1. Drug
Dexmedetomidine hydrochloride was provided by Gibco (Waltham, MA, USA), which was dissolved in ddH2O at a concentration of 1 mM in stock and then further diluted to final concentrations in the cell culture medium when used.
2. Cell lines
MDA-MB-231, MCF7, and MCF10A were provided by The American Type Culture Collection (Waltham, MA, USA). Cell lines were authenticated by analyzing the cell line through short tandem repeat (STR) profiling. STR profiling is a method of analyzing the DNA of a cell line to ensure its identity. Using this method, the entire genome of a cell line can be compared to a reference DNA profile to verify its identity. MDA-MB-231 and MCF7 are BrCa cell lines and MCF10A is normal breast cell lines. All cell lines were cultured in a DMEM (D5796, Gibco, MA, USA) containing 10% Fetal Bovine Serum (FBS) at 37°C and 5% CO2 condition. Cell lines were tested for mycoplasma contamination using the TransDetect PCR Mycoplasma Detection Kit (FM311-01, TransGen Biotech, Beijing, China).
3. Cell viability assay
To evaluate the effect of the gene on cell viability, the cell viability was measured using the CCK8 assay. Cells were collected and seeded in 96-well plates at 103 cells/well. The next day, dexmedetomidine (at testing concentrations) was added and cells were cultured for 48 h. Then Cell Counting Kit-8 (CCK8) solution (K1018, APExBIO, China) was added to each well. After 60 min incubation, the absorbance at 450 nm was measured using a microplate reader (DTX 800, Beckman Coulter, MA, USA). The OD blank was calibrated using the following formula:
cell viability = (OD value of experimental group - OD value of blank group) / OD value of blank group × 100%
The data is then normalized with the control group with no treatment. We defined the fold-change normalized absorbance at 450 nm as “cell viability”. The normalization method has been used in a previous paper[22].
4. Identification and analysis of dexmedetomidine targets
To identify the potential role of the gene, differential expression genes (DEG) analyses were used to identify DEG between TNBC and normal breast tissues from TCGA datasets (https://www.cancer.gov/about-nci/organization/ccg/research/structural-genomics/tcga). DEG was identified by the unpaired Student’s t-test, within the DESeq2 (3.8) package [46]. Genes with a P-value < 0.05 and an absolute fold change (FC) larger than 1.3 were considered to be statistically significant. All the DEG was presented in a volcano plot. To identify the target of the drug, the drug targets of dexmedetomidine were predicted using the SwissTargetPrediction(http://www.swisstargetprediction.ch/) [47, 48]. To identify the common targets, the intersection analysis was conducted using the EVenn (http://www.ehbio.com/test/venn/) [49]. The protein-protein interaction (PPI) network analysis was conducted using GeneMANIA(https://genemania.org/) [50]. Gene annotations of dexmedetomidine candidate targets in TNBC were from the GeneCard(https://www.genecards.org/) [51].
5. QPCR (quantitative polymerase chain reaction)
TNBC tissue samples were collected from patients with surgery previously by the Department following related regulations and laws with ethical approval. The total RNA of tissue or cell samples was isolated with QIAzol (79306, Invitrogen, Carlsbad, CA, USA). Reverse transcription was carried out with a reverse transcription kit (A3500, Promega, Madison, WI, USA). Reverse transcription is a process in which an enzyme, reverse transcriptase, is used to create a complementary DNA (cDNA) strand from an RNA template. The protocol typically involves the following steps: 1. Prepare the reaction mix: The reaction mix should contain reverse transcriptase, buffer, MgCl2, dNTPs, and the RNA template. 2. Incubate the reaction mix at the optimal temperature for reverse transcriptase (usually around 37°C). 3. Add the reverse transcriptase to the reaction mix and incubate for the recommended time (usually around 30 min). 4. Add the appropriate enzyme inhibitor (such as RNase inhibitor) to the reaction mix and incubate for the recommended time (usually around 10 min). 5. Heat inactivate the reverse transcriptase, usually by incubating at 75°C for 10 min. 6. Perform a final centrifugation step to separate the cDNA from the reaction mix. 7. Collect the cDNA and store it at -20°C until ready to use. RT-qPCR was performed with the LightCycler TM instrument (LightCycler® 480 Instrument II, Roche Applied Sciences, Indianapolis, IN, USA) according to the manufacturer's protocol and the primer property. The mRNA level of each target gene was normalized by internal reference glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Catalytic subunit of the DNA-dependent protein kinase (PRKDC), indoleamine 2,3-dioxygenase 1 (IDO1), opioid receptor kappa 1 (OPRK1), glutaminyl-peptide acyltransferase (QPCT), macrophage migration inhibitory factor (MIF), potassium voltage-gated channel, subfamily H (Eag-related), member 2 (KCNH2), cholinergic receptor, muscarinic 3 (CHRM3), and potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4 (KCNN4) were identified as dexmedetomidine targets in TNBC, hence their expression were determined. The relative expression levels were calculated using the 2 (−△△CT) method. The primer was designed using the Eurofins Genomic primer design tool. Primer sequences were as follows:
PRKDC:
F: 5'- CAGAAGGCTGCCACAGGAA − 3'
R: 5'- GCTGATCGTCTGAAGACCTC − 3'
IDO1:
F: 5'- TGCCTTCAGCTCCGTCACTT − 3'
R: 5'- GATCCCAGGTGAGGGGACAA − 3'
MIF:
F: 5'- CACATGCTGCCTGGCATTCT − 3'
R: 5'- GTCACTGTCTGCTGCTGCCA − 3'
KCNH2:
F: 5'- AGTGGCATCCATTGCTTCTC − 3'
R: 5'- AGTGCTGCCCAATGTCTGTC − 3'
CHRM3:
F: 5'- CAGCTAAAACCGGTGCTCCA − 3'
R: 5'- GCGTCTTGCATTGCTCACCA − 3'
KCNN:
F: 5'- CTCGGTACTTGGCCTTCATG − 3'
R: 5'- GCTTGGTGGTGGTCTTGCAT − 3'
GAPDH
F: 5'- TGAAGGTCGGAGTCAACGGATTTGGT − 3'
R: 5'- TGTAGACCATGTAGTTGAGGTCAATG − 3'
6. Western blotting
TNBC tissue samples were collected from patients with surgery previously by the Department following related regulations and laws with ethical approval. Tissue and cell samples were lysed in RIPA buffer. Protein samples were quantified by using a Bio-Rad DC protein assay kit II (5000112, Bio-Rad, Hercules, CA), separated by electrophoresis on 8–15% SDS-PAGE gel (NW0012C, Invitrogen, NY, USA), and electrotransferred onto a Hybond enhanced chemiluminescence (ECL) transfer membrane (Cytiva RPN2235, Amersham Pharmacia, Piscataway, NJ). After blocking with 3–5% non-fat skim milk, the membrane was probed with primary against Anti-PRKDC antibody (1:1000; abx011674, abbexa, MA, USA), Anti-IDO1 antibody (1:1000; HPA023149, Sigma-Aldrich, CA, USA), Anti-OPRK1 antibody (1:1000; STJ115970, St John's Laboratory Ltd, London, UK), Anti-QPCT antibody (1:1000; HPA008406, Sigma-Aldrich, CA, USA), Anti-MIF antibody (1:3000; orb11051, Biorbyt Ltd, Cambridge, UK), Anti-KCNH2 antibody (1:5000; PA5-33867 Thermo Fisher Scientific Inc., MA, USA), Anti-CHRM3 antibody (1:1000; PA1-86940, Thermo Fisher Scientific Inc., MA, USA), and Anti-KCNN4 antibody (1:1000; NBP2-33694, Novus Biologicals, CO, USA) or GAPDH (1:10,000; #HC301-02; TransGen Biotech) overnight at 4°C, and exposed to horseradish peroxidase (HRP)-conjugated secondary antibodies. Goat Anti-Mouse IgG, Peroxidase-Conjugated (1:1000; BL001A; Biosharp, Hefei, China) and Goat Anti-Rabbit IgG, Peroxidase-Conjugated (1:30,000; BL003A; Biosharp, Hefei, China) were used as secondary antibodies. Protein expression was measured by using the ECL system. The western blot image was analyzed using the Volume Box Tools method with GelDoc Go Imaging System, and the protein expression was normalized with the expression level of GAPDH.
7. Immunostaining
To validate the protein expression in the tissue samples, immunostaining was used to observe the expression of proteins in TNBC tissues and normal breast tissues (adjacent tissue paired with the TNBC tissues). The breast cancer samples and para-cancer normal breast tissue samples were collected from 33 TNBC patients with surgical treatment or biopsy from the Second Hospital University of South China. The supplementary materials provided the details of the patients involved in the study. The samples were preserved by fixing, embedding them in paraffin wax, and keeping them at 4°C. All donors were aged 18 or over and had provided written consent for the use of their samples. The project had received approval from the Ethics Committee at The Second Hospital University of South China. All the samples in paraffin were sliced into slides with paraffin sections which were deparaffinized and dehydrated. Deparaffinization and dehydration of paraffin sections typically involve the use of a sequence of solvents and alcohols of increasing strength. The solvents used in this process usually include xylene and a graded series of ethanol solutions ranging from 50–100%. Incubated 0.3% hydrogen peroxide for 15 min, then slides were boiled in 10 mM citrate buffer (pH 6.0) for 10 min in a microwave, incubated 10% normal rabbit serum (Gibco, MA, USA) for 30 min, and finally, incubated slides with antibodies overnight at 4°C. The tissues were stained with primary antibodies at 1:100 overnight at 4°C followed by the incubation of secondary antibodies at 1:500 overnight at 4°C. DAB (brown) was used to stain the proteins.
8. Antibodies
Anti-PRKDC antibody (abx011674, abbexa, MA, USA), Anti-IDO1 antibody (HPA023149, Sigma-Aldrich, CA, USA), Anti-OPRK1 antibody (STJ115970, St John's Laboratory Ltd, London, UK), Anti-QPCT antibody (HPA008406, Sigma-Aldrich, CA, USA), Anti-MIF antibody (orb11051, Biorbyt Ltd, Cambridge, UK), Anti-KCNH2 antibody (PA5-33867 Thermo Fisher Scientific Inc., MA, USA), Anti-CHRM3 antibody (PA1-86940, Thermo Fisher Scientific Inc., MA, USA), and Anti-KCNN4 antibody (NBP2-33694, Novus Biologicals, CO, USA).
9. Plasmids and transfection of cells
To overexpress or knock down gene expression, all the plasmids were designed and constructed by GenScript (Nanjing, China). The plasmids were customized and modified pCMV (item number 44154214). The silencing of endogenous proteins was achieved by transfecting plasmids expressing short hairpin RNA (shRNA- TGGAGATGTCCGTAAGGTCTTGCCAAGAAATATTGCTGTTC). The compensation of genes was achieved by transfecting plasmids expressing the exogenous mRNA. The overexpression of genes was conducted as the compensation experiment. All the plasmids were transfected into MDA-MB-231, MCF7, and MCF10A cells with Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) for 48h before experiments. Lipofectamine 3000 is a transfection reagent used to introduce DNA or RNA into eukaryotic cells. It is used in a two-step process. First, mix the DNA or RNA with Lipofectamine 3000 reagent in a serum-free medium. Then, combine the mixture with the cells in a culture dish. Incubate for the recommended amount of time. Finally, change the medium and incubate for the desired amount of time before harvesting the cells or analyzing them. Wild-type genes (such as wild-type IDO1), mean the gene sequence was not changed.
10. Protein-ligand docking
To predict the binding of the protein and drug, the protein-ligand docking was used to dock the binding of dexmedetomidine candidate targets and dexmedetomidine in TNBC. The protein structures were downloaded from the Alpha-Fold [52]. The protein used was IDO1. The AutoDock Vina (1.1.2) [53, 54] was used to dock the protein-ligand binding. Protein-ligand interactions were analyzed using the PLIP [55].
11. Statistical analysis
The results were expressed as means ± standard deviation from at least three independent experiments. Statistical analyses of comparisons between groups were conducted by One-way ANOVA or Student's t-test using SigmaPlot version 12 (Systat Software Inc., San Jose, CA, USA). Turkey’s post hoc comparisons were conducted. P-value < 0.05 was considered statistically significant.