti-aquaporin 4 (1:200, ab9512, Abcam, RRID:AB_307299), anti-activated Notch1 (1:50, ab8925, Abcam, RRID:AB_306863) and anti-ki67 (1:500, ab15580, Abcam, RRID:AB_443209). Donkey anti-mouse IgG Alexa Fluor 488 (A-21202, Thermo Fisher Scientific, RRID:AB_141607), goat anti-mouse IgG Alexa Fluor 488 conjugate (A-11029, Thermo Fisher Scientific, RRID:AB_138404), donkey anti-goat IgG Alexa Fluor 633 (A-21082, Thermo Fisher Scientific, RRID:AB_141493) and donkey anti-rabbit IgG Alexa Fluor 546 (A-10040, Thermo Fisher Scientific, RRID:AB_2534016) secondary antibodies were used. Images were acquired using a Leica TCS SP5 confocal microscope.
Immunohistochemical and immunofluorescence staining of human tumor specimen: Tissue sections of resected primary gliomas were obtained from the Department of Neuropathology in Heidelberg in accordance with local ethical approval. Sections were incubated with the anti-IDH1 R132H antibody (H09, Dianova, RRID:AB_2335716). 3 µm thin formalin-fixed paraffin-embedded and 100 µm thick sections formalin-fixed tissue sections were used for immunohistochemistry and immunofluorescence respectively.
Alamar blue proliferation assay: 1000 GBMSCs were seeded in 96-well plates and AlamarBlue Reagent (DAL1025, Thermo Fisher Scientific) was added on days 0, 1, 3, and 5. Fluorescence intensity (excitation: 560 nm; emission: 590 nm) was measured using a SpectraMax M5e microplate reader (Molecular Devices) after 3 h.
Image Processing: For image analysis and figures, images were processed using ZEN software (Zeiss, RRID:SCR_018163) and Imaris (Bitlane, RRID:SCR_007370). Image calculation and filtering was performed to reduce background noise. For figures, 3D stacks are transformed into orthogonal 2D maximum intensity projections (MIP).
Quantifications: All quantifications were performed manually in ImageJ (NIH, RRID:SCR_003070) and Imaris (Bitlane, RRID:SCR_007370) in high resolution (1024*1024 pixels) 3D z-stacks. Cells were regarded perivascular if the whole cell body was directly associated with a blood vessel. TM length of individual cells was measured by tracking TMs in z-stacks (3D images). For the mitotic index, mitotic events were analyzed in H2B-GFP expressing cells. The mitotic events were normalized to the distribution of cells in the parenchymal and perivascular compartment in the respective region, thereby assuming equal fractions in both compartments. The early reaction after single ablation was defined as the directed extension of TMs towards the damaged area within 100 minutes. For the quantification of the tumor/brain area ratio on MRI images, the tumor and the whole-brain area were measured manually in the image with the largest tumor expansion.
Statistics: Statistical analyses were performed using SigmaPlot (Systat Software, RRID:SCR_003210). Normal distribution of datasets was assessed with a Shapiro–Wilk test. Statistical significance of normally distributed data was assessed by a two-sided Student's t test. Non-normally distributed data were assessed with a Mann–Whitney rank-sum test. For datasets with > 2 groups ANOVA or ANOVA on ranks with the appropriate post hoc tests (Tukey's or Student–Newman–Keuls tests) were performed. Statistical details including can be found in the respective figure legends.