2.1 Clinical samples and data collection
Patients admitted to the Department of Vascular Surgery at Hebei General Hospital between January 2023 and June 2023 for severe carotid artery stenosis or lower limb varicose veins were retrospectively analyzed. Patients aged between 18 and 80 years old, with carotid artery severe stenosis or lower limb venous curvature who underwent surgical treatment, volunteered for this survey, and had complete case data were included in the study. Patients with liver or kidney dysfunction, hereditary hyperlipidemia, the use of drugs that may affect lipid metabolism levels, malignant neoplasms disease and hyperthyroidism were excluded from the study. The patients were categorized into two groups based on their disease: the arteriosclerosis group(AS group) and the non-arteriosclerosis group(Non-AS group). All patient were instructed to adhere to an 8-hour fasting period prior to specimen collection upon initial hospitalization. A volume of 5ml blood was obtained from the cubital vein, and serum lipid levels were quantified using an automated biochemical analyzer.The demographic data and serum lipid levels of the patients were subjected to statistical analysis. The carotid plaque and adjacent normal intimal tissue were obtained from patients who underwent carotid endarterectomy. The AS group consisted of carotid plaque samples, while adjacent normal intimal tissue was utilized as the control group.
2.2 Experimental animals
The male 10 ApoE−/− and 10 C57BL/6J mice (8weeks, SPF grade) were purchased from Changsheng Biotechnology Co., Ltd, (Liaoning, China, license number: SCXK (Liao) 2020-0001). All mice were raised at the Hebei General Hospital Animal Center. The breeding conditions are a light-controlled (12 h: 12 h light/dark alter) room with temperature 22 ± 1°C and humidity 40%-45%.
2.3 Model preparation and sample collection
After one week of adaptive rearing with regular rodent chow. The C57BL/6J mice were used as the control group (ND group), and the ApoE−/− mice were used as the model group (HFD group). The ApoE−/− mice were fed high-fat diet (ingredients: protein 24.2%, carbohydrates 40.1%, fat 27.4%, cholesterol 2%, total calorie ratio 4.7 kcal/gm) to establish the AS model, while the ND group was fed with regular rodent chow. The two groups mice were fed with the same quality of feed every day. After 8 weeks, the mice were anesthetized with 3% pentobarbital sodium after fasting overnight. Then, after weighing and collecting blood from the inner canthus, physiological saline was used to perfuse the left ventricle of mice, and the mice were sacrificed by cervical dislocation under anesthesia. Afterwards, the entire aorta were quickly dissected for subsequent detection of relevant indicators.
2.4 Cell processing and grouping
The THP-1 cell line was obtained from Starfish Biologicals and cultured in 1640 complete medium supplemented with 10% FBS and 1% PS at 37°C in a CO2 incubator (5%). For well plate inoculation experiments, THP-1 cells in the logarithmic growth phase were pre-induced into macrophages using PMA (500 ng/mL). The experimental groups included the blank control group, ox-LDL stimulation group, si-LY86 knockdown group, and si-LY86 knockdown + ox-LDL stimulation group. In all experiments, LY86 sequence was knocked down for 24 hours followed by stimulation with ox-LDL (50 µg/mL) for another 24 hours (siRNA from Reebok Biotech; ox-LDL from Yiyuan Biotech, YB-002).
2.5 Lipid Parameters
The blood samples were centrifuged at 4°C and 3000r/min for 15 minutes to obtain the supernatant. The levels of total cholesterol (T-CHO, batch A111-1-1 ), triglycerides (TG, batch A110-1-1), high density lipoprotein cholesterol (HDL-C, batch A112-1-1), and low density lipoprotein cholesterol (LDL-C, batch A113-1-1) were determined by a automatic biochemical analyzer (7600–020, Hitachi, Tokyo, Japan).
2.6 Immunohistochemistry and Immunofluorescence
The human tissues were embedded in paraffin and sectioned at a thickness of 5 µm. Following dewaxing and hydration, some tissues underwent HE staining, while the remaining tissue sections were subjected to LY86 staining after antigen retrieval with sodium citrate. False positives were minimized by dropwise addition of an appropriate amount of endogenous peroxidase blocker. The primary antibody (LY86, 1:10, Santa Cruz Biotechnology, F-5) was added dropwise and incubated at 37℃ for 1 h. Subsequently, reaction enhancement solution was added dropwise and incubated at 37℃ for 20 min. Enhanced enzyme-labeled goat anti-mouse/rabbit IgG polymers were then added dropwise and incubated at 37℃ for 20 minutes followed by DAB color development and restaining with hematoxylin. Finally, the slices were sealed, photographed using a microscope, and statistically analyzed using the Histochemistry Kit from ZSGB-BIO.
For immunofluorescence analysis, the aortic arch of mice were embedded in OCT and sectioned at a thickness of 4 µm. The tissue sections were washed with PBS for three times. Then the slices were permeabilized with 0.2% Triton X-100 and blocked in 5% normal donkey serum for 1 h and stained with primary antibody overnight. Next, the slices were washed with PBS for three times and incubated with the fluorescent-conjected secondary antibody for 1 h at room temperature. PBS was used to wash the slices for three times before using DAPI to stain the nucleus. Primary antibodies were: anti- LY86 (dilution: 1:50, Santa Cruz Biotechnology, C2918), anti- HMGCR (dilution: 1:100, PTMab PTM-6018), anti-CD68 (dilution: 1:100, Proteintech, 28058-1-AP), anti-GRP78 (dilution: 1:100, Proteintech, 11587-1-AP). Finally, the slices were observed with an Olympus IX71 fluorescence microscope (Olympus, Japan).
2.7 Western blots
Total proteins were extracted from human tissues or THP-1 cells treated with NP-40 lysate (Bohazel Bio). The protein samples were resolved using 10% SDS-PAGE fast gel (meilunbio) and transferred onto methanol-activated PVDF membranes (Merck & Millipore). Subsequently, the membranes were blocked with 5% skimmed milk for 1 hour, followed by overnight incubation at 4℃ with the primary antibodies. Afterward, HRP-coupled goat anti-mouse or rabbit IgG (Santa Cruz Biotechnology) was applied to the membrane for 1 hour at room temperature. Protein bands were visualized using an ECL chemiluminescence kit and captured using an imaging system. The gray values of the protein bands were quantified utilizing Image Lab software. The primary antibodies used in this study included: anti-LY86 (dilution: 1:500, Santa, C2918), anti-SREBP2 (dilution: 1:1000, Affinity, AF0450), anti-β-actin (dilution: 1:10000, Abclonal, AC026), anti-GRP78 (dilution: 1:1000, Affinity, AF5366), and anti-HMGCR (dilution: 1:1000 PTMab PTM-6018).
2.8 Cell transfection experiments
The THP-1 cells were seeded in six-well plates, and once the cells adhered to the surface, the medium was replaced with 1640 complete medium supplemented with 2% FBS. Complexes of siRNA (5 µL siRNA + 200 µL 1640 basal medium + 5 µL HighGene) were prepared in sterile, enzyme-free EP tubes and added to the well plates to achieve a final siRNA concentration of 50 nM. Half of the medium was exchanged after 5 hours, and the knockdown effect was assessed by Western blotting and qRT-PCR analysis after 24 hours.
2.9 Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) Assay
The RNA was extracted from human tissues or group-treated cells using Trizol reagent (TAKAZA). The concentration was determined using the microplate method, followed by reverse transcription of the appropriate amount of RNA (Vazyme, HiScript ® Ⅲ RT SuperMix for qPCR, R323). Subsequently, the cDNA was amplified in the X960 system (Sangon Biotech, SGExcel FastSYBR qPCR, B532955). The primer sequence used for LY86 amplification were as follows: Forward - GTTTCACAGCCACTCTCTTCCTC and Reverse – TTGTAATGGATCGCAACTCT -GGTAG. For quantitative analysis, β-actin served as an internal reference and 2−△△CT values were calculated for statistical analysis.
2.10 Oil Red O Staining
The oil red O storage solution was prepared by dissolving 1 g of oil red O powder in 100 mL of isopropanol. Subsequently, the oil red O storage solution was diluted and mixed with double-distilled water at a ratio of 3:2. After filtering impurities using qualitative filter paper under dark conditions, the solution was prepared for use. The cells and entire aorta were fixed with 4% paraformaldehyde for 10 min and washed twice with PBS. For cells, each well was treated with 1 mL of oil red O staining solution for 30 min. After discarding the staining solution, the cells were washed repeatedly with double-distilled water until the liquid became colorless and stained with hematoxylin. Finally, lipid droplet staining was observed under a microscope to confirm successful staining. The entire aorta was stained with oil red O for 30min, and then removed non-specific staining with 60% isopropanol. Cut the blood vessels along the midline and captured a tile image.
2.11 Data analysis
Statistical analysis was conducted using SPSS software (version 26.0, IBM, Chicago, IL, USA). The distribution of quantitative data was assessed using the Shapiro-Wilk test. Mean ± SD was used to present normally distributed data and compared between groups through an independent sample t-test or One-way ANOVA. Non-normally distributed measurement data were represented as M (Q1, Q3), and group comparisons were made using the Wilcoxon test. Qualitative data were expressed as numbers and percentages (n%) and analyzed for group differences with Fisher's exact probability test or Pearson's chi-square test. The criterion for statistical significance was set at P < 0.05.